ID: 995211966

View in Genome Browser
Species Human (GRCh38)
Location 5:109550973-109550995
Sequence CCATATGGGCAATAAAGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995211960_995211966 18 Left 995211960 5:109550932-109550954 CCTAGAGACTTGTTGAATGGCTT No data
Right 995211966 5:109550973-109550995 CCATATGGGCAATAAAGTCCAGG No data
995211961_995211966 -7 Left 995211961 5:109550957-109550979 CCCAAAATGCTGATAGCCATATG No data
Right 995211966 5:109550973-109550995 CCATATGGGCAATAAAGTCCAGG No data
995211962_995211966 -8 Left 995211962 5:109550958-109550980 CCAAAATGCTGATAGCCATATGG No data
Right 995211966 5:109550973-109550995 CCATATGGGCAATAAAGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995211966 Original CRISPR CCATATGGGCAATAAAGTCC AGG Intergenic