ID: 995279365

View in Genome Browser
Species Human (GRCh38)
Location 5:110316194-110316216
Sequence CTGAATAACAAGCATCAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 253}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995279365 Original CRISPR CTGAATAACAAGCATCAGAA TGG (reversed) Intronic
900498679 1:2989028-2989050 CTGAAAAAAATGCTTCAGAAGGG + Intergenic
900937869 1:5778282-5778304 CTGTATTAGAAGCATGAGAATGG + Intergenic
903793240 1:25908771-25908793 CTAAAGAACAAGGATCAGACTGG - Intergenic
906204092 1:43978087-43978109 CTGAACACCAAGCCTCTGAAAGG - Exonic
906759274 1:48359528-48359550 TTGAATAATAAGTATTAGAAGGG - Intronic
906879390 1:49574197-49574219 CTGGAGAACAGGCATAAGAATGG + Intronic
908525598 1:64984814-64984836 CTAAATAGTAAGCAGCAGAAGGG + Intergenic
909791069 1:79679397-79679419 CTGAATCACAAGAAGAAGAATGG - Intergenic
910356840 1:86367101-86367123 CAGAGGAACAAGTATCAGAATGG + Intronic
910519748 1:88106279-88106301 CAGACTGACAAGGATCAGAAAGG - Intergenic
910549660 1:88461652-88461674 CTGAATAGCAAGAATCCGAGAGG - Intergenic
911432824 1:97814129-97814151 CTGAATAGCAAGAAGCAGCAAGG + Intronic
911883277 1:103268202-103268224 CTGGAGAACAAGCATGGGAATGG + Intergenic
912130201 1:106590324-106590346 CTGGAGAACAAGCATGGGAATGG - Intergenic
912141988 1:106741391-106741413 CTTAATAAAAAGCAGCAGAAAGG + Intergenic
912944123 1:114070449-114070471 CTGGAGAACAGGCATGAGAATGG - Intergenic
914356479 1:146889234-146889256 AATAATAACAAGCATCAGCAAGG + Intergenic
916434357 1:164763335-164763357 CTGCATTCCAGGCATCAGAATGG + Intronic
917436412 1:175025530-175025552 TGGAATTACAAGTATCAGAAGGG - Intergenic
919241508 1:194922233-194922255 CTGGAGAACAGGCATGAGAATGG + Intergenic
920526458 1:206670522-206670544 AAGTATAACAAGCATCATAAAGG + Intronic
920789975 1:209080719-209080741 CTGAATAAGAACCATTATAAAGG - Intergenic
920904056 1:210142809-210142831 GTGTAGAAGAAGCATCAGAATGG + Intronic
921439662 1:215170184-215170206 CTAAATAACAAACATAATAAAGG + Intronic
922150523 1:222999243-222999265 GTGAATAACTAGAATTAGAAGGG + Intronic
1063094390 10:2896735-2896757 ATTATTAAAAAGCATCAGAAGGG - Intergenic
1063854874 10:10238207-10238229 CTTAAAAGCAAGCATCAAAAGGG + Intergenic
1065843656 10:29726987-29727009 CTCAATAACAAGCATTAAATGGG + Intronic
1066286279 10:33969147-33969169 CTGCATTCCAAGCATCAGGAAGG - Intergenic
1067332852 10:45337946-45337968 CTGGAGAACAGGCATGAGAATGG + Intergenic
1069075327 10:64033012-64033034 CTGAATAAAAGTAATCAGAAGGG + Intergenic
1069587791 10:69620217-69620239 CTGCAGAGCAAGCATCTGAATGG + Intergenic
1072846883 10:98841333-98841355 CTGAATAACAACTATCAGAGAGG - Intronic
1072969293 10:100003040-100003062 ATGAATAAGAAGTATAAGAATGG + Intronic
1074264773 10:111890453-111890475 CTGAGAAAGAAGCATCAGACAGG - Intergenic
1074668355 10:115757930-115757952 CCGAATCACAAGCAGAAGAAAGG - Intronic
