ID: 995243978

View in Genome Browser
Species Human (GRCh38)
Location 5:109916909-109916931
Sequence CCTGACAGCCATGAGGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995243975_995243978 -4 Left 995243975 5:109916890-109916912 CCTGATAACAGATAATTCTCCTG No data
Right 995243978 5:109916909-109916931 CCTGACAGCCATGAGGCTGCTGG No data
995243974_995243978 29 Left 995243974 5:109916857-109916879 CCAAGATAATGACTAAATTTAAT No data
Right 995243978 5:109916909-109916931 CCTGACAGCCATGAGGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995243978 Original CRISPR CCTGACAGCCATGAGGCTGC TGG Intergenic