ID: 995215665

View in Genome Browser
Species Human (GRCh38)
Location 5:109591714-109591736
Sequence CGGGGCTTTCAGCAAAGACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995215661_995215665 -1 Left 995215661 5:109591692-109591714 CCTCTACTTCTGGGAGGAATCAC No data
Right 995215665 5:109591714-109591736 CGGGGCTTTCAGCAAAGACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995215665 Original CRISPR CGGGGCTTTCAGCAAAGACT TGG Intergenic
No off target data available for this crispr