1074992301 10:118719862-118719884 CTGCATAGCAAGAATGAGAATGG - Intronic
1076429458 10:130391453-130391475 CTGGGTATCAAACATCAGAAAGG + Intergenic
1078018078 11:7632550-7632572 CTGAAGAACCAAGATCAGAAAGG + Intronic
1080742579 11:35080075-35080097 CTGAATAACAGCCACCTGAAGGG + Intergenic
1081601108 11:44494988-44495010 CTGCATAATTAGCATCTGAATGG + Intergenic
1082078050 11:47989899-47989921 ATGAAGAGCAAGGATCAGAAAGG - Intronic
1084243260 11:67837257-67837279 CTGAGTATCAAGCTTCAGTAAGG - Intergenic
1084281657 11:68099711-68099733 CTGGCTACCAAGCAACAGAACGG + Intronic
1086029890 11:82341650-82341672 GTGAATGACAATAATCAGAATGG - Intergenic
1086278329 11:85158179-85158201 CTGAAGAACAGGCATGGGAATGG + Intronic
1086529479 11:87767481-87767503 TTGAATAACAAGGCTCAGAGAGG - Intergenic
1086596765 11:88581714-88581736 CTAAATACCAAACATCATAATGG - Intronic
1086922054 11:92598598-92598620 GTGAATACCAAGGCTCAGAAAGG + Intronic
1087294943 11:96360525-96360547 CTGTAGAAAATGCATCAGAAAGG + Intronic
1087500263 11:98943275-98943297 TTGAAAAACAAGCAGCAAAAAGG - Intergenic
1088384417 11:109237402-109237424 CTGCTTAGCAAGCGTCAGAATGG - Intergenic
1089144835 11:116319014-116319036 CTGAAAAGCAAGCTTCAAAAAGG - Intergenic
1090085576 11:123647538-123647560 ATGAAAAAGTAGCATCAGAAGGG - Intronic
1090600454 11:128364449-128364471 CAGAATAAAAAAGATCAGAAGGG + Intergenic
1092092969 12:5819343-5819365 CTGGATAACAGGCATGGGAATGG + Intronic
1092623999 12:10305626-10305648 CTGAATAATCATCACCAGAATGG - Intergenic
1093035952 12:14332748-14332770 CTGGAGAACAAGCATGGGAATGG + Intergenic
1093379273 12:18471966-18471988 CTGCATTACAAAAATCAGAATGG + Intronic
1095129679 12:38524907-38524929 GTGAATAAAAAGGATCAGAAAGG - Intergenic
1096544267 12:52327011-52327033 CAGAATGGCAAGGATCAGAAAGG + Intergenic
1097431803 12:59518506-59518528 CTGAAGAACAGGCATAGGAATGG - Intergenic
1097821735 12:64134797-64134819 CTGGATAACAGGCATGGGAATGG - Intronic
1098880088 12:75908192-75908214 CTGAATAACAACCAACAGGGAGG + Intergenic
1099144878 12:79029437-79029459 CTCAAAACCAAGCAACAGAAAGG + Intronic
1099185720 12:79513791-79513813 CAGAATAACAACCATCAGAAAGG - Intergenic
1100785783 12:98076452-98076474 CTGAATGACAGGGATGAGAAAGG + Intergenic
1100866195 12:98859539-98859561 ATGAATAACAACAAACAGAAAGG + Intronic
1102485762 12:113255001-113255023 CTGAATAAAAATGATGAGAAGGG - Intronic
1106771750 13:32968083-32968105 CTGAATAACAACCTGCAGATTGG - Intergenic
1107965678 13:45596368-45596390 CTGTATAAAAAGTATCTGAAAGG - Exonic
1109239347 13:59864808-59864830 CTGAGTAGCAAGCAGCATAATGG + Intronic
1109515986 13:63443011-63443033 CTGGAGAACATGCATGAGAATGG + Intergenic
1111307072 13:86428487-86428509 ATGAATAAGAAGAATCAGTATGG - Intergenic
1112135183 13:96570342-96570364 CTGAATATTAAGCCACAGAAAGG + Intronic
1112771132 13:102795994-102796016 CTATATAAGAAACATCAGAATGG + Intronic
