ID: 995243979

View in Genome Browser
Species Human (GRCh38)
Location 5:109916910-109916932
Sequence CTGACAGCCATGAGGCTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995243975_995243979 -3 Left 995243975 5:109916890-109916912 CCTGATAACAGATAATTCTCCTG No data
Right 995243979 5:109916910-109916932 CTGACAGCCATGAGGCTGCTGGG No data
995243974_995243979 30 Left 995243974 5:109916857-109916879 CCAAGATAATGACTAAATTTAAT No data
Right 995243979 5:109916910-109916932 CTGACAGCCATGAGGCTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995243979 Original CRISPR CTGACAGCCATGAGGCTGCT GGG Intergenic