ID: 995253172

View in Genome Browser
Species Human (GRCh38)
Location 5:110017696-110017718
Sequence TCTTTGGATGGCTGTGTCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995253172_995253177 5 Left 995253172 5:110017696-110017718 CCACTGACACAGCCATCCAAAGA No data
Right 995253177 5:110017724-110017746 CTCAGAGGTCAGCAAACTGTAGG No data
995253172_995253178 15 Left 995253172 5:110017696-110017718 CCACTGACACAGCCATCCAAAGA No data
Right 995253178 5:110017734-110017756 AGCAAACTGTAGGACACGCCTGG No data
995253172_995253175 -10 Left 995253172 5:110017696-110017718 CCACTGACACAGCCATCCAAAGA No data
Right 995253175 5:110017709-110017731 CATCCAAAGAGGCTACTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995253172 Original CRISPR TCTTTGGATGGCTGTGTCAG TGG (reversed) Intergenic
No off target data available for this crispr