ID: 995239038

View in Genome Browser
Species Human (GRCh38)
Location 5:109865018-109865040
Sequence CATTCTGCTCATTTGCAGGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 219}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995239034_995239038 15 Left 995239034 5:109864980-109865002 CCATAAATATTTGCTTTATTGTC 0: 1
1: 0
2: 6
3: 68
4: 688
Right 995239038 5:109865018-109865040 CATTCTGCTCATTTGCAGGTGGG 0: 1
1: 0
2: 2
3: 19
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995239038 Original CRISPR CATTCTGCTCATTTGCAGGT GGG Exonic
900900173 1:5510698-5510720 CAGTCTGCTCATCTGCAGAGTGG - Intergenic
901735245 1:11308250-11308272 CATTCTTCTCATCAGAAGGTGGG + Intergenic
902182306 1:14698428-14698450 GATTCTGCTGATTTGCCGTTGGG + Intronic
902613101 1:17608559-17608581 CATTCTGCTTATTTCCTGGAGGG + Intronic
902811623 1:18891205-18891227 CATTCTTCTCATTTACAGAGGGG - Intronic
904463324 1:30693242-30693264 CAGGCTGCTCACTTGGAGGTGGG - Intergenic
905500518 1:38432865-38432887 CATTCAGCTCAATCACAGGTAGG - Intergenic
907122538 1:52019986-52020008 CATTGTGCTCATTTGAATGTGGG + Intergenic
907718854 1:56952781-56952803 CAGTCTGCTCATATGCAAATAGG + Intronic
907861837 1:58361339-58361361 CATTCTGCTCTTCTGCAGATTGG + Intronic
907906305 1:58785469-58785491 CATTTCCCTCATCTGCAGGTGGG + Intergenic
908900576 1:68951778-68951800 CATTCTGTTCATGACCAGGTAGG - Intergenic
909562125 1:77018698-77018720 CATTCTTCTCAATGACAGGTCGG - Intronic
910481359 1:87661964-87661986 AATTATGCCCATTTGCAGATGGG + Intergenic
912065788 1:105740763-105740785 CATTCTGCTCATGACCAAGTAGG - Intergenic
914240303 1:145848656-145848678 CATTCTGCACCTTTCCAGGGAGG - Exonic
914866835 1:151437453-151437475 AATTATTCTCATTTGCTGGTGGG + Intronic
920080389 1:203368767-203368789 CATCCTGGTCCTGTGCAGGTGGG - Intergenic
921086558 1:211799412-211799434 CATTTTCCTCATTTGCATATTGG - Intronic
923641876 1:235771469-235771491 GAATATGCTCAGTTGCAGGTTGG - Intronic
1066138460 10:32476670-32476692 AATTCTCCTCAATTGCAGGGGGG - Intronic
1069087430 10:64157720-64157742 CATTCTTCTCATTTGCCTGCAGG + Intergenic
1074051986 10:109888423-109888445 CATTCTCCTCATTTGCTTGTGGG - Intronic
1075056149 10:119220040-119220062 CTTTCTGCTCATGGGCAGGGAGG + Intronic
1076299010 10:129410435-129410457 CAGTCTGCTTATTTACAAGTTGG - Intergenic
1077994477 11:7441620-7441642 CTTTCTGTTCATCTTCAGGTTGG + Intronic
1080572552 11:33569393-33569415 TAGTCTGCTCAATTCCAGGTAGG - Intronic
1082813600 11:57493839-57493861 CATGCTCCTCATTTACAGATGGG - Intronic
1083696867 11:64449063-64449085 TGCTCTGCTGATTTGCAGGTGGG + Exonic
1084178152 11:67434040-67434062 GATGCTGCTGATGTGCAGGTGGG + Exonic
1084969660 11:72764205-72764227 CATTCAGCTGCTTTGCAGCTGGG - Intronic
1085235810 11:75014511-75014533 CAGTTTCCTGATTTGCAGGTTGG - Intronic
1088374465 11:109124849-109124871 AATTCTGCTCAGTCTCAGGTAGG - Intergenic
1089598983 11:119601760-119601782 CATTCTGCTCAGCTGCAGAACGG - Intergenic
