ID: 995243689

View in Genome Browser
Species Human (GRCh38)
Location 5:109913721-109913743
Sequence CTGCATATATCTATGGACAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995243685_995243689 -6 Left 995243685 5:109913704-109913726 CCAGTAGCTCCTGGTTGCTGCAT No data
Right 995243689 5:109913721-109913743 CTGCATATATCTATGGACAAGGG No data
995243683_995243689 6 Left 995243683 5:109913692-109913714 CCACATTTCTGGCCAGTAGCTCC No data
Right 995243689 5:109913721-109913743 CTGCATATATCTATGGACAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995243689 Original CRISPR CTGCATATATCTATGGACAA GGG Intergenic
No off target data available for this crispr