ID: 995211968

View in Genome Browser
Species Human (GRCh38)
Location 5:109550986-109551008
Sequence AAAGTCCAGGCTGAGGTTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995211961_995211968 6 Left 995211961 5:109550957-109550979 CCCAAAATGCTGATAGCCATATG No data
Right 995211968 5:109550986-109551008 AAAGTCCAGGCTGAGGTTTCAGG No data
995211962_995211968 5 Left 995211962 5:109550958-109550980 CCAAAATGCTGATAGCCATATGG No data
Right 995211968 5:109550986-109551008 AAAGTCCAGGCTGAGGTTTCAGG No data
995211965_995211968 -10 Left 995211965 5:109550973-109550995 CCATATGGGCAATAAAGTCCAGG No data
Right 995211968 5:109550986-109551008 AAAGTCCAGGCTGAGGTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995211968 Original CRISPR AAAGTCCAGGCTGAGGTTTC AGG Intergenic