1114406012 14:22456944-22456966 ATGAATACCAAGCCTCAGAATGG - Intergenic
1115018646 14:28647852-28647874 CTGTCTAACACCCATCAGAATGG - Intergenic
1115601538 14:34960325-34960347 CTGAATAACAAGCTGCATACTGG - Intergenic
1115800788 14:36991237-36991259 CTGAATAACATTCAACAGAATGG + Intronic
1116214815 14:42000682-42000704 GTGAATAACAAGCATTGGCAAGG - Intergenic
1116630489 14:47324974-47324996 CTGAATAAAAAGTAGAAGAACGG + Intronic
1117596576 14:57332181-57332203 CTGAAGAACAGGCATGGGAATGG - Intergenic
1118950862 14:70435373-70435395 CTAAATAACAGGCATGGGAATGG - Intergenic
1119121716 14:72085551-72085573 CAAGATAATAAGCATCAGAAGGG + Intronic
1124049532 15:26183228-26183250 CTTAACAACAAACATCAGAATGG + Intergenic
1125008836 15:34848303-34848325 CTTAAAAACAAACATCAAAAAGG + Intergenic
1126348573 15:47720850-47720872 CTGCATAAAATGCATCAAAAGGG - Intronic
1126755746 15:51923383-51923405 CTCAAAAAGAAGCAGCAGAAGGG + Intronic
1126960164 15:53983890-53983912 CTGAATATGAACCATGAGAAAGG - Intergenic
1127696190 15:61450127-61450149 CTTAATAACAAGCTGCAAAAAGG + Intergenic
1128496126 15:68199639-68199661 CTGTATGACAAGCAGCAGAGGGG - Exonic
1128604643 15:69027736-69027758 CTTAAGAACAAGCAAAAGAAAGG + Intronic
1130262172 15:82364052-82364074 CTGAAAACCAAGCTTGAGAAAGG - Intergenic
1130279058 15:82504955-82504977 CTGAAAACCAAGCTTGAGAAAGG + Intergenic
1130623086 15:85484311-85484333 CTGAAAACCAAGCTTGAGAAAGG - Intronic
1131570475 15:93530039-93530061 CTGAGTAACAAACATTAAAATGG - Intergenic
1134138738 16:11698189-11698211 CTGAATAACGAGCTGAAGAAAGG - Exonic
1137629280 16:49930905-49930927 GTGATTCAGAAGCATCAGAACGG + Intergenic
1138629446 16:58281759-58281781 CTGAACCACGAGCAGCAGAAAGG + Exonic
1139977538 16:70826219-70826241 AATAATAACAAGCATCAGCAAGG - Intronic
1143556068 17:7661390-7661412 GTAAATAATAAGCAACAGAATGG - Intergenic
1145102686 17:20089931-20089953 CTGAATAACCAGCTTCAGCCCGG - Intronic
1146945621 17:36871099-36871121 CTGTATTACAAGCATCAGCTTGG + Intergenic
1147551025 17:41441579-41441601 CTATATATCAAGCATCAGCAAGG - Intergenic
1150727238 17:67661320-67661342 ATGAATAATAAGTATCTGAAGGG - Intronic
1152347261 17:79760748-79760770 CTTGAGAACAAGCACCAGAAAGG + Intergenic
1154010406 18:10569282-10569304 CTGGAGACCAAGCGTCAGAAGGG + Intergenic
1158011310 18:52731142-52731164 CTCAATAACTCGCATCAGGAAGG - Intronic
1158902565 18:61979663-61979685 CTGAATAAAAAGCAATAAAAAGG - Intergenic
1159251859 18:65889884-65889906 CTGATTAACAAGGATCACACTGG - Exonic
1168441786 19:56374483-56374505 CTGGATAACAAGGGTCAGATAGG - Intergenic
926268687 2:11348132-11348154 CTGAATGACAAGCAACAGACTGG - Intronic
926496583 2:13595767-13595789 GTAAATAACCAGCTTCAGAAAGG - Intergenic
927455004 2:23241673-23241695 GTGAATAACAAACATCTGCAAGG + Intergenic
928015708 2:27654989-27655011 ATGAAGTACAAGCATCAGGAAGG + Intronic
930295447 2:49547841-49547863 CTGAAGAACAGGCATGGGAATGG - Intergenic
