ID: 995280647

View in Genome Browser
Species Human (GRCh38)
Location 5:110331758-110331780
Sequence CCTCACATGTGGAAGGGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 367
Summary {0: 1, 1: 1, 2: 6, 3: 31, 4: 328}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995280647_995280656 16 Left 995280647 5:110331758-110331780 CCCTTCCCCTTCCACATGTGAGG 0: 1
1: 1
2: 6
3: 31
4: 328
Right 995280656 5:110331797-110331819 TAACTGATGAACCAGAAAGCAGG 0: 1
1: 0
2: 1
3: 27
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995280647 Original CRISPR CCTCACATGTGGAAGGGGAA GGG (reversed) Intronic
900702335 1:4056006-4056028 CCTCACTGGTGGAAGGGGCCAGG - Intergenic
901809571 1:11759834-11759856 CCTCATATGTAAAAGGGGGATGG - Intergenic
902542860 1:17166780-17166802 CCTGAGATGTGGATGGGGGAAGG + Intergenic
902572253 1:17354372-17354394 TATCACATGTGGAAGGTTAAAGG - Intronic
902652384 1:17845126-17845148 GGTCACATGGGGAAGGGGAAAGG - Intergenic
903029718 1:20454993-20455015 CCTCCCCTGTGGAATGGGAATGG + Intergenic
903344852 1:22677397-22677419 CCCTACAAGGGGAAGGGGAAAGG + Intergenic
903882646 1:26522053-26522075 CCTCATCTGAGGAATGGGAATGG - Intergenic
904499014 1:30903400-30903422 CCACACATGTGTATGCGGAAGGG - Intronic
904608701 1:31713560-31713582 CTTGAGATGGGGAAGGGGAATGG + Intergenic
907267746 1:53272970-53272992 CCTGAAAGGGGGAAGGGGAAAGG + Intronic
907570815 1:55481876-55481898 CCACACATGAGGATGGGGACTGG - Intergenic
907975242 1:59425434-59425456 CTTCACAAGTGTAATGGGAAGGG - Intronic
910138015 1:83995503-83995525 CCAATCATGTTGAAGGGGAAGGG - Intronic
910712650 1:90197557-90197579 CCTTCCATGGGGAAGGGGGATGG + Intergenic
911095637 1:94052864-94052886 ACTCAGATGTGGTAGAGGAAGGG - Intronic
914438296 1:147680234-147680256 CCACAGTTGTGGAAGGGGACTGG + Intergenic
915678172 1:157551346-157551368 CCTCACAGTTGGAAGGTGCATGG - Intronic
915922903 1:159990510-159990532 CCTCATATGGGGAAGGGAGAGGG - Intergenic
917089261 1:171336539-171336561 CCTCATGTGTGGAAGGGGCCTGG - Intronic
917976079 1:180239350-180239372 CCTTACATGTGGGAAAGGAATGG + Intronic
921221524 1:212977295-212977317 CCTCACCTGTGTAAGGGGACGGG + Intronic
921263017 1:213400532-213400554 CCTCATCTCTGGAAGGGGCAGGG - Intergenic
921411861 1:214844663-214844685 CCTCAGATCTGGAAGGGGAATGG - Intergenic
922188558 1:223297212-223297234 GCTAACATGTGGAGAGGGAAGGG + Intronic
922659322 1:227415973-227415995 GCTCACATGTGCCAGGTGAAAGG + Intergenic
922712092 1:227841948-227841970 CCACTCATGGGGAAGGGGAAGGG + Intronic
923330714 1:232921845-232921867 CCTAACATGAGAAAGGGGAGAGG + Intergenic
924862211 1:247936690-247936712 CCAGACATGTGGGAGGGGAATGG + Intergenic
1063278774 10:4601769-4601791 CCTCACAATTGGAAGGTGAAAGG + Intergenic
1065772911 10:29094245-29094267 CCACTCAGGTGGAAGGTGAAGGG + Intergenic
