ID: 995245628

View in Genome Browser
Species Human (GRCh38)
Location 5:109932108-109932130
Sequence CTTTGTAAGCTCAAAGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995245628_995245633 -1 Left 995245628 5:109932108-109932130 CCTCCCACTTTGAGCTTACAAAG No data
Right 995245633 5:109932130-109932152 GTGCTGGGATTATAGACACGAGG 0: 2
1: 8
2: 212
3: 1503
4: 2956
995245628_995245634 7 Left 995245628 5:109932108-109932130 CCTCCCACTTTGAGCTTACAAAG No data
Right 995245634 5:109932138-109932160 ATTATAGACACGAGGCACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995245628 Original CRISPR CTTTGTAAGCTCAAAGTGGG AGG (reversed) Intergenic
No off target data available for this crispr