ID: 995253073

View in Genome Browser
Species Human (GRCh38)
Location 5:110016595-110016617
Sequence GAACTCAACATGTCCTAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995253070_995253073 28 Left 995253070 5:110016544-110016566 CCTTTCTGAGAATTTCACACTTG No data
Right 995253073 5:110016595-110016617 GAACTCAACATGTCCTAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995253073 Original CRISPR GAACTCAACATGTCCTAAAC TGG Intergenic
No off target data available for this crispr