ID: 995280085

View in Genome Browser
Species Human (GRCh38)
Location 5:110324532-110324554
Sequence AAGATGCCTTCAACTATGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 147}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995280085 Original CRISPR AAGATGCCTTCAACTATGAA AGG (reversed) Intronic
909208081 1:72786823-72786845 AAGGTAACTTCAAATATGAAAGG + Intergenic
909541890 1:76800824-76800846 GAGATGTTTTCAACTCTGAAAGG - Intergenic
909789966 1:79663984-79664006 ATGGTGCCTTCTACAATGAAGGG - Intergenic
912543734 1:110436227-110436249 AAGATGCCTTGAATTAACAAAGG + Intergenic
914865434 1:151424044-151424066 TAGATGACTTCTACTATGGACGG - Exonic
921990656 1:221362606-221362628 AAAATGCCTTTAAGTATGTATGG - Intergenic
922426865 1:225505435-225505457 AAAATGCTTTAAACTATGACTGG - Intronic
924688971 1:246326153-246326175 AACATGCCTTAAAATATTAATGG + Intronic
1068092783 10:52453582-52453604 CAGATTCCTGGAACTATGAAAGG + Intergenic
1070784513 10:79155253-79155275 AAGAGGCCTTGAACTCTGACAGG - Intronic
1070878219 10:79835656-79835678 AGGATGCCTCCAAATGTGAAAGG + Intergenic
1071422093 10:85510935-85510957 TAGATCCCTTCCATTATGAAGGG + Intergenic
1071572928 10:86707987-86708009 AAGAAGCCTCCCAATATGAATGG + Intronic
1071644768 10:87351984-87352006 AGGATGCCTCCAAATGTGAAAGG + Intergenic
1071902581 10:90136941-90136963 ACCATGCCTTCAACTATGGGTGG + Intergenic
1075367324 10:121903705-121903727 CAGATACCTTCAACTAAGCAAGG - Intronic
1076180008 10:128399682-128399704 ATGATGCATTCAACTAAGTAAGG + Intergenic
1076334900 10:129700044-129700066 AAGATGTGTTCAACTATGAAAGG - Intronic
1081019291 11:37923690-37923712 AGGAGCCCTTCAACTATTAATGG + Intergenic
1083090897 11:60199962-60199984 AACATGCATCCAACTATTAAAGG - Intergenic
1084049447 11:66590290-66590312 ATTATGCTTCCAACTATGAAGGG - Exonic
1085269526 11:75262115-75262137 AAGAGGCCTTACACTTTGAAGGG + Intergenic
1085502593 11:77037593-77037615 TAGAGGCCTTCCACTATTAAAGG + Intronic
1087634759 11:100689604-100689626 AAGATTTCTTCACTTATGAATGG - Intronic
1087830150 11:102810889-102810911 CAGATGTCTTCAACTAAGAGGGG + Intergenic
1093396306 12:18687075-18687097 AATGTGCCTTCAACTCTAAAGGG + Intronic
1099047823 12:77745603-77745625 AAGATGCCTTCAACTCATCAAGG - Intergenic
1099447062 12:82765231-82765253 AAGGTGCTTTGAAATATGAAAGG - Intronic
1108085660 13:46789288-46789310 AAGATGTTTTCATATATGAAAGG - Intronic
1108978925 13:56484981-56485003 AAAATGACTTCAACTTTGGAAGG + Intergenic
1117214401 14:53535693-53535715 AAGATGCCTTTATTTACGAAAGG + Intergenic
1117674890 14:58145400-58145422 ATGTTGCCATCAACTAGGAAAGG + Intronic
1118819118 14:69333501-69333523 AAGATTCCTCCAGCTATGACAGG - Exonic
1122521863 14:102350002-102350024 AAGCTGTCTTCAACTACCAAGGG - Exonic
1124089854 15:26588575-26588597 AAGATACATTCAACTTTTAAAGG + Intronic