1089646637 11:119884700-119884722 CATTCTGCTTATTAGCATGGAGG + Intergenic
1092769087 12:11880707-11880729 CATTTTGCCCATATGAAGGTGGG - Intronic
1094704692 12:32903063-32903085 CCTTCTGCTCAGCTGCAGCTGGG - Intergenic
1095712241 12:45302755-45302777 CATTAGGCTCATTTGGAGGGCGG + Intronic
1096203922 12:49706476-49706498 CATTCTGCTTATTTTCAGAACGG - Intronic
1096487694 12:51994769-51994791 CTTTCTGTGCATGTGCAGGTCGG + Intronic
1097324917 12:58265693-58265715 CATTTTGGTCATTTCCAGTTTGG + Intergenic
1098892327 12:76022242-76022264 TAGTCTGCTCATTTGTAAGTGGG - Intergenic
1099967835 12:89469631-89469653 CCTTCTGCTAATTTGTTGGTGGG - Intronic
1100045467 12:90375335-90375357 CATTCTCCTGATTTCCAGGAAGG - Intergenic
1102461878 12:113104955-113104977 CAGTTTTCTCATCTGCAGGTTGG - Intronic
1105957519 13:25298399-25298421 GGTTCTGCTCAGTTGCAGATAGG + Intergenic
1106021945 13:25924059-25924081 CATTCAGTTCTTTTGCAGATGGG - Intronic
1107033879 13:35880598-35880620 CCTTTTGCTGATTTGCAGTTGGG + Intronic
1108899462 13:55382176-55382198 CATTCTTCTCACTTTCATGTGGG + Intergenic
1111135938 13:84043603-84043625 CACTCTTCTCATTGACAGGTGGG + Intergenic
1111490594 13:88969008-88969030 CTTTCTTCTCACTTGCATGTAGG + Intergenic
1111601344 13:90479453-90479475 AATTCTGCTAATTTGCAAGAAGG + Intergenic
1112399776 13:99066219-99066241 CATTCTGCTGATTTGCAGTGGGG - Intronic
1113320862 13:109230674-109230696 CCTTCACCACATTTGCAGGTTGG - Intergenic
1115536671 14:34379638-34379660 CATTCTTCTCATCAGCAGATGGG - Intronic
1116280267 14:42898061-42898083 CATTGTTCTCATGTGCAGGATGG - Intergenic
1118261768 14:64253821-64253843 CATTGTGGACATTTGCAGATAGG - Intronic
1119084551 14:71727862-71727884 CGTTCTGCTCATTAAAAGGTAGG - Intronic
1120336509 14:83163650-83163672 CATTGTGCTTATTGGCAGGTTGG + Intergenic
1121776801 14:96596638-96596660 CATTCTTCTCATTTGCAAAATGG + Intergenic
1123189672 14:106556974-106556996 CAGGCTGTTCATTTGCAGATAGG + Intergenic
1123201195 14:106666115-106666137 CAGGCTGTTCATTTGCAGATAGG + Intergenic
1123212616 14:106775195-106775217 CAGGCTGTTCATTTGCAGATAGG + Intergenic
1124365028 15:29065059-29065081 CATTGTACTCATCTGCCGGTGGG + Intronic
1124852717 15:33356443-33356465 CAGTCTGCCACTTTGCAGGTAGG + Intronic
1125591651 15:40857950-40857972 AATTCTGCTCATTTGGAGGTTGG + Exonic
1125860269 15:42992623-42992645 TATTCTGCACATGTGCAGCTTGG + Intronic
1126315256 15:47362878-47362900 CATGCTGCTCATTTGCTGTTGGG + Intronic
1126433138 15:48608204-48608226 CATTCTGTTCATATTCAAGTGGG + Intronic
1126508423 15:49436639-49436661 ACTTATGCTCATTTGCAGATGGG + Intronic
1127685147 15:61336265-61336287 CATTCTGGGCATTTTCAGGCAGG - Intergenic
1127821459 15:62659916-62659938 CATTTTGCTGATTTGCGAGTTGG + Intronic
1133544033 16:6787717-6787739 CTCTGTGCTCATTTGCAGCTTGG - Intronic
1138226460 16:55299715-55299737 CAGACTTCTCATTGGCAGGTGGG + Intergenic
1140112465 16:72015666-72015688 CTTTCTGCTGCATTGCAGGTGGG + Intronic
