ID: 995232809

View in Genome Browser
Species Human (GRCh38)
Location 5:109789090-109789112
Sequence CTTTGCTAATGCAAGAACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 165}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995232809 Original CRISPR CTTTGCTAATGCAAGAACAA TGG (reversed) Intronic
900090934 1:920198-920220 CTTTACCATTGAAAGAACAAAGG - Intergenic
902235280 1:15053389-15053411 TTGTCCTACTGCAAGAACAATGG - Intronic
904928948 1:34071091-34071113 CATTGCTTATGGAAGGACAAAGG + Intronic
906867335 1:49436599-49436621 GATTGGGAATGCAAGAACAAAGG + Intronic
909373088 1:74909420-74909442 CATTGCTAATAAAATAACAATGG + Intergenic
909963289 1:81875197-81875219 GTTTGCTACTGTCAGAACAAAGG + Intronic
915953003 1:160202512-160202534 GTTTCCTAAAGGAAGAACAAAGG + Intergenic
917034396 1:170731220-170731242 TTTTGTCAGTGCAAGAACAACGG - Intronic
917722600 1:177800272-177800294 CATTACTAATGGAAGAAAAATGG - Intergenic
918603313 1:186390270-186390292 CTTTGCTAATGCATCTAAAAGGG + Intronic
918719404 1:187833908-187833930 CCTAGCTAATGTAATAACAAAGG + Intergenic
919181480 1:194088800-194088822 CTTTGCTAATCAAATAACAATGG + Intergenic
919543952 1:198888664-198888686 CTTTGGCATTGCAAGATCAAAGG - Intergenic
919561750 1:199128700-199128722 TTTTGCTATTTCAAGAAGAATGG - Intergenic
920441630 1:205984800-205984822 CTTTGCAAATGAAGGGACAATGG - Intronic
920671668 1:208008455-208008477 CTTTGCTCAAGCCAGAAAAATGG + Intergenic
923395418 1:233557128-233557150 CATAGGTAATGCAGGAACAACGG + Intergenic
923676394 1:236084205-236084227 CATTCCTTATGCAGGAACAAAGG + Intergenic
923768668 1:236917451-236917473 TATTGCTAATACAACAACAAAGG + Intergenic
1065620368 10:27574937-27574959 CTTTGCTACTGCTAGTTCAAAGG - Intergenic
1068021464 10:51590613-51590635 TTTTACTAATGCATGAAAAAAGG - Intronic
1070400662 10:76050814-76050836 TTTTGCTACAGAAAGAACAATGG + Intronic
1071097082 10:81988903-81988925 CTTTCCTTATGCATCAACAAAGG - Intronic
1074686808 10:115969477-115969499 TTTTGCTAAAGCTGGAACAAGGG - Intergenic
1074740063 10:116477921-116477943 TATTGTTATTGCAAGAACAAAGG - Exonic
1079501581 11:21106584-21106606 TTTTCCTACTCCAAGAACAATGG - Intronic
1079813615 11:25026988-25027010 ATTTGCAAATGGAAGAACACAGG - Intronic
1082714261 11:56592832-56592854 GTTTGCTCATGAAAGGACAAGGG + Intergenic
1084582778 11:70034474-70034496 CTTTGATCATGAAAGAAGAAAGG - Intergenic
1086025785 11:82289784-82289806 CTCTCCTAATGCATGAACAGTGG - Intergenic
1086439261 11:86812223-86812245 CCTTGCTAATCTAGGAACAAAGG + Intronic
1090075805 11:123579352-123579374 CTTTCCTAAGGGAAGCACAAGGG + Intronic
1090641729 11:128735062-128735084 CTTTGCTGATGAAGAAACAAAGG - Intronic
1092797031 12:12121964-12121986 CTTTGCTAAGATAACAACAATGG - Intronic
1094279398 12:28718804-28718826 CTTTTCTAAGGCAAGAAGAAAGG - Intergenic
1094374578 12:29776413-29776435 CTTTGAGAAAGAAAGAACAAAGG + Intronic
1096043590 12:48542423-48542445 CTTTGCTAATGCAGCAACCGTGG - Intergenic
1097651760 12:62307262-62307284 ATGTGCTAATGCATGAAAAAAGG + Intronic
1100795443 12:98177026-98177048 CTTTGGAAATGCAAGACCACAGG - Intergenic
1102617765 12:114169466-114169488 CATTGCTAATTCAAGAGCTAGGG + Intergenic
1103126427 12:118426738-118426760 AATTGTAAATGCAAGAACAAAGG - Intergenic