1125616788 15:41021557-41021579 AAGATGACTTCAAATATGCCAGG - Intronic
1127548131 15:60009074-60009096 AAGATGCCTGCATTTGTGAAAGG - Intronic
1129764121 15:78150034-78150056 AAGATGCCCTATCCTATGAAGGG - Intronic
1130808346 15:87350872-87350894 AAGCTGCCTTCAATAATGGAGGG + Intergenic
1138575825 16:57906783-57906805 AAGATTCCTCCAGCTAGGAAGGG - Intronic
1149729737 17:58933413-58933435 AAGATGCCTTCTACCATGGGGGG + Intronic
1153421499 18:4911353-4911375 AAGAAGCTTTCAACAATGGAAGG - Intergenic
1153682319 18:7512279-7512301 AAGAGGCTTTTAAATATGAAAGG - Intergenic
1153704100 18:7727347-7727369 CAGATGCCTTTAACCTTGAAAGG + Intronic
1153790079 18:8571094-8571116 GAAATGCCTTCATCTCTGAAGGG - Intergenic
1154476948 18:14770075-14770097 AAAATGCCTGCAACTAGGCAGGG - Intronic
1157461837 18:47904255-47904277 CAAATGCCTTCAACTATGACGGG + Intronic
1157940835 18:51927518-51927540 AAGATGCTCTCAGCTTTGAAAGG - Intergenic
1158546510 18:58402460-58402482 AAGATGCCATCTACTGTTAATGG - Intergenic
1159748197 18:72266052-72266074 AATATGCCTCAAACTCTGAAAGG - Intergenic
1159952868 18:74497360-74497382 TATATGCCTTCAATTATCAAGGG + Intronic
1160099564 18:75907409-75907431 AAAATGCTTTTAATTATGAAGGG + Intergenic
1161644604 19:5445318-5445340 AAGATTCCTTCTACAATGGAAGG + Intergenic
1164729728 19:30494349-30494371 AAGACGCCTGCAACTTTGCAAGG - Intronic
928331250 2:30359688-30359710 CAGATTCCTGTAACTATGAAGGG - Intergenic
929187574 2:39111252-39111274 AAGATGGATTCAAGGATGAAGGG + Intronic
929846170 2:45530616-45530638 AAGATGCTATTAACTGTGAAGGG + Intronic
933421518 2:82052317-82052339 AAGATGTATTCAGGTATGAAAGG + Intergenic
934530973 2:95088681-95088703 AAAATGCCATCAGCTATAAAAGG - Intronic
935231584 2:101102469-101102491 AAAATCTCTTCAAGTATGAAAGG + Intronic
935359720 2:102237221-102237243 GAGATGCCCTCAAATCTGAATGG + Intronic
938649840 2:133371592-133371614 AATATTTCTTCAACTCTGAATGG + Intronic
940857200 2:158738750-158738772 AAGATGCCTTCAAAAAGGTAAGG - Intergenic
942017555 2:171832107-171832129 AAAGTGCCTTGAACTAGGAATGG - Intronic
942918009 2:181336005-181336027 AAGATGCTTCCAAATAAGAAGGG + Intergenic
946095364 2:217270010-217270032 AAGCTGTCTTCAATTAGGAAGGG + Intergenic
946965575 2:225033903-225033925 AAGGCTCCTTCAACTGTGAAAGG - Intronic
948606689 2:239140436-239140458 AAGATCCCTTCACCTCTGAAGGG + Intronic
948955910 2:241291079-241291101 AAGATGCCTCCATCTAGAAAGGG + Intronic
1168940181 20:1704039-1704061 AAGATGGCTTCACCTATTCATGG - Intergenic
1170232010 20:14059444-14059466 AAGATGCTTTAAATTTTGAAGGG + Intronic
1173076324 20:39823260-39823282 ATGAGGACTTCAACTATGAAAGG + Intergenic
1177421001 21:20856780-20856802 AATATGCCTTTTACTTTGAAGGG - Intergenic
1179391410 21:40995268-40995290 AAGATGCTTTTACCTAGGAAAGG - Intergenic
1180988392 22:19918889-19918911 AAGATGCCCCCAACTATGGCTGG - Exonic
950628308 3:14264740-14264762 AACATGCCTTCAATAATGTAAGG - Intergenic
