ID: 995229250

View in Genome Browser
Species Human (GRCh38)
Location 5:109740054-109740076
Sequence CAGGCTTAACAAAGGGCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 159}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995229250 Original CRISPR CAGGCTTAACAAAGGGCTGG AGG (reversed) Intronic
900834794 1:4993078-4993100 GAGGCATCTCAAAGGGCTGGGGG - Intergenic
900924720 1:5697533-5697555 CAACCTTATGAAAGGGCTGGAGG + Intergenic
902661215 1:17905348-17905370 CAGGCTTCACAGAGGTCTGTTGG - Intergenic
903766052 1:25735031-25735053 CAGCTTGAAGAAAGGGCTGGAGG + Intronic
904459509 1:30667824-30667846 CAGGATTAACACAGGGTTGCTGG - Intergenic
905559617 1:38916157-38916179 CTGCCTTAACCAAGGGATGGAGG + Intronic
906608595 1:47187423-47187445 CAGGCCTAACAAAGGGAGAGGGG + Exonic
907048365 1:51313667-51313689 CAGGCTGGGCAAAGGCCTGGAGG - Intronic
910341605 1:86194613-86194635 CAGGCTCCACAAAGGACTGTTGG - Intergenic
912582714 1:110734873-110734895 TTGGCTTAACAAAGGGCAAGTGG + Intergenic
913080249 1:115378088-115378110 CTTGCTTAACAAAGGGATGAGGG + Intergenic
914946699 1:152073194-152073216 CAGCATTAACAAAGGCATGGAGG - Intergenic
917452119 1:175155945-175155967 CAGCCTCAAAAGAGGGCTGGAGG + Intergenic
918153014 1:181814798-181814820 CACCCTTATAAAAGGGCTGGAGG - Intergenic
922815615 1:228446738-228446760 ATAGCTTAACAAAGGGCGGGAGG - Intergenic
1063067084 10:2621045-2621067 CAGGCCACACAAAGGGCTGGGGG + Intergenic
1064930101 10:20615544-20615566 TAGGATTAACAAAGGTCTGTAGG + Intergenic
1065590451 10:27257011-27257033 CTGGCTTTACATAGGCCTGGTGG - Intergenic
1065642946 10:27803745-27803767 CATGCTCAACAAATGGCTGTTGG + Intergenic
1065963587 10:30753493-30753515 CAGGCTTAGCACACGGCTGCAGG - Intergenic
1066173589 10:32879452-32879474 CAGCCTTAAGGAAGGGCTTGGGG + Intronic
1069604928 10:69732950-69732972 CAGGCTGAACAAAGGCCCAGAGG + Intergenic
1069951168 10:72019181-72019203 CAACCTTATGAAAGGGCTGGAGG + Intergenic
1072519795 10:96221311-96221333 CAGGCTAAACAGAGAGCTGGAGG - Intronic
1072548847 10:96461600-96461622 GAGGCTAAACAAAGGCATGGAGG - Intronic
1073185996 10:101615350-101615372 CAGGATCCACTAAGGGCTGGGGG + Intronic
1076322351 10:129592729-129592751 CTGGCTTAACAGAAGGCAGGTGG - Intronic
1076478127 10:130766705-130766727 GGTGCTTACCAAAGGGCTGGAGG + Intergenic
1078763674 11:14273089-14273111 CAGGCCTTCCAAAGTGCTGGCGG - Intergenic
1079030010 11:16979607-16979629 AAGGCTTTAGAAAGGGTTGGAGG - Intronic
1080245251 11:30172866-30172888 CAGGCTCAGAAATGGGCTGGTGG - Intergenic
1081620514 11:44616606-44616628 CAGGCTCAGCAAAGGTCTAGCGG - Intronic
