ID: 995265969

View in Genome Browser
Species Human (GRCh38)
Location 5:110161082-110161104
Sequence AAACTCAAGTTGTCTAAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995265968_995265969 -9 Left 995265968 5:110161068-110161090 CCAAGATGCTAAGGAAACTCAAG No data
Right 995265969 5:110161082-110161104 AAACTCAAGTTGTCTAAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995265969 Original CRISPR AAACTCAAGTTGTCTAAAAT TGG Intergenic
No off target data available for this crispr