951984711 3:28605964-28605986 AACATTCCTTAAACTATCAATGG + Intergenic
954507240 3:51088849-51088871 ATGATGCCTTTAACAATAAAGGG - Intronic
956522761 3:70123737-70123759 AAGGTGCCTTCAAGTTTGTAGGG + Intergenic
957634975 3:82770748-82770770 AATATCCCTTCAGCTATGGAGGG - Intergenic
958048307 3:88313413-88313435 AACATGCCATCAGCTAGGAAAGG - Intergenic
958620961 3:96559121-96559143 AAGCTTCCTTCAACTAATAAAGG + Intergenic
960463512 3:117966714-117966736 AAGATGCATACAAGTATGCATGG - Intergenic
960587808 3:119336222-119336244 AAGATTCATTTAACTATAAAAGG + Intronic
963432861 3:145231690-145231712 AAGCTGCCTTCAATACTGAAAGG - Intergenic
964194690 3:154049030-154049052 AAGATGCCTTCTACTTTTAATGG - Intergenic
965330228 3:167363532-167363554 AAGAGGCCTTCACCAAGGAAAGG - Intronic
967594149 3:191310693-191310715 CAGATGCCAAGAACTATGAAGGG - Intronic
967810550 3:193757020-193757042 TAGATCCCTTCAACAATGCAGGG - Intergenic
970198184 4:13574067-13574089 AAGCTGCCCTCAAATATGTAAGG + Intronic
970780760 4:19734721-19734743 AAAATACTTCCAACTATGAAGGG - Intergenic
971787300 4:31120903-31120925 AAGATGCCTTCAATTGTGCCAGG + Intronic
974330860 4:60476635-60476657 AAGAACACTTCAAATATGAAAGG - Intergenic
976706899 4:88028456-88028478 ATTAAGCCTTCAACTATGACTGG + Intronic
976751055 4:88451723-88451745 AAGATGCCCTTAACTAGGAATGG - Intergenic
977850031 4:101816376-101816398 AAGATGGCTTGAGCTATGGATGG - Intronic
978888980 4:113799681-113799703 AAGATTCCTCCAGCCATGAAAGG - Intergenic
980038333 4:127910511-127910533 AAGATTCCTACAAATATAAATGG + Intergenic
980577944 4:134709488-134709510 AAAATGCCTGAAAATATGAAAGG - Intergenic
981029420 4:140109218-140109240 AGGATACCTTCAACTGTGGAGGG - Intronic
983302959 4:165950470-165950492 GAGATTCCTTCAAGTATGCATGG + Intronic
983809605 4:172043783-172043805 AAGATATCTTCAATTTTGAAAGG + Intronic
984185351 4:176536869-176536891 AATTTGCCTTCTACTCTGAAGGG + Intergenic
984457670 4:179991501-179991523 AAGATGCCATCAGCAATGACAGG + Intergenic
985199485 4:187470327-187470349 AAGATGGCTTCACAGATGAATGG + Intergenic
986138155 5:5002452-5002474 AAAATGCATTCAACTCTGAAAGG + Intergenic
986242918 5:5977573-5977595 AAGATGCCTTCTGCCATGATTGG + Intergenic
986341979 5:6796978-6797000 AAGATGCTCTCAACTGCGAAAGG - Intergenic
989129691 5:38094723-38094745 CAGATGATTTCAACTATTAAGGG - Intergenic
990072859 5:51806491-51806513 ATGATGACTTCAAATTTGAAGGG + Intergenic
993587827 5:89753901-89753923 AAAATGCTTACAACTATTAAAGG - Intergenic
995280085 5:110324532-110324554 AAGATGCCTTCAACTATGAAAGG - Intronic
998525034 5:142834816-142834838 AAACTGCCTCCAACTCTGAATGG + Intronic
1003814137 6:9818364-9818386 AAGAAAACTTCAAATATGAAGGG + Intronic
1005895347 6:30172774-30172796 AAGATGCCTCCACCTTTGTAGGG + Intergenic
1008038226 6:46769865-46769887 ACATTTCCTTCAACTATGAATGG + Intergenic