1089306315 11:117528492-117528514 CAGGCTTGAGAAACTGCTGGGGG + Intronic
1093930045 12:24947048-24947070 CTGGCCTAACAAAAGGGTGGTGG - Intronic
1096678823 12:53241633-53241655 CAGTGTGAACAAAGGACTGGAGG + Intergenic
1097066473 12:56324297-56324319 CAGGCTTATCGAGGTGCTGGAGG - Exonic
1099320932 12:81147643-81147665 CAGGTTTAGAAAAGGGGTGGAGG + Intronic
1101570512 12:105949159-105949181 CAACCTTACAAAAGGGCTGGAGG + Intergenic
1101889895 12:108703844-108703866 CAGGAGGAACAAGGGGCTGGAGG - Intronic
1103415569 12:120739920-120739942 CAGACTTTACAAAGGGCTGAGGG - Exonic
1104648603 12:130514643-130514665 CAGGCTGACGACAGGGCTGGTGG - Intronic
1108041718 13:46345503-46345525 CAGGATCAAGAAAGGGCTGCTGG - Exonic
1108379479 13:49842378-49842400 TAGCCTTATAAAAGGGCTGGAGG + Intergenic
1109176655 13:59166189-59166211 TAGGATTTACAAAGGGATGGAGG + Intergenic
1114431004 14:22660527-22660549 CAACCTTATAAAAGGGCTGGAGG - Intergenic
1118946414 14:70391892-70391914 CTGGCTGAACAAAGGGCTTCAGG - Intronic
1121666734 14:95677911-95677933 CAGGCAGGAGAAAGGGCTGGAGG + Intergenic
1121827957 14:97026258-97026280 CAGGCTTACCAAAGGGAAGTGGG + Intergenic
1122440060 14:101725569-101725591 CAGGCTTAAAAAAGGACATGTGG + Intergenic
1122607559 14:102957534-102957556 CAGGCTTATCAAAGATCTGGCGG + Intronic
1122706975 14:103628102-103628124 CAGGGTTCACAAAGGGCTGCTGG + Intronic
1127604787 15:60575560-60575582 AAAGCTTACCAAAGGGCAGGAGG - Intronic
1127757190 15:62104213-62104235 CTGGCTTAAAAGAGGGCTTGGGG - Intergenic
1128475988 15:67997226-67997248 CAGGCTGGGCAATGGGCTGGAGG - Intergenic
1129203282 15:74019052-74019074 CAGTCTTACCAGAGGGCTGGGGG + Intronic
1131513061 15:93060208-93060230 AAGGCTTACCAAGGGGCCGGAGG - Intronic
1132537042 16:487413-487435 CAGGCTTAAACCAGGGCCGGGGG - Intronic
1132802371 16:1760782-1760804 TTGGCTGATCAAAGGGCTGGAGG - Intronic
1132941323 16:2509875-2509897 AAGCCATCACAAAGGGCTGGGGG - Intronic
1133406364 16:5527685-5527707 CAGACTTAGGAAAGGGCTGTGGG + Intergenic
1134241240 16:12508656-12508678 CAGGCTTAACAGAGGGCACCAGG - Intronic
1135984145 16:27171393-27171415 CAGGATGTACAAAGGCCTGGAGG + Intergenic
1137462506 16:48678263-48678285 AAGGCTTCACTATGGGCTGGAGG - Intergenic
1144626010 17:16844823-16844845 CAGGCTCAACAAACCGCAGGGGG - Intergenic
1144925383 17:18802609-18802631 CAAACATAAAAAAGGGCTGGTGG - Intronic
1145291377 17:21549277-21549299 CAGGGTTTACACAGGGGTGGGGG + Intronic
1145388698 17:22437776-22437798 CAGGGTTTACACAGGGGTGGGGG - Intergenic
1146693090 17:34890023-34890045 CAGCATTTACAAAGGCCTGGAGG - Intergenic
1147571707 17:41575571-41575593 GAGGCTTAAGACAGGGCTGGAGG - Intergenic
