ID: 995260744

View in Genome Browser
Species Human (GRCh38)
Location 5:110101545-110101567
Sequence CAGGGGATTCTTGTTTCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995260739_995260744 3 Left 995260739 5:110101519-110101541 CCTAGACTTCTGGAAGCGTTAAG No data
Right 995260744 5:110101545-110101567 CAGGGGATTCTTGTTTCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995260744 Original CRISPR CAGGGGATTCTTGTTTCCCA GGG Intergenic
No off target data available for this crispr