1008351984 6:50502311-50502333 AAGATACTTTTGACTATGAATGG + Intergenic
1009721354 6:67474643-67474665 AAGATGCCTTGGAATATCAAAGG - Intergenic
1010037755 6:71345700-71345722 ATGATGGCTTCAAGTATGTAGGG + Intergenic
1010149518 6:72714168-72714190 AAGAGGCCTTCAACAACAAATGG - Intronic
1012762361 6:103318075-103318097 TAGATGCCTACAACCATGACTGG - Intergenic
1013157111 6:107503458-107503480 ATGATGCATTCAATTATGACAGG - Intronic
1014846161 6:126279695-126279717 AATTTGCCAGCAACTATGAAAGG - Intergenic
1016725800 6:147365840-147365862 AAGATGCCTACAAATATTTATGG + Intronic
1016794775 6:148106216-148106238 AAGATGCTTTTATCTCTGAAAGG + Intergenic
1018256752 6:161928095-161928117 AAGTTGCCTTCTGCTATGTAAGG + Intronic
1021043513 7:15892720-15892742 AAGATTGCTTCAGCAATGAATGG + Intergenic
1023366925 7:39474083-39474105 AGGAAGCATTCAACTCTGAAGGG + Intronic
1024172089 7:46800018-46800040 GAGATGTCTTCAACTGTAAATGG + Intergenic
1026467830 7:70669704-70669726 ACGATGACTTCAACTCTCAAAGG - Intronic
1027984650 7:85271841-85271863 AAGATGCCTTCATCTATTTTAGG + Intergenic
1028416413 7:90585112-90585134 TAAATGCTTTCAAATATGAAAGG - Intronic
1030413135 7:109207094-109207116 TCAATGCCTTCATCTATGAATGG + Intergenic
1035060823 7:156068141-156068163 AAGATGTCTTCAATAATCAAAGG + Intergenic
1035095390 7:156350119-156350141 AAGGTGCTTTCAGCAATGAAAGG + Intergenic
1035652463 8:1278754-1278776 AAGATCCCTTTGACAATGAAAGG + Intergenic
1037673454 8:21035172-21035194 ATGATGCCTTCAATTACAAAAGG - Intergenic
1040645345 8:49390640-49390662 TAGATTCCTGCAAATATGAAAGG - Intergenic
1040873470 8:52125116-52125138 AAAATGCATTCAAGTATCAAAGG + Intronic
1042088190 8:65131554-65131576 AGGATGTCTTGAACTAAGAAAGG - Intergenic
1043838892 8:85078190-85078212 AAGATGCCTTTCAGTAGGAATGG - Intergenic
1043934589 8:86129139-86129161 AATATTCATTCAACTTTGAATGG - Intronic
1044472510 8:92586415-92586437 ATTAGGCCTTCAAGTATGAATGG + Intergenic
1046765286 8:118062562-118062584 ATGATTCCTTCCACTTTGAATGG - Intronic
1049911697 9:275268-275290 AAGGTGACTTCAGCTCTGAAGGG + Intronic
1052605422 9:30692119-30692141 ATGATGTCTTGAACTTTGAAGGG - Intergenic
1053159458 9:35803972-35803994 AGGATGCCTTCAACAATCACAGG - Intronic
1053448689 9:38173956-38173978 AAGATACCTTCAAATATGCAAGG + Intergenic
1054729969 9:68691601-68691623 AAGCTGCCTTCAACTTTGTGTGG - Intergenic
1186939189 X:14486127-14486149 AAGATACGTTAAAATATGAAAGG + Intergenic
1187642484 X:21310009-21310031 AAAATGTATTTAACTATGAATGG - Intergenic
1189578998 X:42385850-42385872 AAGATGCCTTCATCCAAGCATGG - Intergenic
1190118364 X:47640283-47640305 TAAATGCCATAAACTATGAAGGG + Intronic
1198475433 X:136992470-136992492 AAGATGCCTTCAAGTTAGACAGG - Intergenic
1199081973 X:143587236-143587258 AAGATGGCTACAAAGATGAAAGG + Intergenic
1200368851 X:155699602-155699624 ATGAAGCCTTGAACTATGGAGGG + Intergenic