ID: 995265185

View in Genome Browser
Species Human (GRCh38)
Location 5:110151839-110151861
Sequence AGGCAGAGCACAGTGACTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995265176_995265185 12 Left 995265176 5:110151804-110151826 CCTGTGGCCAGAGAGAGAATCTG No data
Right 995265185 5:110151839-110151861 AGGCAGAGCACAGTGACTGGGGG No data
995265177_995265185 5 Left 995265177 5:110151811-110151833 CCAGAGAGAGAATCTGTGTACTT No data
Right 995265185 5:110151839-110151861 AGGCAGAGCACAGTGACTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995265185 Original CRISPR AGGCAGAGCACAGTGACTGG GGG Intergenic
No off target data available for this crispr