ID: 995231739

View in Genome Browser
Species Human (GRCh38)
Location 5:109772463-109772485
Sequence GATGAATTGAGATCAAACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 146}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995231735_995231739 13 Left 995231735 5:109772427-109772449 CCTCAGATCCATATATCACCTTC 0: 1
1: 0
2: 0
3: 15
4: 158
Right 995231739 5:109772463-109772485 GATGAATTGAGATCAAACACAGG 0: 1
1: 0
2: 2
3: 18
4: 146
995231737_995231739 -5 Left 995231737 5:109772445-109772467 CCTTCGTTTTGACCTGATGATGA 0: 1
1: 0
2: 0
3: 9
4: 74
Right 995231739 5:109772463-109772485 GATGAATTGAGATCAAACACAGG 0: 1
1: 0
2: 2
3: 18
4: 146
995231736_995231739 5 Left 995231736 5:109772435-109772457 CCATATATCACCTTCGTTTTGAC 0: 1
1: 0
2: 0
3: 10
4: 139
Right 995231739 5:109772463-109772485 GATGAATTGAGATCAAACACAGG 0: 1
1: 0
2: 2
3: 18
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995231739 Original CRISPR GATGAATTGAGATCAAACAC AGG Intronic
901269478 1:7940847-7940869 GAGGACTTCAGGTCAAACACAGG + Exonic
901526729 1:9827773-9827795 GATGAAATGAGATCACATGCAGG + Intergenic
902743935 1:18460434-18460456 GATGACCTGAGATCAAATTCTGG - Intergenic
907639269 1:56169459-56169481 GAGGAATTGAGGTCAAACTCAGG + Intergenic
908986080 1:70023500-70023522 GTTAAATTGAGATAAAACACTGG - Intronic
912410892 1:109480043-109480065 GATGACTGGAGATCAGACGCAGG - Exonic
912756368 1:112328266-112328288 GATGAATGGAAATGAAAGACAGG - Intergenic
919045351 1:192444336-192444358 AATGAGTTGAGATTAAAGACAGG - Intergenic
919173454 1:193988281-193988303 GATAAATTGAGAACAAAGAGAGG + Intergenic
923758589 1:236817672-236817694 GATAAAATGTGATCTAACACAGG - Intronic
924032939 1:239905407-239905429 GATTAAATGAGATAATACACTGG + Intronic
1064306305 10:14169960-14169982 CATGAATTCAGATCAAGCACTGG - Intronic
1065475752 10:26136254-26136276 TATGACTTGAAAACAAACACAGG + Intronic
1067785287 10:49241454-49241476 GATGAGTTGAGATCCAACATTGG + Intergenic
1075317984 10:121467413-121467435 GATGAAATGAGAAAAAACGCTGG + Intergenic
1075873474 10:125788035-125788057 GAGGAATGGAGATCAGAGACGGG + Intronic
1078611850 11:12827407-12827429 AATGAAATGAGATTATACACAGG - Intronic
1078970762 11:16408648-16408670 GATGAAATGAGATGAAACATGGG + Intronic
1084035783 11:66509435-66509457 GATGAAATGAGATCACAGAGGGG - Exonic
1086079354 11:82887322-82887344 GATAAATGGAGAGCAAACATAGG - Intronic
1087282042 11:96221952-96221974 GAGGAAATGAGGTGAAACACAGG - Intronic
1089212448 11:116814743-116814765 GAAGAATTGAGAGCAAGGACTGG + Intergenic
1090568690 11:128024042-128024064 GATTAAATGAGATCAGACATGGG + Intergenic
1091784879 12:3237312-3237334 GATGACTTACGATCAAAGACAGG + Intronic
1093993904 12:25621009-25621031 GGTGAACTGACATCAGACACTGG + Intronic
1096264369 12:50111579-50111601 CAAGAATAGAGATCACACACGGG + Intergenic
1097588060 12:61538956-61538978 TATGAATTGAGATTAAAAACTGG + Intergenic
1107252980 13:38388020-38388042 AATGAACTGAGATCAATCAATGG - Intergenic
1107338975 13:39385998-39386020 GATGAATTGATGGGAAACACTGG - Intronic
1107633482 13:42367661-42367683 GATGAATACAGGTGAAACACAGG + Intergenic
1107883023 13:44850135-44850157 GAAGAAGTGAGATTAAACCCTGG + Intergenic
