ID: 995211967 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:109550979-109551001 |
| Sequence | GGGCAATAAAGTCCAGGCTG AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 995211962_995211967 | -2 | Left | 995211962 | 5:109550958-109550980 | CCAAAATGCTGATAGCCATATGG | No data | ||
| Right | 995211967 | 5:109550979-109551001 | GGGCAATAAAGTCCAGGCTGAGG | No data | ||||
| 995211961_995211967 | -1 | Left | 995211961 | 5:109550957-109550979 | CCCAAAATGCTGATAGCCATATG | No data | ||
| Right | 995211967 | 5:109550979-109551001 | GGGCAATAAAGTCCAGGCTGAGG | No data | ||||
| 995211960_995211967 | 24 | Left | 995211960 | 5:109550932-109550954 | CCTAGAGACTTGTTGAATGGCTT | No data | ||
| Right | 995211967 | 5:109550979-109551001 | GGGCAATAAAGTCCAGGCTGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 995211967 | Original CRISPR | GGGCAATAAAGTCCAGGCTG AGG | Intergenic | ||