ID: 995211968 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:109550986-109551008 |
| Sequence | AAAGTCCAGGCTGAGGTTTC AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 995211961_995211968 | 6 | Left | 995211961 | 5:109550957-109550979 | CCCAAAATGCTGATAGCCATATG | No data | ||
| Right | 995211968 | 5:109550986-109551008 | AAAGTCCAGGCTGAGGTTTCAGG | No data | ||||
| 995211962_995211968 | 5 | Left | 995211962 | 5:109550958-109550980 | CCAAAATGCTGATAGCCATATGG | No data | ||
| Right | 995211968 | 5:109550986-109551008 | AAAGTCCAGGCTGAGGTTTCAGG | No data | ||||
| 995211965_995211968 | -10 | Left | 995211965 | 5:109550973-109550995 | CCATATGGGCAATAAAGTCCAGG | No data | ||
| Right | 995211968 | 5:109550986-109551008 | AAAGTCCAGGCTGAGGTTTCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 995211968 | Original CRISPR | AAAGTCCAGGCTGAGGTTTC AGG | Intergenic | ||