930307658 2:49695702-49695724 CTTAATAACAGGCATGAAAAAGG + Intergenic
930657467 2:54020235-54020257 CTGATTAAGAAGCATCATTAAGG - Intronic
930988427 2:57619176-57619198 CTGACTAACAACCATCAGGCTGG + Intergenic
931107696 2:59074757-59074779 CTGTAAAACAAGCTTCAGAAGGG - Intergenic
931630558 2:64294801-64294823 CTGAGTAACAGGCATTAGAGAGG + Intergenic
932985025 2:76715733-76715755 CAGAATAAGAAACATGAGAACGG + Intergenic
933002700 2:76945917-76945939 GTGAAGAACAAGAATGAGAAGGG - Intronic
935814236 2:106831500-106831522 CTGAGAATCAAGCATCAGATGGG - Intronic
936246708 2:110834789-110834811 CTGAAAAACACCCAGCAGAAGGG + Intronic
937992117 2:127669969-127669991 AACAATAACAAGCATCAGCAAGG + Intronic
938672107 2:133596490-133596512 CACAATCTCAAGCATCAGAATGG + Intergenic
940278773 2:151967632-151967654 AGGAATAACAGGCATAAGAAAGG + Intronic
940501496 2:154500003-154500025 CTGGATAACTAGCACCAGCAAGG - Intergenic
941549111 2:166892172-166892194 GAGAATAAAAAACATCAGAATGG - Intronic
942012911 2:171781626-171781648 ATGAATAACAAGGATGTGAAAGG + Intergenic
942918317 2:181339700-181339722 CTGCATAACCATCATCACAATGG + Intergenic
943384312 2:187183148-187183170 CTGGAGAACAAGCATGGGAATGG - Intergenic
946435365 2:219648355-219648377 CTGTTTATCAAGCAACAGAAAGG + Intergenic
946899509 2:224358611-224358633 ATGGAGAACAAACATCAGAATGG + Intergenic
947411025 2:229839742-229839764 CTGAATAATTAGCAGCGGAATGG + Intronic
947503386 2:230688391-230688413 CCCAATTACAAGAATCAGAAGGG + Intergenic
1169604730 20:7304394-7304416 CTTAATATAAAGCTTCAGAAAGG + Intergenic
1171136144 20:22696328-22696350 CTGAAGAAGAACCATCAGAAAGG - Intergenic
1172204863 20:33156102-33156124 CTCAATAACAAGAATCACTACGG - Intergenic
1174263238 20:49312768-49312790 CTGAATGACAAGCAGCATCATGG + Intergenic
1174722695 20:52830564-52830586 CTGAAAGACTGGCATCAGAAAGG + Intergenic
1175128410 20:56769888-56769910 CTGACTAAAAAGCAACACAAGGG - Intergenic
1176997858 21:15577933-15577955 CTGGAGAACAGGCATGAGAATGG + Intergenic
1177363434 21:20103559-20103581 CTGAAGAACAGGCATGGGAACGG + Intergenic
1179131288 21:38639443-38639465 TTGAATAAAAAGGATCAGAGAGG + Intronic
1179518475 21:41926259-41926281 TTGAAAATCAAGCAACAGAAGGG + Intronic
1183150978 22:36037301-36037323 CTCAACAACAAGGATCAGATAGG - Intergenic
949245573 3:1922618-1922640 CTGGAGAACAAGCATGGGAATGG + Intergenic
949722485 3:7006592-7006614 CTGAATAATAGTCATAAGAAAGG - Intronic
951736859 3:25875751-25875773 CTCAATAACAAACATCACACAGG - Intergenic
955642400 3:61099958-61099980 AACAATAACAAGCATCAGCAAGG - Intronic
955830092 3:62992240-62992262 CTCAATAACAAGGAAAAGAATGG - Intergenic
957264927 3:77950761-77950783 ATGAAGAAAAAGCATCAGAAAGG - Intergenic
957634152 3:82759840-82759862 CTGAAGAACAGGCATGGGAATGG + Intergenic
957935989 3:86943455-86943477 ATGAATAACAAGCTTCTCAAAGG + Exonic
