ID: 995269560

View in Genome Browser
Species Human (GRCh38)
Location 5:110205495-110205517
Sequence AGCTATGTGCAGAAGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995269555_995269560 16 Left 995269555 5:110205456-110205478 CCCAGTATTGGGCCAAGAGCTAT No data
Right 995269560 5:110205495-110205517 AGCTATGTGCAGAAGATGGCAGG No data
995269558_995269560 4 Left 995269558 5:110205468-110205490 CCAAGAGCTATATCTCAAAAGGA No data
Right 995269560 5:110205495-110205517 AGCTATGTGCAGAAGATGGCAGG No data
995269553_995269560 25 Left 995269553 5:110205447-110205469 CCACCAAAGCCCAGTATTGGGCC No data
Right 995269560 5:110205495-110205517 AGCTATGTGCAGAAGATGGCAGG No data
995269554_995269560 22 Left 995269554 5:110205450-110205472 CCAAAGCCCAGTATTGGGCCAAG No data
Right 995269560 5:110205495-110205517 AGCTATGTGCAGAAGATGGCAGG No data
995269556_995269560 15 Left 995269556 5:110205457-110205479 CCAGTATTGGGCCAAGAGCTATA No data
Right 995269560 5:110205495-110205517 AGCTATGTGCAGAAGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995269560 Original CRISPR AGCTATGTGCAGAAGATGGC AGG Intergenic
No off target data available for this crispr