1144583581 17:16474245-16474267 CAACCTTCTCATTTGTAGGTGGG - Intronic
1144621430 17:16821046-16821068 TATTCTCCTCACTTGGAGGTGGG - Intergenic
1146356199 17:32136363-32136385 CATTCAGGCCATTTGGAGGTAGG + Intergenic
1147992908 17:44345843-44345865 TTTCCTGCTCATTTGCAGCTAGG + Intronic
1148216834 17:45837918-45837940 CATTCTGCTCAGGTTCAGCTTGG + Intergenic
1149807723 17:59634859-59634881 CATTCTGCTAGTTTCCAGGAAGG + Intronic
1150587052 17:66528375-66528397 CATTATGCTCTTTTCCATGTAGG - Intronic
1151224029 17:72635193-72635215 CATTCTTGTCTTTTGCAGTTGGG + Intergenic
1152128737 17:78463113-78463135 CACTTTGCTGATTTGCAGGATGG - Intronic
1152674989 17:81635415-81635437 CATTCCACTCATCTCCAGGTTGG + Intronic
1156819652 18:41356915-41356937 CATTCTGCTCCTATCCATGTGGG + Intergenic
1157830254 18:50850973-50850995 GATTCTGCTCATGTGCAGTAGGG - Intergenic
1159921138 18:74228277-74228299 CATTCAGCCCAGCTGCAGGTGGG + Intergenic
1160430913 18:78812031-78812053 CTTTCTGCTTATTTGCATGGGGG - Intergenic
1160792730 19:929951-929973 CACTCTGCTCATCTGCAGAATGG + Intronic
1165141152 19:33700707-33700729 CATTATGCACAATTGGAGGTGGG + Intronic
1166587474 19:43962580-43962602 CATTTTGCTTGTTTGCAGTTTGG + Intronic
1166785109 19:45362911-45362933 CAGTGTCCTCATTTGCAGGGTGG + Intronic
925563630 2:5225560-5225582 GATTCTGCACATTTACACGTTGG + Intergenic
928450388 2:31373125-31373147 GATTATCCACATTTGCAGGTGGG + Intronic
929022084 2:37563455-37563477 CATTCTGCACACTTGTAGGGCGG + Intergenic
929497286 2:42457159-42457181 TAGTCTCCTCATTTGTAGGTGGG - Intronic
933633356 2:84681024-84681046 GTTTCTGTTCATTTCCAGGTGGG + Intronic
936701055 2:115012104-115012126 CATTCAGCTCATGTGGAGGACGG - Intronic
937365561 2:121258420-121258442 CATTTTGTTCATTTCCAGTTTGG - Intronic
939598463 2:144157890-144157912 CATCCTGCTCCTTTGCATTTTGG + Intronic
939813573 2:146866471-146866493 AATGTTGCTAATTTGCAGGTGGG - Intergenic
940684558 2:156829889-156829911 CATTCTTCTCATAAGCAGATGGG + Intergenic
942170808 2:173287799-173287821 CATTCTGGTCCTTTCCAGCTGGG - Intergenic
942458987 2:176156803-176156825 CATTCTGCTCATTTCCTGTCTGG - Intronic
942682643 2:178494224-178494246 CAGTCTGATAATTTGGAGGTTGG + Intronic
942796769 2:179830033-179830055 CATTTTGCTCTTTTTCAGTTGGG - Intronic
943002996 2:182352694-182352716 CATTCTGCCCATTTGCTAGCTGG + Intronic
944209380 2:197190828-197190850 GACTCTGCTCTTGTGCAGGTAGG - Intronic
946222608 2:218241119-218241141 CATTCTGTTCCTTGGCAGGGTGG + Intronic
946938221 2:224743853-224743875 AATTCTACTCATTTGGAGCTGGG - Intergenic
947354095 2:229274057-229274079 CCTTCTGCTCATTTTAAGGGTGG - Intergenic
947915238 2:233828308-233828330 CTTTCTGTTCAGATGCAGGTGGG + Intronic
947940612 2:234051710-234051732 CATGGGGCTCATTTGGAGGTAGG + Intronic
948087839 2:235266104-235266126 CATTTTCCTCATTTGTAGGATGG + Intergenic
948732436 2:239975534-239975556 CAAACTGCTCATTTGCAAATGGG + Intronic
