ID: 995211965

View in Genome Browser
Species Human (GRCh38)
Location 5:109550973-109550995
Sequence CCTGGACTTTATTGCCCATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995211965_995211971 1 Left 995211965 5:109550973-109550995 CCATATGGGCAATAAAGTCCAGG No data
Right 995211971 5:109550997-109551019 TGAGGTTTCAGGTGGAAATGAGG No data
995211965_995211975 26 Left 995211965 5:109550973-109550995 CCATATGGGCAATAAAGTCCAGG No data
Right 995211975 5:109551022-109551044 CTTGTTGGGAACTGGAGCAAAGG No data
995211965_995211974 18 Left 995211965 5:109550973-109550995 CCATATGGGCAATAAAGTCCAGG No data
Right 995211974 5:109551014-109551036 ATGAGGAACTTGTTGGGAACTGG No data
995211965_995211969 -7 Left 995211965 5:109550973-109550995 CCATATGGGCAATAAAGTCCAGG No data
Right 995211969 5:109550989-109551011 GTCCAGGCTGAGGTTTCAGGTGG No data
995211965_995211973 12 Left 995211965 5:109550973-109550995 CCATATGGGCAATAAAGTCCAGG No data
Right 995211973 5:109551008-109551030 GTGGAAATGAGGAACTTGTTGGG No data
995211965_995211972 11 Left 995211965 5:109550973-109550995 CCATATGGGCAATAAAGTCCAGG No data
Right 995211972 5:109551007-109551029 GGTGGAAATGAGGAACTTGTTGG No data
995211965_995211968 -10 Left 995211965 5:109550973-109550995 CCATATGGGCAATAAAGTCCAGG No data
Right 995211968 5:109550986-109551008 AAAGTCCAGGCTGAGGTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995211965 Original CRISPR CCTGGACTTTATTGCCCATA TGG (reversed) Intergenic