1109243465 13:59922525-59922547 GATAAATTGAAATAAAACAGTGG - Intronic
1112447731 13:99480773-99480795 GATGCATTGAAATAAAACTCTGG - Intergenic
1114976140 14:28102268-28102290 CCTGAATTGAGATCACAGACTGG + Intergenic
1115163193 14:30418687-30418709 GAGGAGATGAGATCAAACATAGG - Intergenic
1118280756 14:64426311-64426333 GATCAAATGAGATCAAATACGGG - Intronic
1121102018 14:91255940-91255962 GATGAAAAGAGATCATGCACAGG - Intergenic
1122419987 14:101569791-101569813 GATTATTTGCAATCAAACACAGG + Intergenic
1202931275 14_KI270725v1_random:33899-33921 GATGAAATGAGATGAAATAATGG + Intergenic
1126346945 15:47705662-47705684 GAAGAATTGGGAAAAAACACTGG - Intronic
1126644864 15:50865368-50865390 AATGAAGTCAGATCATACACAGG - Intergenic
1128681755 15:69657553-69657575 GATGGATTAATCTCAAACACAGG + Intergenic
1129175332 15:73835919-73835941 GATGAATTGGAACCAATCACTGG + Intergenic
1129637570 15:77337469-77337491 GATGAATTCAGATTAATCTCTGG - Intronic
1131438686 15:92442497-92442519 GATGGATTGGGATCAACCATGGG - Intronic
1131466895 15:92662995-92663017 GATGACCAGAGATCAAACTCTGG + Intronic
1132784921 16:1651491-1651513 GGTGGATTGAGGTCACACACAGG + Intronic
1133155447 16:3872029-3872051 GATTAATGGAAATGAAACACCGG + Intronic
1137515657 16:49141201-49141223 GATGAATAGAGCTCAAACCCAGG - Intergenic
1139078671 16:63486733-63486755 GATGAATTCAGATTGAACTCTGG - Intergenic
1139221098 16:65182887-65182909 GATGATTTGAAGTCAAATACTGG - Intergenic
1140888493 16:79265210-79265232 GATGAATTTAGATTAAACAGGGG - Intergenic
1141662258 16:85447718-85447740 GCTGAATTGAGAAGAAAGACTGG + Intergenic
1144310399 17:14008630-14008652 TATGAATTAATATCAAACAAAGG - Intergenic
1147460823 17:40567673-40567695 GATGAATTGATTTCCAACAGAGG - Intergenic
1153260436 18:3218597-3218619 GATGAATTTTGATAAAACAAAGG + Intronic
1153471840 18:5455081-5455103 GTTGTATTAAGATAAAACACTGG + Intronic
1153638181 18:7131108-7131130 GATGCATGGAGCTAAAACACAGG + Intergenic
1153953059 18:10073151-10073173 GCTGAATTGAGATAAAACACAGG + Intergenic
1155323164 18:24638806-24638828 GATGAAGTGAGAGCAGACAGTGG + Intergenic
1157632967 18:49118348-49118370 TATGAATTGATATAAAATACTGG + Intronic
1158037175 18:53046956-53046978 GGTGAAAGGAGAACAAACACAGG - Intronic
1159123278 18:64194522-64194544 GATTAATTCAGAACAAACATAGG + Intergenic
1162861975 19:13512946-13512968 GATGAATTAAGATCAAGCAGAGG + Intronic
1162862129 19:13514166-13514188 GATGAATTAAGATCAAGCAGAGG - Intronic
1165125654 19:33595033-33595055 CATGTATTGAGTTGAAACACTGG + Intergenic
1166566477 19:43768704-43768726 GATAATTTGAAACCAAACACTGG + Intronic
1168495902 19:56850531-56850553 GATTAAGTGAGATTAATCACTGG - Intergenic
1168662498 19:58178852-58178874 GATGAGTGGAGATCAAATCCTGG + Intergenic
925680711 2:6418346-6418368 GATGAATTGAGAGGAAAAAGTGG - Intergenic
926047602 2:9721206-9721228 GATAAATTGAGATCATGGACAGG - Intergenic
929420353 2:41784071-41784093 TAGGAATTGAGCCCAAACACAGG + Intergenic
929896412 2:45964377-45964399 GATGATCTGAGATGAATCACAGG - Intronic
929959256 2:46484139-46484161 GATGACTTGAGGTCACATACAGG + Intronic
930538912 2:52680405-52680427 GATTATTTAAGATCAAACACTGG + Intergenic
932090144 2:68799226-68799248 AATGAATGGAGAATAAACACTGG + Intronic
936339881 2:111621842-111621864 GATCAAATGAGGTCATACACGGG + Intergenic
