ID: 995251438

View in Genome Browser
Species Human (GRCh38)
Location 5:109997462-109997484
Sequence GATTGTGCCTGAAGCATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995251432_995251438 30 Left 995251432 5:109997409-109997431 CCCTGAGGGAAGAATTGTTCTGG No data
Right 995251438 5:109997462-109997484 GATTGTGCCTGAAGCATGGAAGG No data
995251434_995251438 29 Left 995251434 5:109997410-109997432 CCTGAGGGAAGAATTGTTCTGGT No data
Right 995251438 5:109997462-109997484 GATTGTGCCTGAAGCATGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995251438 Original CRISPR GATTGTGCCTGAAGCATGGA AGG Intergenic
No off target data available for this crispr