1148218525 17:45846980-45847002 CACGCCTCTCAAAGGGCTGGTGG + Exonic
1148382607 17:47210530-47210552 CAGCCTTAGGACAGGGCTGGGGG + Intronic
1148959982 17:51384967-51384989 CACGCTTAGGACAGGGCTGGGGG - Intergenic
1153024297 18:658795-658817 CAGCCTTGACACAGGGGTGGAGG + Intronic
1153054707 18:934546-934568 CAGACTTTACAAAGGGCTCTTGG + Intergenic
1156244876 18:35288794-35288816 GAGGCTTACCAACGGGCAGGAGG + Intronic
1157266809 18:46231368-46231390 TAGACTTGACAAATGGCTGGAGG + Intronic
1160789773 19:918043-918065 TCAGCTGAACAAAGGGCTGGGGG + Intronic
1160872736 19:1284543-1284565 CAGCCTGAACAAAGGTCAGGTGG + Intergenic
1161305675 19:3566243-3566265 CTGGCAGAACACAGGGCTGGTGG - Intronic
1162473185 19:10884614-10884636 CAGGCCTAACCCAGGGCTGAAGG + Intronic
1163588500 19:18177056-18177078 CAGGCTTGGCTCAGGGCTGGTGG + Intronic
1164658392 19:29941270-29941292 GAGGCTGTACAAAGGGCTGTAGG + Intronic
927279154 2:21288478-21288500 CAGAGTGAACAAAGGGCTGTAGG + Intergenic
933835824 2:86244754-86244776 GAGGGTTAACAAAGGGCTTGGGG + Intronic
938201428 2:129376026-129376048 AAGGCTGAACACAGGGCTGAGGG - Intergenic
938319270 2:130352176-130352198 CAGCCTCCACAAAGAGCTGGGGG + Intergenic
940843643 2:158615352-158615374 CAGGCTTCATAAATGGCTGAGGG - Intronic
941162452 2:162051675-162051697 CAGCCTTGACACAGGGGTGGTGG + Intronic
947328881 2:229007435-229007457 CAGGTTTGAAAAAGGGCTTGTGG + Intronic
947463585 2:230323170-230323192 CGGGCTGAACAGAGGGCAGGCGG + Intergenic
947472421 2:230411733-230411755 CGGGCTGAACAGAGGGCAGGCGG + Intergenic
1170610365 20:17907791-17907813 CAGCCTTATGAAAGGGCTGGAGG - Intergenic
1171163594 20:22951295-22951317 CAGGCTTAAACAAAGTCTGGAGG + Intergenic
1171969106 20:31552280-31552302 CAGCTTCAGCAAAGGGCTGGAGG + Intronic
1172225569 20:33303046-33303068 CAGGGTGAACAAAGGGCGGAGGG - Exonic
1173705158 20:45104799-45104821 CAGGGTAAAGAAAGGGCAGGAGG - Intergenic
1175642483 20:60642670-60642692 CAGGCTGACCAAGGGGCTGTGGG - Intergenic
1176134874 20:63518122-63518144 CAGGCTTCCCACAGGGCGGGAGG - Intergenic
1177264766 21:18768055-18768077 CAGGCTTAACAAAGGGTTACAGG + Intergenic
1181646310 22:24233264-24233286 CAGGCTGGACAAAGGCCTGGAGG - Intronic
1182030974 22:27159205-27159227 CAGGATTTGCAAAGGGCTTGGGG + Intergenic
1183604106 22:38858742-38858764 CAGACTTCAAAAAGGCCTGGTGG - Intergenic
1183796362 22:40121745-40121767 AAGCCTTAGCAAAGGGTTGGGGG - Intronic
950548218 3:13651656-13651678 CAGGCTGAACACAGGGCTGTAGG - Intergenic
951114508 3:18844253-18844275 CAGCTTTACCACAGGGCTGGGGG + Intergenic