940540987 2:155017532-155017554 GAAGAATTGATATCATACAATGG - Intergenic
941700802 2:168602678-168602700 CATGATTTGACATCAAAAACAGG + Intronic
943051397 2:182917665-182917687 GTTGAAGTGAGATCCTACACTGG - Intronic
943291058 2:186072275-186072297 GATGAATTGGGATGGCACACAGG + Intergenic
944411128 2:199443442-199443464 TAAAAATTGAGATCAAACACTGG + Intronic
945175429 2:207038884-207038906 GCAGAGTTGGGATCAAACACAGG - Intergenic
946615940 2:221509982-221510004 GATGAAATGAGATAATACACAGG + Intronic
1174312272 20:49666975-49666997 GATGAAATGAGATAAAACACAGG - Intronic
1175045942 20:56105902-56105924 GAGCAAATGAGATGAAACACTGG - Intergenic
1176593302 21:8662508-8662530 GATGAAATGAGATGAAATAATGG + Intergenic
1177187686 21:17816410-17816432 GATGATTTGCCAGCAAACACTGG + Intronic
1178933391 21:36839128-36839150 GATTAAATGGGATTAAACACAGG + Intronic
1180276148 22:10639629-10639651 GATGAAATGAGATGAAATAATGG + Intergenic
1182484178 22:30629406-30629428 GATCAATTGAGCTCAAGAACTGG + Intergenic
1182721705 22:32407238-32407260 GAAGAATGCAGGTCAAACACAGG + Intronic
949862362 3:8517537-8517559 GATGAATTTAGTTGATACACAGG + Intronic
953567252 3:44043340-44043362 GCTGCTTTGACATCAAACACTGG - Intergenic
955152197 3:56378732-56378754 GATGAATTGAGTTCAGAGACAGG + Intronic
956584977 3:70854626-70854648 GATGAAAGGAGATCAAAGAGAGG - Intergenic
960413525 3:117357148-117357170 AATGAACTGAGATCAAATCCTGG - Intergenic
960891108 3:122449284-122449306 GATGGCCTGAGATCAACCACCGG - Intronic
963176228 3:142300301-142300323 AATTAATAGAGATCAGACACAGG - Intergenic
964031955 3:152148474-152148496 GATGTATTAAGATCAAACAAGGG + Intergenic
964623413 3:158736848-158736870 TATGAACTGAGAAAAAACACAGG - Intronic
971120187 4:23695938-23695960 AGTGAATTGAAATAAAACACTGG + Intergenic
972328808 4:38044232-38044254 GATGAGGTGAGATCACAGACAGG + Intronic
972510052 4:39760427-39760449 GATACATTGTGATCACACACTGG + Intronic
973659704 4:53090924-53090946 CAAGAATTGATAACAAACACAGG + Intronic
977081446 4:92534178-92534200 GATGACCTTAGATCAAACGCTGG - Intronic
982390394 4:154857428-154857450 GGTGAATTGGGATGATACACTGG + Intergenic
982882583 4:160738667-160738689 GATGATGTGAGATCAAATCCTGG + Intergenic
984640502 4:182159375-182159397 GATGAAATGAGCTAACACACAGG + Intronic
984799640 4:183702255-183702277 GATGACTTGAGCTCAAAAAGTGG + Intronic
986143422 5:5052788-5052810 GATAAATTGAATTCAAACCCCGG - Intergenic
990472318 5:56127368-56127390 GATGGATTGAAATTAAATACAGG + Intronic
995231739 5:109772463-109772485 GATGAATTGAGATCAAACACAGG + Intronic
996131063 5:119780999-119781021 GATGAAGGGAGATGAGACACTGG + Intergenic
997468862 5:134105482-134105504 GATGAGATGAGATAACACACAGG + Intergenic
1001228688 5:169967271-169967293 GATGAAGTGATTTCAAATACGGG + Intronic
1001546214 5:172571898-172571920 GATGAACTGAGATCCGCCACAGG - Intergenic
1003167151 6:3690454-3690476 AAGGAATTCATATCAAACACTGG - Intergenic
1003523284 6:6876911-6876933 GATGAATTGGAATCAGACATGGG - Intergenic
1009938616 6:70262484-70262506 GATGAATTGAAGACAAACACAGG - Intronic
1010446106 6:75950386-75950408 GATGAATTCAGATCCAACTGGGG - Intronic
1011569335 6:88717413-88717435 GTTGAATTGAAATCAAAAATAGG - Intronic
