ID: 995247014

View in Genome Browser
Species Human (GRCh38)
Location 5:109946066-109946088
Sequence CAGAGTAGACAGGGTGATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995247010_995247014 6 Left 995247010 5:109946037-109946059 CCTGAGAAGTGATAGGAGGGAAA No data
Right 995247014 5:109946066-109946088 CAGAGTAGACAGGGTGATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995247014 Original CRISPR CAGAGTAGACAGGGTGATGG AGG Intergenic
No off target data available for this crispr