ID: 995243978 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 5:109916909-109916931 |
Sequence | CCTGACAGCCATGAGGCTGC TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
995243975_995243978 | -4 | Left | 995243975 | 5:109916890-109916912 | CCTGATAACAGATAATTCTCCTG | No data | ||
Right | 995243978 | 5:109916909-109916931 | CCTGACAGCCATGAGGCTGCTGG | No data | ||||
995243974_995243978 | 29 | Left | 995243974 | 5:109916857-109916879 | CCAAGATAATGACTAAATTTAAT | No data | ||
Right | 995243978 | 5:109916909-109916931 | CCTGACAGCCATGAGGCTGCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
995243978 | Original CRISPR | CCTGACAGCCATGAGGCTGC TGG | Intergenic | ||