1169309120 20:4520115-4520137 GATGCTCCACATTTGCAGGTGGG + Intergenic
1169547327 20:6663643-6663665 CAGTCTGGTCATTTGCATGTAGG - Intergenic
1170745909 20:19098729-19098751 CTGTCTGCTAATTTGCAAGTTGG + Intergenic
1173294539 20:41744952-41744974 CATCCTTCTCATTTGCACATGGG - Intergenic
1173658710 20:44718509-44718531 CTGTCTGCCCATTTGAAGGTGGG - Intronic
1175635218 20:60576728-60576750 AATTCTGCTTATTTGCCGTTAGG + Intergenic
1177571339 21:22890745-22890767 AATTCTTCTAGTTTGCAGGTGGG + Intergenic
1177947867 21:27494942-27494964 AATTCTGAGCATTTGCAGGTGGG + Intergenic
1179374608 21:40838863-40838885 AATACTGCTGATTTACAGGTTGG - Intronic
1181090775 22:20471057-20471079 CATCCTGCACATAAGCAGGTAGG - Intronic
1181304837 22:21909872-21909894 CCTTCCCCTCATCTGCAGGTGGG - Intergenic
1181924165 22:26344836-26344858 CATTGTTCTCATTTGCAGAGTGG - Intronic
1182110842 22:27722160-27722182 AATTCTGCTGATCTGCAGTTGGG + Intergenic
1183695755 22:39421209-39421231 CATTCTGCTCACCTGCAGTTAGG + Intronic
949629714 3:5911494-5911516 CATTCTTCTCATTTGCACATAGG - Intergenic
951663089 3:25092409-25092431 TATTCTGCTAATTTGTAAGTAGG + Intergenic
952341318 3:32449843-32449865 CACTCTGATCATTTGCTCGTTGG + Intronic
952552372 3:34494123-34494145 CATTCTGCTAATTTCCAGGCAGG - Intergenic
953134249 3:40169136-40169158 CATTCTTCCCCTCTGCAGGTGGG - Intronic
954106739 3:48413665-48413687 CATTGTCCTCATGTACAGGTGGG - Exonic
954565386 3:51595655-51595677 CCTTCTCCTCACTTGAAGGTTGG - Intronic
954956464 3:54524443-54524465 CATTCTTCTCACGTGCACGTGGG - Intronic
956958653 3:74372207-74372229 CATTTTGCTAATTTGGAGGAGGG - Intronic
959322603 3:104897154-104897176 TATTCTGCTTATCTGAAGGTAGG + Intergenic
962900972 3:139761150-139761172 TATTCTGCTCATTTCCATGATGG - Intergenic
965155633 3:165050014-165050036 CATTCTGTTTATTTTTAGGTTGG - Intronic
965207189 3:165736351-165736373 CATTCTTCTCATTAGTAGATGGG + Intergenic
966257620 3:177935393-177935415 CATTCATCTCATTTGAAGGACGG + Intergenic
966422317 3:179745622-179745644 CATTCTTGCCATTTGCGGGTAGG - Intronic
966923857 3:184631827-184631849 CATTCTCCTCCTTTCCAGGATGG - Intronic
967158741 3:186717036-186717058 CAGTCTGCTTCTATGCAGGTAGG + Intergenic
968943962 4:3653991-3654013 CAGGCTTCTCAGTTGCAGGTGGG + Intergenic
969550254 4:7861317-7861339 CTTGCTGCTCATCTGCAGGAAGG + Intronic
969842927 4:9896427-9896449 TATTTTGCTCATTTTCAAGTGGG + Intronic
970434843 4:16023415-16023437 CTTTGTGCTTATTTGCATGTAGG - Exonic
973348731 4:49084768-49084790 CTTTCTTTTTATTTGCAGGTTGG + Intergenic
976982921 4:91254256-91254278 CATTCTTCTCAATTGCACATGGG + Intronic
977554647 4:98476511-98476533 TCTTCTGCTCATTTCTAGGTGGG - Intronic
977638233 4:99325287-99325309 CATTCAGATCGTTTGCAGTTTGG - Intergenic
978120977 4:105079207-105079229 CCTTGAGCTAATTTGCAGGTGGG + Intergenic
980863305 4:138524463-138524485 CATTCTTCTCATCTGCACATGGG + Intergenic
981421330 4:144554007-144554029 CATTGCTCTCATTTGCAGGTAGG + Intergenic
