ID: 995269861

View in Genome Browser
Species Human (GRCh38)
Location 5:110207867-110207889
Sequence AGTCCCAGTGGGCCCCTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995269861_995269867 17 Left 995269861 5:110207867-110207889 CCCTCTAGGGGCCCACTGGGACT No data
Right 995269867 5:110207907-110207929 CTAGAAGCAAACAGGAATGTTGG No data
995269861_995269866 9 Left 995269861 5:110207867-110207889 CCCTCTAGGGGCCCACTGGGACT No data
Right 995269866 5:110207899-110207921 TTATAGGTCTAGAAGCAAACAGG 0: 116
1: 155
2: 121
3: 74
4: 192
995269861_995269865 -7 Left 995269861 5:110207867-110207889 CCCTCTAGGGGCCCACTGGGACT No data
Right 995269865 5:110207883-110207905 TGGGACTTAAGTCTAATTATAGG No data
995269861_995269868 18 Left 995269861 5:110207867-110207889 CCCTCTAGGGGCCCACTGGGACT No data
Right 995269868 5:110207908-110207930 TAGAAGCAAACAGGAATGTTGGG No data
995269861_995269870 20 Left 995269861 5:110207867-110207889 CCCTCTAGGGGCCCACTGGGACT No data
Right 995269870 5:110207910-110207932 GAAGCAAACAGGAATGTTGGGGG No data
995269861_995269871 23 Left 995269861 5:110207867-110207889 CCCTCTAGGGGCCCACTGGGACT No data
Right 995269871 5:110207913-110207935 GCAAACAGGAATGTTGGGGGTGG No data
995269861_995269869 19 Left 995269861 5:110207867-110207889 CCCTCTAGGGGCCCACTGGGACT No data
Right 995269869 5:110207909-110207931 AGAAGCAAACAGGAATGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995269861 Original CRISPR AGTCCCAGTGGGCCCCTAGA GGG (reversed) Intergenic
No off target data available for this crispr