ID: 995211973

View in Genome Browser
Species Human (GRCh38)
Location 5:109551008-109551030
Sequence GTGGAAATGAGGAACTTGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995211962_995211973 27 Left 995211962 5:109550958-109550980 CCAAAATGCTGATAGCCATATGG No data
Right 995211973 5:109551008-109551030 GTGGAAATGAGGAACTTGTTGGG No data
995211970_995211973 -6 Left 995211970 5:109550991-109551013 CCAGGCTGAGGTTTCAGGTGGAA No data
Right 995211973 5:109551008-109551030 GTGGAAATGAGGAACTTGTTGGG No data
995211961_995211973 28 Left 995211961 5:109550957-109550979 CCCAAAATGCTGATAGCCATATG No data
Right 995211973 5:109551008-109551030 GTGGAAATGAGGAACTTGTTGGG No data
995211965_995211973 12 Left 995211965 5:109550973-109550995 CCATATGGGCAATAAAGTCCAGG No data
Right 995211973 5:109551008-109551030 GTGGAAATGAGGAACTTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995211973 Original CRISPR GTGGAAATGAGGAACTTGTT GGG Intergenic