ID: 995240785

View in Genome Browser
Species Human (GRCh38)
Location 5:109883949-109883971
Sequence CCAACCACACAGGTGACCGT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 85}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995240785_995240788 -1 Left 995240785 5:109883949-109883971 CCTACGGTCACCTGTGTGGTTGG 0: 1
1: 0
2: 1
3: 7
4: 85
Right 995240788 5:109883971-109883993 GTAAGTCCTTGAGCCCTCAAAGG 0: 1
1: 0
2: 0
3: 10
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995240785 Original CRISPR CCAACCACACAGGTGACCGT AGG (reversed) Exonic