ID: 995243976

View in Genome Browser
Species Human (GRCh38)
Location 5:109916902-109916924
Sequence TAATTCTCCTGACAGCCATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995243974_995243976 22 Left 995243974 5:109916857-109916879 CCAAGATAATGACTAAATTTAAT No data
Right 995243976 5:109916902-109916924 TAATTCTCCTGACAGCCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995243976 Original CRISPR TAATTCTCCTGACAGCCATG AGG Intergenic
No off target data available for this crispr