958992391 3:100861989-100862011 CAAAATAAGAAGCATCAGCATGG - Intronic
959392966 3:105799499-105799521 CCGCATAACAAGCATTAAAAAGG + Intronic
961852027 3:129830076-129830098 ATGAATAACAACCATGAGAATGG + Intronic
962536540 3:136334199-136334221 CTTTCTAACAAGCATTAGAAGGG - Intronic
963390213 3:144652575-144652597 CTGAAAGACTAGCTTCAGAAAGG - Intergenic
964348439 3:155778884-155778906 ATGAGGAACAAACATCAGAATGG + Intronic
964977493 3:162638082-162638104 CTGAATAACAAGTATGGGAATGG - Intergenic
966160100 3:176958705-176958727 CTGCATTCCAAGCAGCAGAATGG - Intergenic
971341858 4:25777432-25777454 CAGAAAAAGAAACATCAGAAAGG + Intronic
971364826 4:25969304-25969326 CTAAATAAAAAGCATGAAAAAGG - Intergenic
971685256 4:29757289-29757311 CTGGAGAACAGGCATGAGAATGG + Intergenic
972095222 4:35340391-35340413 CTGCATAACTGGCATGAGAATGG + Intergenic
974517349 4:62935113-62935135 CTGATTAACTATCACCAGAAAGG - Intergenic
974726788 4:65809170-65809192 CTGGAAAACAGGCATGAGAAAGG + Intergenic
974836812 4:67261099-67261121 CTGAAAAACATCCATTAGAATGG - Intergenic
975004146 4:69266722-69266744 CTGAATAGCAATGATTAGAATGG - Intergenic
976067634 4:81207185-81207207 ATGAATTACAAGCATAAGAAAGG + Intronic
978341954 4:107728560-107728582 CTGGAGAACAAGCATGGGAATGG - Intergenic
979341054 4:119524796-119524818 AAGAATAAGAAGCAGCAGAAAGG - Intronic
979450974 4:120870695-120870717 CTGAAGAACAAGGTTCAGAGAGG + Intronic
980033432 4:127856726-127856748 AGGAATAACAAGCATAAAAAAGG - Intergenic
980199347 4:129635530-129635552 GTGAATATCAAGCAGGAGAATGG - Intergenic
981042032 4:140232108-140232130 GAGAATAACAAGGATGAGAAAGG + Intergenic
982580395 4:157170678-157170700 TTGAAGAACAAGAAGCAGAAAGG - Exonic
982673393 4:158348675-158348697 CTTAAGACCAACCATCAGAAAGG - Intronic
983225852 4:165085508-165085530 ATAAATTCCAAGCATCAGAATGG + Intronic
983735094 4:171047383-171047405 TTGAATAACAGGAAACAGAAAGG + Intergenic
985905530 5:2832492-2832514 CTGAATAACCTGCTTCAGGAAGG - Intergenic
987657414 5:20823934-20823956 CTGAAGAACAGGCATGGGAATGG - Intergenic
987885329 5:23805583-23805605 CTGGAGAACAGGCATCAGAATGG + Intergenic
988766132 5:34380012-34380034 CTGAAGAACAGGCATGGGAATGG + Intergenic
989015465 5:36926606-36926628 GTGAATAAAATGCAGCAGAAAGG - Intronic
990364834 5:55059770-55059792 CTGGATAGCAAGCATATGAATGG + Intergenic
990668134 5:58096539-58096561 CTGAATATCCATCATCACAAAGG - Intergenic
992240455 5:74764618-74764640 CTTAATAACATGGATCACAATGG - Intronic
992381259 5:76240025-76240047 CAGAATAAAAAGCATAAGAAAGG - Intronic
994425816 5:99585982-99586004 TTGAATTACATGCCTCAGAAAGG + Intergenic
994864677 5:105251881-105251903 AAGAATAAAAAGCATCAGAAAGG + Intergenic
995279365 5:110316194-110316216 CTGAATAACAAGCATCAGAATGG - Intronic
996707816 5:126514662-126514684 CTGACCAAAAAGCATCAGGAAGG + Intergenic
998798474 5:145843656-145843678 CTGGGTGACAAGCCTCAGAAAGG + Intergenic