952575356 3:34767929-34767951 CAGGTTTATCAAAGGGCAGATGG - Intergenic
953376037 3:42429347-42429369 CAGCCATCTCAAAGGGCTGGTGG + Intergenic
953404198 3:42652571-42652593 CAAGCTGCAGAAAGGGCTGGAGG - Intergenic
954905268 3:54056907-54056929 GAGGATTAAGGAAGGGCTGGTGG - Intergenic
956352645 3:68354840-68354862 CTGGCTTATAAAAGGGCTTGAGG - Intronic
961533162 3:127552345-127552367 CAGGCCTCACACATGGCTGGGGG - Intergenic
963969750 3:151416410-151416432 CAGGCCTTACCAAGGGCTGCTGG - Exonic
964872037 3:161323912-161323934 CAGGCTTACCAAAAGGCTGAAGG + Intergenic
967363834 3:188663304-188663326 CAGACTCAAGAAAGGGATGGGGG + Intronic
967995629 3:195164359-195164381 AGGGCTGAACAAAGGTCTGGAGG - Intronic
969523678 4:7693361-7693383 CAGCCTTGGCAAAGGGGTGGTGG - Intronic
970016630 4:11519439-11519461 CAGGCTTGTCAGAGGGTTGGGGG - Intergenic
971748987 4:30622052-30622074 CAGCATGAACAAAGGGCTGTGGG - Intergenic
972914676 4:43860953-43860975 CAACCTTATAAAAGGGCTGGTGG + Intergenic
973191933 4:47395240-47395262 CAGGCTATACAAAGGCTTGGAGG + Intronic
973214093 4:47649344-47649366 CAGGCTAAAGCATGGGCTGGGGG - Intronic
979543537 4:121914242-121914264 CTGAATTAACAAAGGGCTAGGGG + Intronic
979748348 4:124244741-124244763 GAGACTTATGAAAGGGCTGGAGG + Intergenic
986609511 5:9552635-9552657 GTGGCTTATAAAAGGGCTGGAGG - Intergenic
989990126 5:50753973-50753995 CAGCCTTAACAAAGATCTGTAGG + Intronic
990803058 5:59627541-59627563 CTGGCTTAACAAAAGGCTTTGGG - Intronic
991424371 5:66475548-66475570 CAGTATTAAGAAAGGGCTTGTGG + Intergenic
994059236 5:95455786-95455808 CAGCCTGAGCAAAGGCCTGGAGG + Intergenic
994670152 5:102754692-102754714 CAGGCTGGAGCAAGGGCTGGGGG + Intronic
995229250 5:109740054-109740076 CAGGCTTAACAAAGGGCTGGAGG - Intronic
996748985 5:126870531-126870553 CAGGCTTAAGGAAGGGCTTGGGG + Exonic
1000912745 5:167042024-167042046 CAGGCTGACCAATGTGCTGGGGG + Intergenic
1001777283 5:174338059-174338081 GAGGCTGATCAAAGGGCTGAAGG + Intergenic
1007528931 6:42522859-42522881 TTGGCTTAACACATGGCTGGAGG - Intergenic
1009850810 6:69195743-69195765 CAGACTGAACAAAGTCCTGGTGG + Intronic
1011716431 6:90110074-90110096 CTGGCTTAACAGAGGACTGCTGG + Intronic
1011735216 6:90303462-90303484 CATGATTAAGAAAGGTCTGGTGG + Intergenic
1012325444 6:97910593-97910615 CAGGCCTAAGAAAGGCCTGGTGG + Intergenic
1017777094 6:157688951-157688973 CTGGCTTAACAAAAGCCTGCTGG - Intergenic
1018170576 6:161140206-161140228 CATGAATGACAAAGGGCTGGAGG + Intronic
1018826129 6:167409005-167409027 CCGGCTTGGCACAGGGCTGGTGG + Intergenic
1019518442 7:1449911-1449933 CAGGCAGAACAAGGGTCTGGGGG - Intronic
