ID: 995239208

View in Genome Browser
Species Human (GRCh38)
Location 5:109866595-109866617
Sequence ACATACAGACTACGCTTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 52}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995239208 Original CRISPR ACATACAGACTACGCTTGGA AGG (reversed) Intronic
901365241 1:8742072-8742094 ATATACATACTACACTGGGATGG - Intronic
908442396 1:64168504-64168526 ACATACAGACTACTATATGAGGG - Intronic
910352629 1:86316520-86316542 TCATACAGTCTACTCTTGGTTGG - Intergenic
920422961 1:205848240-205848262 AAATACAGTCTAAGATTGGAGGG + Intronic
922787007 1:228287834-228287856 AAATACAGCCTACGCCAGGAGGG + Exonic
922946158 1:229515904-229515926 ACATACAGACAAGCCTGGGACGG + Intergenic
1065679321 10:28212913-28212935 AAATACAGACAACTCTTAGAAGG + Intronic
1068686957 10:59880485-59880507 ACATAGTGGCTACCCTTGGAGGG + Intronic
1069407018 10:68112360-68112382 ACATACATAATACGCTTCGTAGG + Intronic
1069719407 10:70539927-70539949 ACACACACACAAAGCTTGGAAGG - Intronic
1076453658 10:130574663-130574685 ACATGCAGACTGAGCCTGGACGG - Intergenic
1080202254 11:29686023-29686045 ACATACAGAATACACTTGGAAGG - Intergenic
1081215237 11:40388422-40388444 ACATTCAGGTTGCGCTTGGAGGG + Intronic
1084408967 11:68995090-68995112 ACACACAGGAAACGCTTGGAAGG - Intergenic
1086404836 11:86490661-86490683 ACATACATACAGAGCTTGGAAGG + Intronic
1088564748 11:111157822-111157844 ACTTACAGACTGGGTTTGGACGG - Intergenic
1089863021 11:121606965-121606987 ACATACAGCCAACTCATGGAAGG - Intronic
1097464578 12:59906585-59906607 ACATACAGGGCACTCTTGGATGG - Intergenic
1098559359 12:71854415-71854437 ACATTCAGCCTACGATTGAAGGG - Intronic
1103715357 12:122942023-122942045 ACATACAGAGCATGCTTGGCCGG - Intronic
1108413806 13:50177340-50177362 ACCTAGAGACTTCCCTTGGAAGG - Intronic
1109851074 13:68064420-68064442 ATATACAGGGTACTCTTGGATGG + Intergenic
1118464086 14:66015009-66015031 ACATCCATATTACACTTGGAAGG - Intergenic
1202928563 14_KI270725v1_random:17625-17647 ACCTACAGACTATGCCTGAAAGG + Intergenic
1126981253 15:54246259-54246281 ACATATAGACTACACTGGGGAGG - Intronic
1131138099 15:89953975-89953997 ACATAGAGACTATTCTTAGAGGG + Intergenic
1134377394 16:13690253-13690275 ACATATAGACTACCCTTGAAAGG + Intergenic
1143762398 17:9114931-9114953 AAATACAGACTGCCCTTGGGTGG - Intronic
1167536193 19:50053405-50053427 ACAAACAGAATACTCTTGGCTGG + Intronic
932310470 2:70735678-70735700 AGATAGAGACTGGGCTTGGAAGG - Intronic
1174373099 20:50107106-50107128 ACAGCCAGACTACACTTGGGCGG - Intronic
1176590585 21:8646209-8646231 ACCTACAGACTATGCCTGAAAGG + Intergenic
1180273414 22:10623242-10623264 ACCTACAGACTATGCCTGAAAGG + Intergenic
1183257240 22:36770479-36770501 ATATACAGACAAAGCTTGGGAGG - Intronic
949136686 3:575469-575491 ACCTACAGACTATGCCTGAAAGG - Intergenic
958005058 3:87799982-87800004 ACAGTCAGACTACTCTTAGATGG + Intergenic
971765385 4:30824263-30824285 ACACACAGGCTACACTTGGTGGG - Intronic
979293459 4:119003651-119003673 ACATAGAGACTATACTGGGAGGG - Intronic
995239208 5:109866595-109866617 ACATACAGACTACGCTTGGAAGG - Intronic
1001308205 5:170591001-170591023 CCACACAGACTTCCCTTGGAAGG + Intronic
1001325308 5:170719598-170719620 ACCTACAGACTGCACCTGGAGGG - Intronic
1001460609 5:171909906-171909928 ACATACAAACTATGTTTGAAGGG + Intronic
1003184438 6:3818647-3818669 ACAGACAGACTATTCATGGAGGG + Intergenic
1009726892 6:67546666-67546688 ACATACATACTAAAATTGGACGG + Intergenic
1012865557 6:104614286-104614308 ACAAACAGAAGACGCTTAGATGG + Intergenic
1016318537 6:142817116-142817138 AAATACAAACTAAGGTTGGAGGG + Intronic
1017680571 6:156859757-156859779 ACATTTAGACCAGGCTTGGAAGG - Intronic
1021010260 7:15454576-15454598 ACACACACACTAAGATTGGAAGG - Intronic
1031033711 7:116764586-116764608 CCATAAAGACTGTGCTTGGAAGG - Intronic
1043320108 8:78973970-78973992 ACATACAGACAATTCTTTGAAGG + Intergenic
1045589721 8:103580310-103580332 ACACATAGACTAAGCTTGAAGGG + Intronic
1047985155 8:130225611-130225633 ACACACAGACAACACTTGGATGG + Intronic
1053227032 9:36368406-36368428 AAATACATACTAGGCTTGTAGGG - Intronic
1056004991 9:82259617-82259639 ACAAACAGAGTCAGCTTGGAGGG + Intergenic
1061773705 9:132946493-132946515 CCATGCAGACTATGCTTGGGTGG - Intronic
1203620598 Un_KI270749v1:124933-124955 ACCTACAGACTATGCCTGAAAGG + Intergenic