999075813 5:148793977-148793999 CTAAATTACAAGCATCTCAAGGG + Intergenic
1000264794 5:159624886-159624908 AGAAATAACAAACATCAGAACGG + Intergenic
1000466315 5:161581970-161581992 CTGAATCACAGTCTTCAGAATGG + Intronic
1000999601 5:167993384-167993406 CTAAATGACATCCATCAGAAGGG + Intronic
1004740812 6:18458824-18458846 CTGAATACCAGGAGTCAGAAAGG + Intronic
1006001198 6:30966477-30966499 CTGGAGAACAGGCATTAGAATGG + Intergenic
1007276423 6:40677629-40677651 CTCATTAAGAAGCATCGGAAGGG + Intergenic
1009390402 6:63137369-63137391 CTGAAGAACAGGCATGGGAATGG - Intergenic
1010060118 6:71613180-71613202 TTGAATAAAAAGCATCAGAGAGG - Intergenic
1010882171 6:81191068-81191090 CCGAAGATCAGGCATCAGAATGG + Intergenic
1011009577 6:82688468-82688490 CTGAACAAGAAGTATCTGAAAGG + Intergenic
1012730172 6:102872041-102872063 CTGGAGAACAAGCATGGGAATGG + Intergenic
1012795631 6:103757175-103757197 GGGAATTATAAGCATCAGAATGG + Intergenic
1013570159 6:111415148-111415170 ATGCATAAGAATCATCAGAAAGG + Intronic
1014635849 6:123845511-123845533 CTGTATAATAAAAATCAGAAAGG - Intronic
1014912645 6:127112824-127112846 ATGAATAACTAGAATCAGAATGG - Intergenic
1015475436 6:133655021-133655043 CTGGAGAACAAGCATGGGAATGG + Intergenic
1015842047 6:137487605-137487627 CTGAATAACCAGGAGGAGAAAGG + Intergenic
1016082104 6:139868618-139868640 CTGACTAACACACATCAGGATGG + Intergenic
1016120201 6:140334950-140334972 CTGGAGAACAGGCATAAGAATGG - Intergenic
1016164297 6:140921005-140921027 CTGAATAACAAGAATATAAAGGG - Intergenic
1016219905 6:141655309-141655331 CTGGAGAACAAGCATGGGAATGG + Intergenic
1018875561 6:167819433-167819455 AGGAATAACATGCATCAAAAGGG - Intergenic
1020998597 7:15298156-15298178 GTGTATAACAAGCATCATACTGG + Intronic
1021805539 7:24350937-24350959 CTGCAAATGAAGCATCAGAAGGG + Intergenic
1022414257 7:30164641-30164663 CTAATTAAAAAGCATCCGAAAGG - Intergenic
1022979453 7:35590602-35590624 CTGCTTACAAAGCATCAGAAAGG - Intergenic
1023649289 7:42351793-42351815 CTGATCTACAAGCATCAGAAGGG - Intergenic
1023763049 7:43484534-43484556 CTGAATAACACTCAAGAGAATGG - Intronic
1023783330 7:43679768-43679790 AGGAATAAGAAGCAGCAGAAAGG + Intronic
1026551703 7:71374418-71374440 CTGAAACACAAGGAGCAGAAAGG - Intronic
1029899575 7:104024548-104024570 GGGAATAAAAAGAATCAGAAAGG + Intergenic
1030401943 7:109062864-109062886 CTGAATTACATCCATCAGAATGG - Intergenic
1031438067 7:121757310-121757332 CTGAACAAAAAGCTTCAAAAAGG - Intergenic
1032699095 7:134363163-134363185 TTGAATAAGCAGCATGAGAAGGG - Intergenic
1033707691 7:143904854-143904876 CTGAAATGCAAGCAGCAGAAGGG + Intergenic
1035275296 7:157744814-157744836 CTGATGAAAAAGCAACAGAATGG + Intronic
1035424617 7:158761004-158761026 CAGAATAAAAAGTATCAAAAAGG - Intronic
1037563613 8:20097389-20097411 CTGAATAAGAAGAATAAGGAGGG - Intergenic
1037658024 8:20903641-20903663 CTGAAGAACAAGCAATAAAATGG + Intergenic