1065990643 10:31006459-31006481 CCAGGCATGTGGAAGGGGCAAGG - Intronic
1066693777 10:38060279-38060301 CCTCACCTGTGGAAGCAGAGTGG - Intronic
1066999040 10:42588863-42588885 CCTCACCTGTGGAAGCAGAGTGG + Intronic
1067225357 10:44372811-44372833 GCTCCCATGTGGATGGAGAAGGG + Intronic
1067944236 10:50680249-50680271 CCTCACATGGGGCTGGGGGAAGG + Intergenic
1069791420 10:71024676-71024698 CATCCCATGTGGAAGGTGGAAGG - Intergenic
1069838108 10:71321925-71321947 CCTCACAAATGAAATGGGAATGG + Intronic
1070656100 10:78272516-78272538 TCTCACTAGTGGAAGGGGAGTGG - Intergenic
1071646080 10:87361558-87361580 CCTCACATGGGGCCGGGGGAAGG + Intronic
1072208706 10:93226618-93226640 CATGTCATGTGGAAGAGGAAGGG + Intergenic
1073065845 10:100758835-100758857 CCACGCAAGTGGAAGGGGATGGG + Intronic
1073077786 10:100835575-100835597 ACTCAGATGGGGAAGGGGATGGG + Intergenic
1073491276 10:103855107-103855129 CCTCACAGCTGGGAGGGGCAAGG + Intronic
1073972821 10:109063889-109063911 CCTCAGAAGGGAAAGGGGAAGGG - Intergenic
1075200004 10:120394705-120394727 CCTCACAAGGGAAGGGGGAAGGG + Intergenic
1075237697 10:120745904-120745926 CCTAACATAAGGGAGGGGAAGGG - Intergenic
1075801230 10:125154799-125154821 GCTCCCACGTGGAAGGAGAAGGG + Intronic
1076746753 10:132518349-132518371 CCTCAGATGGGGATGGGGAGTGG - Intergenic
1077751187 11:4971792-4971814 ACTCATTGGTGGAAGGGGAAAGG + Intronic
1077907092 11:6543062-6543084 CCTCACATGGGGAAGAGTAAGGG + Intronic
1078036238 11:7808024-7808046 CCCCACATGTGGGAGGGGCCTGG - Intergenic
1078775068 11:14386234-14386256 CCTCACATGTGGAAGGGGAGAGG - Intergenic
1079796437 11:24809286-24809308 ATTCACATGTGGAGTGGGAAGGG + Intronic
1080257346 11:30305849-30305871 CCTCACATGGTGAAAGGCAATGG + Intergenic
1080412663 11:32040478-32040500 CCCCTCAGGTGCAAGGGGAAGGG + Intronic
1080695931 11:34602958-34602980 CCTCACTTGTTAAAGGGAAAGGG + Intergenic
1081273711 11:41120667-41120689 CCTTAGATCTGAAAGGGGAAAGG - Intronic
1081781847 11:45718478-45718500 ACGCCCATGTGGAAGGGAAAGGG + Intergenic
1081821081 11:45995587-45995609 GCTCTCATGTGGAAGGTTAATGG - Intronic
1084359097 11:68657978-68658000 CCAGACATGCGGCAGGGGAAAGG + Intergenic
1084566287 11:69930827-69930849 GCTCCCATGTGGCAGGGGCAAGG - Intergenic
1084643895 11:70443182-70443204 CCACTCATGGGGGAGGGGAAGGG + Intergenic
1084727113 11:70949174-70949196 ACTCACATGTGGAAGAGAAAAGG + Intronic
1086913476 11:92499924-92499946 CCTGACATTTGTAAAGGGAATGG - Intronic
1088162059 11:106884032-106884054 CCTGTCATGGGGAAGGGGGAGGG + Intronic
1088700531 11:112407506-112407528 CCTTACATTTGGAAGGGGTGAGG + Intergenic
1089212840 11:116817657-116817679 CCTCGCACGTGGAAGGGGCAAGG + Intergenic
1089298890 11:117486041-117486063 CCTCACATGTACAAGTGGCAGGG + Intronic
