ID: 995211971

View in Genome Browser
Species Human (GRCh38)
Location 5:109550997-109551019
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995211965_995211971 1 Left 995211965 5:109550973-109550995 CCATATGGGCAATAAAGTCCAGG No data
Right 995211971 5:109550997-109551019 TGAGGTTTCAGGTGGAAATGAGG No data
995211962_995211971 16 Left 995211962 5:109550958-109550980 CCAAAATGCTGATAGCCATATGG No data
Right 995211971 5:109550997-109551019 TGAGGTTTCAGGTGGAAATGAGG No data
995211961_995211971 17 Left 995211961 5:109550957-109550979 CCCAAAATGCTGATAGCCATATG No data
Right 995211971 5:109550997-109551019 TGAGGTTTCAGGTGGAAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type