1021759941 7:23893991-23894013 CTGCCATATCAAAGGGCTGGTGG - Intergenic
1022113955 7:27246926-27246948 AAGGCATGACAAGGGGCTGGTGG + Intronic
1023123160 7:36929535-36929557 CATGCTTAATAAAGGTTTGGAGG - Intronic
1023840904 7:44097012-44097034 CAGGCTCACCCCAGGGCTGGAGG + Intergenic
1024827268 7:53405962-53405984 CAGTCTTATAAAAGGGCTGGAGG + Intergenic
1026890235 7:73977454-73977476 CTGGCTGAAGAAAGGGCAGGTGG + Intergenic
1027859410 7:83556831-83556853 GAGCCTTACAAAAGGGCTGGAGG + Intronic
1029248404 7:99218974-99218996 AAGGCTGACCAAGGGGCTGGAGG - Intergenic
1029798323 7:102919215-102919237 AATGCTTAACAACTGGCTGGTGG - Intronic
1031379067 7:121062483-121062505 CAGAATTTAAAAAGGGCTGGAGG - Intronic
1034352324 7:150424913-150424935 CAACCTTATAAAAGGGCTGGAGG + Intergenic
1037627693 8:20622397-20622419 ATGGCTTAACAAAGGGTTGGTGG - Intergenic
1040984549 8:53279577-53279599 CTGCCTTATGAAAGGGCTGGAGG + Intergenic
1041016675 8:53598382-53598404 CAACCTTATGAAAGGGCTGGAGG - Intergenic
1041113676 8:54512434-54512456 CACCCTTATCAAAGGGCTGTAGG + Intergenic
1044508991 8:93053564-93053586 CAGGCTTATCAAAGATCTGATGG + Intergenic
1049249100 8:141578650-141578672 CAGTCTTCAGAATGGGCTGGTGG - Intergenic
1049880460 8:145058615-145058637 CAGGATCAACAATGGGCTGTGGG - Intergenic
1051739479 9:20237722-20237744 CAGTCTTAATAAAGTGCAGGGGG + Intergenic
1052915852 9:33923878-33923900 CAGGATTCACGAAGGGCTGCTGG + Exonic
1056032530 9:82567795-82567817 CGGCCTTAAAAAAGGGATGGTGG - Intergenic
1056581321 9:87889504-87889526 AAGGCTGAACCAAGTGCTGGTGG - Intergenic
1056910630 9:90696927-90696949 GAGGCGTAACTCAGGGCTGGGGG - Intergenic
1059742039 9:117161302-117161324 CAGATACAACAAAGGGCTGGGGG + Intronic
1060233592 9:121843562-121843584 CATGCTTCAGAAAGGGGTGGGGG + Intronic
1060495859 9:124118204-124118226 CAAGATTAACAAAGGGCTCTGGG + Intergenic
1061683883 9:132259231-132259253 CATGCTTCTCAAAGGGCTGGAGG - Intergenic
1185715030 X:2334838-2334860 CAGGGTTCACAAAGGCTTGGAGG - Intronic
1186364522 X:8877345-8877367 CAACCTTATAAAAGGGCTGGAGG + Intergenic
1188092393 X:25978988-25979010 CAGACAAAACAAAGGGATGGAGG + Intergenic
1190369799 X:49729865-49729887 CAACCTTATAAAAGGGCTGGAGG + Intergenic
1192225120 X:69222448-69222470 CAAGCTAAATAAAGAGCTGGTGG + Intergenic
1192246785 X:69379407-69379429 CAGGGTTAGAAAAGGCCTGGAGG + Intergenic
1194779634 X:98009232-98009254 CAGCCTTATAAAAGGGCTGGAGG - Intergenic
1195031183 X:100929059-100929081 CAGGATGAAGAAAAGGCTGGAGG + Intronic
1195615259 X:106906752-106906774 GAAGCATAACAAATGGCTGGAGG - Intronic
1200056494 X:153464101-153464123 CAGGCTTGTCAGAGGGCAGGTGG - Intronic