981757794 4:148160263-148160285 CTGCCTGCTCTTTTGCAGGTTGG - Intronic
981858715 4:149328321-149328343 CAATCTGCTCATTCGCAGAAAGG - Intergenic
984137479 4:175958922-175958944 CATTTTTTACATTTGCAGGTAGG - Intronic
984152011 4:176144985-176145007 TAATCTGCACATTTGCAGATTGG + Intronic
984671493 4:182494051-182494073 TTTTCTGCTGATTTGCAGATGGG + Intronic
985005685 4:185533083-185533105 CATTCTCCTCATTTGCAAAAGGG + Intronic
985158359 4:187017190-187017212 CATTCATCTCATTTGTAGTTGGG + Intergenic
985679218 5:1247180-1247202 CACTCAGCTTATCTGCAGGTGGG - Intergenic
987103671 5:14616028-14616050 AATTCTAATCCTTTGCAGGTTGG + Intergenic
987271721 5:16315948-16315970 CATTTTGCTCATTTGGAATTTGG - Intergenic
987999335 5:25330055-25330077 CATCCTGCTCTTTTGCTGGCAGG - Intergenic
989221888 5:38975532-38975554 CATTCCGATCATGGGCAGGTAGG - Exonic
989303881 5:39928813-39928835 CATTCTGCTCATTGTCAAATTGG - Intergenic
990559702 5:56971665-56971687 CATTCTTGTCACTTTCAGGTTGG + Intronic
991281645 5:64921377-64921399 CATTCTTCTCATCTGCACATGGG - Intronic
991556581 5:67901686-67901708 CATTTTTCTCATCTGTAGGTTGG + Intergenic
992012800 5:72546396-72546418 CATTCTACTAATTTGGAGTTTGG + Intergenic
993927943 5:93894925-93894947 CTTTCTGCTAATCTGCAGATAGG - Intronic
995239038 5:109865018-109865040 CATTCTGCTCATTTGCAGGTGGG + Exonic
997593675 5:135091921-135091943 CATTCTGCTCATCTGTAAGATGG + Intronic
998310895 5:141130063-141130085 CATTCTTCTTATATGCATGTGGG + Intronic
998753077 5:145345945-145345967 CTTAATGCTCATTTGCAGCTGGG - Intergenic
998790680 5:145763498-145763520 CTTTCTGCTTATTTGCAGGTTGG - Intronic
1003442872 6:6159607-6159629 GATTGTGCCCATCTGCAGGTGGG - Intronic
1003970906 6:11298232-11298254 CCTACTGCTCTTTTTCAGGTAGG - Intronic
1004110225 6:12710471-12710493 ATTTCTGCTCATTTACAGATAGG + Intergenic
1004872111 6:19916322-19916344 CATTCTTCTCATCTGCACATGGG + Intergenic
1010405921 6:75505681-75505703 CAGTCTGATCAGTTGCAGGAGGG + Intergenic
1013131631 6:107238734-107238756 CATTCTTATCATTTGGAGGATGG + Intronic
1013270666 6:108542877-108542899 CATCACTCTCATTTGCAGGTGGG - Intergenic
1014837275 6:126173790-126173812 AATTCTGCTGGTTTCCAGGTTGG - Intergenic
1017384356 6:153866343-153866365 CCATCTCCTCATTTGCAGGTGGG - Intergenic
1020286209 7:6683072-6683094 CAATCTGCTCATTAGCAGAAAGG + Intergenic
1021125039 7:16842306-16842328 CAGTTTGTTCATTTGTAGGTAGG - Intergenic
1022053762 7:26707626-26707648 CATACTGATCATTTGCATGGTGG + Intronic
1023169029 7:37372859-37372881 CCTTCTGCTCATTGCCAGGTTGG - Intronic
1026336282 7:69396796-69396818 AATTCTGCTCAATTGCAGATGGG - Intergenic
1026824027 7:73570234-73570256 CATTCTCCTCAGTGCCAGGTGGG + Exonic
1028431518 7:90752221-90752243 CATTCTTCTCATTTGCATTTAGG + Intronic
1028828883 7:95305344-95305366 AATTCTGGTCATCTGAAGGTTGG - Intronic
1029687886 7:102161554-102161576 GATTCTGCTCATTGGCAGCAAGG + Intronic
1034131533 7:148722769-148722791 TGTTCTAGTCATTTGCAGGTGGG + Intronic