1107934592 13:45334836-45334858 CTTTGCTAACCCAAGAAGACAGG - Exonic
1108821504 13:54356358-54356380 CTTTGCTAAGGTCAGAAGAAGGG - Intergenic
1110434571 13:75464689-75464711 TTGTGCCAATGCAAGATCAAGGG - Intronic
1113157823 13:107345184-107345206 GTCTTCCAATGCAAGAACAAAGG - Intronic
1115784312 14:36806990-36807012 CTTTGCTAAAACAAAAAGAAGGG + Intronic
1116612117 14:47089150-47089172 CTTTGGCAATGCAAGAATAGAGG + Intronic
1120173143 14:81266502-81266524 GTCTGATGATGCAAGAACAAGGG - Intronic
1122488533 14:102097517-102097539 CTTGGCCAATGCAAGAGCAGAGG + Intronic
1125478791 15:40065951-40065973 CTTTGCCAAGGCCAGAACAGAGG + Intergenic
1125700123 15:41674950-41674972 CATAGCTAATGCAAAAAAAAGGG - Intronic
1125763304 15:42113836-42113858 CTTTGCTAATTCAAGTAAACAGG + Intergenic
1126386743 15:48100999-48101021 CTTTGTTTATGGAAGAAAAAAGG - Intergenic
1126616597 15:50588594-50588616 CTTTCCTAAAGCTAGAACCAAGG - Intronic
1127086897 15:55432548-55432570 CAATGCTAATGCAAGAATGAAGG - Exonic
1130311611 15:82760933-82760955 CTTTAGAAAGGCAAGAACAAGGG - Intronic
1135345070 16:21681928-21681950 CTTTGCTTCTGCAAGGAAAAGGG + Intronic
1135830318 16:25767304-25767326 CTGGGCTAATCCAAGAAGAAAGG - Intronic
1137746910 16:50828963-50828985 CTTTTCTAATGCCAGTACCATGG + Intergenic
1138066034 16:53942286-53942308 CTTTGCTCATGCTGGAATAAGGG - Intronic
1139813584 16:69646072-69646094 ATTTTCCAATGTAAGAACAATGG - Intronic
1147542029 17:41368395-41368417 TTTTGCAAAGGCATGAACAAGGG - Intronic
1149318901 17:55464900-55464922 GTTTGCAAATCCAAGAACTATGG - Intergenic
1150487551 17:65554403-65554425 ATTTTCTAAGGCAAGATCAAGGG + Intronic
1153971727 18:10233439-10233461 CACTGATAATGCATGAACAAAGG - Intergenic
1153979263 18:10295430-10295452 CTTTGCTTCTGCATGAATAAGGG - Intergenic
1154388470 18:13916681-13916703 CTCTGCTTCTGCAAGTACAAGGG - Intergenic
1156023622 18:32627439-32627461 TGGTGCTATTGCAAGAACAATGG - Intergenic
1156332973 18:36142360-36142382 TTTTGCTAATGCACATACAATGG + Intronic
1157518111 18:48325454-48325476 CATTGCTAGTGCATGAAAAAGGG - Intronic
1158412490 18:57220536-57220558 TTTTGATAATTCAAGTACAAGGG - Intergenic
925357052 2:3249290-3249312 CTTTGCTAAGGCATTAACAAGGG - Intronic
926905893 2:17805412-17805434 CTTTGCTAACTCAAGGACACAGG + Intergenic
927318496 2:21715240-21715262 CTTTACCAAGGCAAGAAGAATGG - Intergenic
927633469 2:24793834-24793856 CCTTGCTAATAAAAGAAAAATGG - Exonic
930296613 2:49562406-49562428 GTTTGCTTATGTAAGAACACTGG + Intergenic
937862833 2:126724507-126724529 TTTTGATAATGTAAGAATAATGG - Intergenic
939585690 2:144002067-144002089 CCCTGATAGTGCAAGAACAATGG + Intronic
941028231 2:160482601-160482623 ATTTGCTAATAGAAGAACTATGG + Intronic
942615944 2:177792459-177792481 CTTTGATTATGCAAAAACCATGG - Intronic
945427033 2:209719052-209719074 TTTTCATAATGCAAGAACAAAGG + Intronic
945780259 2:214162064-214162086 CTTTGTTATTGCAGGAAAAATGG - Intronic
945934374 2:215887811-215887833 CTTTGCTAAGGCAGTGACAAGGG + Intergenic
1170512263 20:17090284-17090306 CTTTGTTAGTGCACAAACAAAGG - Intergenic
1173122664 20:40307985-40308007 CTATGCTAAGGCAAGATGAAGGG + Intergenic
1173457265 20:43213503-43213525 GATTGCTAAAGCAAGAAAAACGG + Intergenic
1173692312 20:44971460-44971482 ACTTGCTAATGGAAGAGCAAAGG + Intronic
