ID: 995230226

View in Genome Browser
Species Human (GRCh38)
Location 5:109752858-109752880
Sequence GATTATTAACAAATGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995230222_995230226 0 Left 995230222 5:109752835-109752857 CCAGGCATCATGGAGGAGAAATG 0: 1
1: 0
2: 2
3: 35
4: 275
Right 995230226 5:109752858-109752880 GATTATTAACAAATGGAGCTGGG No data
995230221_995230226 1 Left 995230221 5:109752834-109752856 CCCAGGCATCATGGAGGAGAAAT 0: 1
1: 0
2: 1
3: 42
4: 259
Right 995230226 5:109752858-109752880 GATTATTAACAAATGGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995230226 Original CRISPR GATTATTAACAAATGGAGCT GGG Intronic
No off target data available for this crispr