1034355760 7:150449743-150449765 CATTCTGCTCAGTCTCAGGAGGG + Intergenic
1034806047 7:154090280-154090302 CATTGTGTGAATTTGCAGGTCGG - Intronic
1034833780 7:154332738-154332760 CATTTTGCTAATTTTAAGGTTGG - Intronic
1037193103 8:16151808-16151830 CAGTCTGCTACTTTGCAGGAAGG - Intronic
1039275455 8:35930257-35930279 CATTTGGGTCATTTGCAGCTTGG - Intergenic
1041141428 8:54823711-54823733 CATTTTGCTCATTTCCAGTTTGG + Intergenic
1041428654 8:57752591-57752613 CAGTTTGGTCATTTGCAAGTTGG - Intergenic
1044638215 8:94349933-94349955 CATTCTTCTCAAGTGCACGTAGG + Intergenic
1045722126 8:105124946-105124968 TATTCTGGTCATCTGCAAGTTGG + Intronic
1047478085 8:125254916-125254938 CACTCTTCTCATTAGCAAGTGGG + Intronic
1048392141 8:133977535-133977557 CATTCTTCTGATTAGTAGGTAGG - Intergenic
1050142774 9:2533648-2533670 CATTCTGTTCAGTTGTATGTAGG + Intergenic
1050756027 9:9004655-9004677 CATTCTCTTTATTTGCAGGGTGG - Intronic
1051389433 9:16548133-16548155 AAATCTTCTCATTTGCAGGTGGG - Intronic
1053064065 9:35054672-35054694 AATTCTGCTCATTGGCAACTTGG - Intergenic
1053431477 9:38044559-38044581 GATTCTCCTCAGTGGCAGGTGGG - Intronic
1055691886 9:78841058-78841080 CATTTTGCTGATTTTCAGGGTGG + Intergenic
1055880147 9:80991271-80991293 CATCCTGGTTATTTCCAGGTTGG + Intergenic
1056023861 9:82470756-82470778 CATTCTTCTCAAGTGCACGTGGG + Intergenic
1056187023 9:84145266-84145288 AATTCTCATAATTTGCAGGTGGG + Intergenic
1056555172 9:87682132-87682154 CATCCTGCTCAGTTCAAGGTTGG + Intronic
1056998291 9:91484209-91484231 CATTATCCTCATTTTCAGTTGGG - Intergenic
1058699707 9:107589990-107590012 CATACTGCTGATTTGCAGCAGGG - Intergenic
1059342527 9:113606242-113606264 CATTTTGGTCATTTCCAGTTTGG + Intergenic
1060070160 9:120539904-120539926 CATACTGCTCCTTTGCACGTTGG - Intronic
1186495045 X:10006471-10006493 CACTTTGCTCATCTGCAAGTTGG + Intergenic
1186530259 X:10287918-10287940 AATTATTCTCATTTGCAGATAGG - Intergenic
1186570054 X:10705688-10705710 CAGTCTTCTCATTTGTAAGTTGG - Intronic
1187214107 X:17258460-17258482 CCTTCTGCTAATTTTCAGTTTGG - Intergenic
1187920203 X:24194391-24194413 CATTCTCCTCATGTCCATGTGGG + Intronic
1189113399 X:38317806-38317828 CTTTCAGTTCAGTTGCAGGTAGG - Intronic
1189723731 X:43947569-43947591 TATTCTGCTCATTTCCATGGGGG + Intergenic
1190126110 X:47707180-47707202 CTATCTCCTCATTTGCAGGAGGG + Intergenic
1194113013 X:89859695-89859717 CATTTTATTCATTTGCATGTGGG + Intergenic
1194236191 X:91386507-91386529 TCTTCTGCTCATTTTCAGTTTGG - Intergenic
1194469752 X:94278592-94278614 AATTCTGCTTATTTGTATGTTGG + Intergenic
1197309639 X:124888570-124888592 CTTTCTGCTCATTTTAAAGTAGG - Intronic
1198798142 X:140421520-140421542 CAGGCTGCTCATTTGTAGTTTGG - Intergenic
1199924723 X:152450587-152450609 CTTTCTACTCACTTGCATGTGGG + Intronic
1200465665 Y:3514525-3514547 CATTTTATTCATTTGCATGTGGG + Intergenic
1201480855 Y:14437999-14438021 CATCCTCCTAATTTGCACGTGGG - Intergenic