1174918551 20:54677963-54677985 CTTTGCTAAAGCACTAAGAAGGG + Intergenic
1176886360 21:14260063-14260085 TTTTGGTATTGAAAGAACAAAGG + Intergenic
1177726334 21:24973100-24973122 GTTTGCTAATGACAGCACAAAGG + Intergenic
1179116746 21:38500255-38500277 CTTTGCTAATGAAATAGCCACGG + Intronic
1179158169 21:38869284-38869306 AACTGCTATTGCAAGAACAAAGG - Intergenic
1182129096 22:27837747-27837769 GTTTGATCATGGAAGAACAAAGG + Intergenic
1183129805 22:35823130-35823152 CTTTGTTAATGCTAGAGAAAGGG + Intronic
1184088538 22:42280423-42280445 CTTAGCAAAGGCAAGAACAGAGG - Intronic
1184909875 22:47523760-47523782 CTTAGCTAATGCATTAACATGGG + Intergenic
949649437 3:6138864-6138886 CTTTGATAATGCATAATCAAAGG + Intergenic
952315865 3:32231790-32231812 GTTAGCTAAGGAAAGAACAAGGG - Intergenic
955878544 3:63520172-63520194 ATTTGCTAATGAGAGAAGAAAGG - Intronic
957229718 3:77496545-77496567 AATTGCTTATACAAGAACAATGG - Intronic
959233937 3:103693448-103693470 TTACGCTAATGCAAGAACATAGG + Intergenic
960245787 3:115399009-115399031 CTTAGTTACTGCAAGATCAAAGG + Intergenic
961567673 3:127775289-127775311 ATTTACTAAGGCAAGAAAAACGG + Intronic
963977972 3:151504207-151504229 CTTTGCCCAGGAAAGAACAACGG + Intergenic
965238842 3:166165791-166165813 ATTTGCCAATAAAAGAACAAAGG - Intergenic
966004974 3:174999226-174999248 CTTTTATAATGCAAGACCAATGG - Intronic
969408465 4:7011485-7011507 CTATGCTACAGAAAGAACAAGGG - Intronic
970648349 4:18148779-18148801 CTTTGTTAAAGCAAGAAGAATGG + Intergenic
970974404 4:22026267-22026289 GGTTGCTAATGTAAGAATAATGG + Intergenic
973698512 4:53514295-53514317 TTTTGCTAATGAAAGAGCATGGG + Intronic
976190190 4:82479848-82479870 CTTAGCTGACGCAGGAACAATGG - Intergenic
978924789 4:114230115-114230137 TTTTTCTAATTCAATAACAATGG + Intergenic
979372900 4:119910946-119910968 CTTTGCTAGTCTAAGAAAAAAGG - Intergenic
980705504 4:136488071-136488093 CATGGCAAAAGCAAGAACAAGGG + Intergenic
981410386 4:144423367-144423389 TTTTCATAATGAAAGAACAATGG + Intergenic
981868879 4:149462274-149462296 GTTTGCCAATGCAAGAAGAGGGG + Intergenic
982316174 4:154034208-154034230 TTTTACTAATGCAAAAACCAAGG - Intergenic
982757663 4:159242162-159242184 CTTTGCTCTTGAAAAAACAAAGG - Intronic
983075247 4:163317674-163317696 CTTTGCTAAAGCATAACCAAAGG + Intergenic
983350761 4:166585273-166585295 CTTTACTAATGCCTGACCAATGG - Intergenic
985133852 4:186765964-186765986 CTTTGATTATGTAAGAGCAATGG - Intergenic
985263772 4:188139504-188139526 CTTTGCTAATCCCAGAACAGAGG + Exonic
986747012 5:10753815-10753837 CTCTTCTCAGGCAAGAACAAAGG - Intronic
987604056 5:20109732-20109754 TTTTGCTTTTGCAACAACAAAGG + Intronic
991385303 5:66082356-66082378 CTTTTCTAATGTAACAACCAGGG + Intronic
994453334 5:99972208-99972230 AATTGCTGATGCAAAAACAATGG + Intergenic
994851482 5:105059338-105059360 CTTTATTAATGGAACAACAAAGG + Intergenic
995232809 5:109789090-109789112 CTTTGCTAATGCAAGAACAATGG - Intronic
997391950 5:133524416-133524438 CTCTGGCAATGCAAGAAGAAAGG + Intronic
998182451 5:139954988-139955010 GTTGGCAAATGCAAGAAGAAGGG - Intronic
998762890 5:145451969-145451991 ATTTGGAAAAGCAAGAACAAGGG - Intergenic
1004319817 6:14623645-14623667 CTTTTCTAATACAAGGGCAAGGG + Intergenic
