ID: 995243974

View in Genome Browser
Species Human (GRCh38)
Location 5:109916857-109916879
Sequence ATTAAATTTAGTCATTATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995243974_995243976 22 Left 995243974 5:109916857-109916879 CCAAGATAATGACTAAATTTAAT No data
Right 995243976 5:109916902-109916924 TAATTCTCCTGACAGCCATGAGG No data
995243974_995243978 29 Left 995243974 5:109916857-109916879 CCAAGATAATGACTAAATTTAAT No data
Right 995243978 5:109916909-109916931 CCTGACAGCCATGAGGCTGCTGG No data
995243974_995243979 30 Left 995243974 5:109916857-109916879 CCAAGATAATGACTAAATTTAAT No data
Right 995243979 5:109916910-109916932 CTGACAGCCATGAGGCTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995243974 Original CRISPR ATTAAATTTAGTCATTATCT TGG (reversed) Intergenic