ID: 995259760

View in Genome Browser
Species Human (GRCh38)
Location 5:110089481-110089503
Sequence GCAACCTTCTTAGAAGGTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995259760_995259762 -10 Left 995259760 5:110089481-110089503 CCACTACCTTCTAAGAAGGTTGC No data
Right 995259762 5:110089494-110089516 AGAAGGTTGCTGTTTGCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995259760 Original CRISPR GCAACCTTCTTAGAAGGTAG TGG (reversed) Intergenic
No off target data available for this crispr