ID: 995253549

View in Genome Browser
Species Human (GRCh38)
Location 5:110019885-110019907
Sequence CAGAGCACTGAGAAGGAGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995253543_995253549 10 Left 995253543 5:110019852-110019874 CCAGCACTAGAGTGGGAGAGGAG No data
Right 995253549 5:110019885-110019907 CAGAGCACTGAGAAGGAGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995253549 Original CRISPR CAGAGCACTGAGAAGGAGTA TGG Intergenic
No off target data available for this crispr