ID: 995266409

View in Genome Browser
Species Human (GRCh38)
Location 5:110166801-110166823
Sequence AATATCTAAGACATTAGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995266409_995266413 -7 Left 995266409 5:110166801-110166823 CCCCCTCTAATGTCTTAGATATT No data
Right 995266413 5:110166817-110166839 AGATATTTCTAAAAGTATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995266409 Original CRISPR AATATCTAAGACATTAGAGG GGG (reversed) Intergenic
No off target data available for this crispr