1014611477 6:123553196-123553218 GAGAAACTGAGATCATACACAGG - Intronic
1015751269 6:136561609-136561631 GAAGAATTTAGATGAAATACAGG + Exonic
1016446512 6:144138393-144138415 GATGCATTGGGATCAAACCATGG + Intergenic
1016955687 6:149624667-149624689 GATGAAATGAGGACCAACACAGG - Intronic
1018670615 6:166173794-166173816 GAGGAGATGAGATCAAACAGGGG + Intergenic
1020580930 7:10000416-10000438 GATGAAATGAGATCAAGCGGAGG - Intergenic
1022945862 7:35282776-35282798 GGTGAAAAGAGATCAAGCACAGG - Intergenic
1023068287 7:36401858-36401880 GATGAATTGACATGGCACACTGG - Intronic
1024713567 7:52046356-52046378 AAGGAATTGTGATCAAACACTGG - Intergenic
1029616698 7:101663764-101663786 GATGAAATGAGATGGAACATGGG - Intergenic
1030318733 7:108142685-108142707 GAGAATTTGAGATCAAACATGGG + Intergenic
1031581402 7:123478995-123479017 GATAAACTGAGATCAAATAAAGG + Intronic
1032143517 7:129357012-129357034 GATGAATAGATAACAAACATAGG + Intronic
1033777674 7:144630344-144630366 GATGGAGTGAGAGCAAACAGGGG - Intronic
1038461892 8:27724095-27724117 GATGACTTGCCATCAATCACAGG + Intergenic
1040823219 8:51588772-51588794 GCAGGATTGAGATGAAACACAGG + Intronic
1041105233 8:54436374-54436396 TATTAAGTTAGATCAAACACAGG - Intergenic
1041319455 8:56598406-56598428 GATGAATTGAGAGCTAAAAATGG + Intergenic
1042335559 8:67626653-67626675 GATGAATCCAGAAAAAACACAGG - Intronic
1043136650 8:76535608-76535630 GATGAAGTGGGATCAAGCAGAGG + Intergenic
1044826075 8:96198453-96198475 GATTACATGAGATCATACACAGG - Intergenic
1044866313 8:96574382-96574404 TTTGAATTCAGATCAACCACAGG - Intronic
1045405641 8:101864114-101864136 GCTTAATTGAAATCATACACAGG - Intronic
1046713436 8:117540476-117540498 GATCATTTAAGACCAAACACTGG - Intergenic
1056142869 9:83700533-83700555 GATGAATTCTTATCAAAAACAGG + Intronic
1056433909 9:86556794-86556816 GCTGGATTGAGATCAGACTCAGG + Intergenic
1058117153 9:101097466-101097488 GAGGTATTGAGATGTAACACAGG - Intronic
1058947363 9:109870175-109870197 GATGAATTCAGAACAAAGAGAGG - Intronic
1060470054 9:123941025-123941047 GATGAAATGAGATCATCCATGGG + Intergenic
1060665662 9:125430782-125430804 GATGCACTGAGATCCTACACAGG - Intergenic
1203623343 Un_KI270749v1:141300-141322 GATGAAATGAGATGAAATAATGG + Intergenic
1185575897 X:1172014-1172036 AAGGAAGTGAGATCAAAGACAGG + Intergenic
1186726088 X:12360288-12360310 GAGGCATTGAGACCAAACTCTGG + Intronic
1188872174 X:35386496-35386518 GAGGAAATAAAATCAAACACTGG - Intergenic
1189835847 X:45021754-45021776 GAAGAATTTAGATCACACAGTGG + Intronic
1193455837 X:81730295-81730317 GATGAAATGAGTTAAAACATTGG + Intergenic
1193890493 X:87039712-87039734 GTGGAAGTCAGATCAAACACTGG - Intergenic
1194219914 X:91177270-91177292 GCTGAAATGAGATAAGACACTGG + Intergenic
1198279361 X:135126588-135126610 CATGAATTGAGATTCAAGACAGG - Intergenic
1198291596 X:135245932-135245954 CATGAATTGAGATTCAAGACAGG + Intergenic
1200180265 X:154145832-154145854 GATGAAATGAGATGAAACCGTGG - Intronic
1200186093 X:154184227-154184249 GATGAAATGAGATGAAACCGTGG - Intergenic
1200191745 X:154221365-154221387 GATGAAATGAGATGAAACCGTGG - Intronic
1200197500 X:154259169-154259191 GATGAAATGAGATGAAACCGTGG - Intronic
1200556421 Y:4641031-4641053 GCTGAAATGAGATAAGACACTGG + Intergenic