1037672259 8:21025176-21025198 ATTAATAACAAACATTAGAATGG + Intergenic
1039165848 8:34679374-34679396 CTGATTACCAGGCAGCAGAACGG - Intergenic
1039820766 8:41132650-41132672 CTGAATAACCTGCTTCTGAATGG + Intergenic
1043352044 8:79373286-79373308 GTGAACAAAAAGCAGCAGAATGG + Intergenic
1043548474 8:81341416-81341438 CTAAAACACAAGAATCAGAATGG - Intergenic
1043968411 8:86504836-86504858 CTAAATAATAAGCAGCAGAGGGG - Intronic
1044503037 8:92983875-92983897 CTGAAAAATAAACATGAGAATGG + Intronic
1044779137 8:95725082-95725104 GTGAAAACGAAGCATCAGAATGG - Intergenic
1046247590 8:111585203-111585225 ATGAATTACATGCATGAGAAAGG + Intergenic
1047605299 8:126468467-126468489 CTAATTATCAAGCTTCAGAAGGG - Intergenic
1048084181 8:131159446-131159468 CTGGAGAACAGGCATGAGAAAGG - Intergenic
1048279275 8:133093052-133093074 CTGAATAGCAAACAGCAGAAGGG - Intronic
1048465176 8:134659594-134659616 CTGGAGAACAATCATCAGAGAGG - Intronic
1048486839 8:134856224-134856246 CTGACTTACAAACATAAGAAGGG + Intergenic
1049526241 8:143128123-143128145 CTGATTTACAAACAGCAGAAGGG - Intergenic
1050637997 9:7633007-7633029 ATGAATATCAAACATCAAAAAGG - Intergenic
1050811066 9:9748325-9748347 CTTAATAACAAAAATAAGAAGGG + Intronic
1051790203 9:20793610-20793632 TTGAACAGCAAGCATCAGAAAGG + Intronic
1052022069 9:23537278-23537300 ATTAATGCCAAGCATCAGAAAGG - Intergenic
1052245898 9:26334389-26334411 CTGAATAATACACATCAGGAAGG - Intergenic
1055733214 9:79300330-79300352 TTGAATAAAAAGCAACTGAAGGG + Intergenic
1057110773 9:92468890-92468912 GTGAATAACAAGAATAAGTATGG + Intronic
1058010471 9:99971419-99971441 AACAATAAAAAGCATCAGAATGG - Intergenic
1060736192 9:126067867-126067889 CTGAAAAACAAGGAAAAGAAAGG - Intergenic
1187107877 X:16262812-16262834 GTGAATAACAGGTATCACAATGG - Intergenic
1187286482 X:17909395-17909417 ATGAATAAGAAGAATCAGTATGG - Intergenic
1188300170 X:28497812-28497834 ATGAACAAGAAGCATCAGATGGG - Intergenic
1191668911 X:63731024-63731046 TTTAATAAGAAGCAGCAGAAGGG + Intronic
1194032294 X:88832157-88832179 CTGGAGAACAGGCATGAGAATGG - Intergenic
1194179882 X:90698259-90698281 CTAGATAACAGGCATGAGAATGG - Intergenic
1195782672 X:108482171-108482193 CTGGAGAACAGGCATGAGAATGG - Intronic
1196490370 X:116258506-116258528 CTGAATAATAATCATCAAAGAGG + Intergenic
1197564210 X:128061538-128061560 CGAAATAACAAAGATCAGAATGG + Intergenic
1198722856 X:139642732-139642754 CTGAATTACAAGGAGCAGAAGGG - Intronic
1198863652 X:141097179-141097201 CTGAATAACTTACAGCAGAATGG + Intergenic
1198899035 X:141490198-141490220 CTGAATAACTTACAGCAGAATGG - Intergenic
1199600025 X:149536385-149536407 CTGACCAAAAAGCATCTGAAGGG + Intergenic
1199627374 X:149752896-149752918 CTGGAGAACAGGCATGAGAATGG - Intergenic
1199650557 X:149943555-149943577 CTGACCAAAAAGCATCTGAAGGG - Intergenic
1200526538 Y:4280428-4280450 CTAGATAACAGGCATGAGAATGG - Intergenic