1005145041 6:22679880-22679902 TTTTGCCAATGAAAGAACCAGGG + Intergenic
1005391969 6:25343359-25343381 CTCTGCTGATCCATGAACAAGGG + Intronic
1006921613 6:37631364-37631386 CTTTTCTAATGGAAGAGGAAGGG - Exonic
1007025662 6:38570323-38570345 CATTGCTGATGCAAGAATCAAGG - Intronic
1008802853 6:55391148-55391170 CTATGCAAATCCAAGAACAGTGG - Intronic
1009904467 6:69852196-69852218 CATAGCTAATGGAATAACAAAGG - Intergenic
1010313020 6:74410305-74410327 CTTAGATAATGCAGAAACAATGG - Intergenic
1012733748 6:102913078-102913100 CTTTGCTTATTCTAGAAAAATGG - Intergenic
1013027471 6:106291400-106291422 CACTGATAATGCAACAACAATGG - Intronic
1013506913 6:110809874-110809896 CTTTACATATGTAAGAACAAAGG + Intronic
1015073421 6:129125145-129125167 CTTTGCTCATGCCAAAACCATGG - Intronic
1015168579 6:130226254-130226276 CTTACCTAATATAAGAACAAGGG + Intronic
1015995449 6:138991607-138991629 CTTTGCAAACCCAATAACAAGGG - Intergenic
1018473123 6:164113772-164113794 TTTGGCCAATGAAAGAACAAAGG + Intergenic
1018490295 6:164285680-164285702 CTTTGCTGCTGCAAGAAGAATGG + Intergenic
1018572343 6:165224783-165224805 GTTTGCTATTGCATGAAGAAAGG - Intergenic
1020457919 7:8395169-8395191 CTTTCCTAATGCCAGGACACTGG - Intergenic
1020462967 7:8444129-8444151 CTATGCTAAGGCAAGAGAAACGG - Intronic
1022275528 7:28851945-28851967 CTTTTTTGATGCAAGAAGAAAGG + Intergenic
1027677938 7:81182207-81182229 CTTAGCCAGTGCAGGAACAATGG + Intronic
1028097435 7:86779199-86779221 CATTCCTAAAGCAAGAATAAGGG + Intronic
1032947303 7:136869246-136869268 CTTTTCTTTTGCAAGATCAAGGG + Exonic
1034393810 7:150804809-150804831 CTTTTCTAATGGAAGAGGAAAGG - Exonic
1038261242 8:25997251-25997273 CTTAACTATTGCATGAACAATGG - Intronic
1039048787 8:33474031-33474053 TTTGGGTAATGCATGAACAACGG - Intronic
1043269325 8:78310081-78310103 CTGTTTTAAAGCAAGAACAATGG - Intergenic
1043348234 8:79325318-79325340 CCGTACTAATGCAAGATCAAAGG - Intergenic
1044121264 8:88399108-88399130 TTTTCCTAATGCCAGGACAAGGG + Intergenic
1044195214 8:89367913-89367935 CTTTTCTGATGCATGAACAAAGG - Intergenic
1047897527 8:129383242-129383264 CTAAGCTAAGGCAGGAACAAAGG + Intergenic
1048288521 8:133161999-133162021 GGTTGCTAATGCCAGAACAATGG - Intergenic
1049701031 8:144012705-144012727 CTTTCCTCACGCCAGAACAATGG + Exonic
1049942861 9:565288-565310 CTTTCCCATTGCAAGAACTATGG - Intronic
1050279372 9:4034394-4034416 CTCTGCTAATTCAAGAAACAAGG - Intronic
1052338275 9:27340940-27340962 CTTTGCTCATCCCAGAACAAGGG - Intronic
1056571113 9:87815877-87815899 TTTTTCTAATGCAAGAACACAGG - Intergenic
1058258342 9:102798479-102798501 CGCTGCTAAAGAAAGAACAAGGG - Intergenic
1188026155 X:25211484-25211506 ATTAGCAATTGCAAGAACAATGG + Intergenic
1188303085 X:28529426-28529448 CCTTAGTAATGCAAGAATAAGGG - Intergenic
1189102626 X:38207086-38207108 CTTTGCTAATGAAAGACAGAGGG - Intronic
1191980372 X:66918216-66918238 CTTTGCTACTGCAATAGCCAAGG - Intergenic
1193864832 X:86719088-86719110 TTTTTCTAATCCAAGAGCAAGGG + Intronic
1194099808 X:89689809-89689831 TTTTGCTAATTCTAGAAAAATGG + Intergenic
1195547851 X:106133598-106133620 CATTTCAAATGCAATAACAATGG + Intergenic
1200452812 Y:3351173-3351195 TTTTGCTAATTCTAGAAAAATGG + Intergenic
1201981328 Y:19913328-19913350 CATTCATAATGCAAGAATAAAGG + Intergenic