1090386419 11:126359899-126359921 CCACACGTGGGGAAGGGGAGGGG + Intronic
1090721672 11:129481026-129481048 CTTGATATGTGGAAGGGAAATGG + Intergenic
1091585351 12:1812849-1812871 CCTCATCTGTGAAACGGGAACGG + Intronic
1091613691 12:2033126-2033148 CCTCCCCTCTGGAAGTGGAATGG - Intronic
1092068874 12:5616321-5616343 CCTCTCATGGTCAAGGGGAAAGG + Intronic
1096598379 12:52712501-52712523 CCTGTCATGTGGTAGGGGGAGGG + Intergenic
1097237340 12:57549502-57549524 CTTTGGATGTGGAAGGGGAAGGG + Intergenic
1097536245 12:60873421-60873443 CCTCCAACGTGGAAGGGGACGGG + Intergenic
1098613048 12:72485580-72485602 CCTCACCTGTAGAATGGGGAGGG - Intronic
1100779323 12:98007503-98007525 TCTCACTTGTGGAGGGGGTAAGG - Intergenic
1101885477 12:108657557-108657579 CCTCATCTGGGGAAGGGGGATGG - Intronic
1103020277 12:117528444-117528466 CCCCAAATGAGGATGGGGAAGGG - Intronic
1106155694 13:27153610-27153632 GGTGACTTGTGGAAGGGGAAAGG - Intronic
1107672416 13:42759786-42759808 CCTTTCATGAGGAAGAGGAAGGG - Intergenic
1107682563 13:42866726-42866748 CACCACCTCTGGAAGGGGAAAGG - Intergenic
1108140481 13:47415982-47416004 CCCCACCTGTGAAAGGGGGAGGG - Intergenic
1110138784 13:72101716-72101738 CCTCCCATGTGGGTTGGGAATGG - Intergenic
1110287999 13:73772508-73772530 TCTCAGATGTGGAAAAGGAAAGG + Intronic
1112309822 13:98308432-98308454 CATCACCTGAGGAAGGGGAATGG + Intronic
1113085973 13:106569948-106569970 CCTCACATGAGGGAAGGGATGGG + Intergenic
1114692426 14:24596081-24596103 CCCCAACTGTGGAAGTGGAAAGG - Intergenic
1115443381 14:33461871-33461893 CATCACTTGTGAAATGGGAATGG + Intronic
1116516872 14:45815192-45815214 CCTAATATCTAGAAGGGGAAAGG + Intergenic
1118318499 14:64739740-64739762 CCTCACATGGCAAAGGGGCAAGG + Intronic
1118851477 14:69587126-69587148 CCCCACAAGTTGATGGGGAAAGG - Intergenic
1119181360 14:72607384-72607406 CTTCACATGGTGAAGGGGCAAGG + Intergenic
1119892041 14:78190135-78190157 CCTCAATTGTGGAAGAGGGAAGG - Intergenic
1120624447 14:86807309-86807331 CCTCACATGTGGAAGGCAGAGGG + Intergenic
1121916574 14:97841152-97841174 CTCTGCATGTGGAAGGGGAATGG - Intergenic
1122006195 14:98705868-98705890 CCTCACCTGTGAAATGGGGAGGG + Intergenic
1122138518 14:99648328-99648350 CCTCATCTGTGGAAGGGGAAAGG - Intronic
1122242094 14:100375881-100375903 CCTCATCTGTGGAATGGGCATGG + Intronic
1122495847 14:102154371-102154393 CCTCACATGGTGGAGGGGGAAGG + Intronic
1122621399 14:103059507-103059529 CCTGAGATGAGCAAGGGGAAAGG + Intergenic
1122769275 14:104090694-104090716 CCTCACAGGTGGAAGGCCACAGG - Intronic
1123000424 14:105291098-105291120 ACTGACATGTGGAAGGGGCCAGG + Intronic
1124204624 15:27706595-27706617 CCTGTGATCTGGAAGGGGAATGG - Intergenic
1125006370 15:34822256-34822278 CCTCACATGCTGAAGCGGGATGG - Intergenic
1128529522 15:68434208-68434230 CCTCACAGGTGCCTGGGGAATGG + Intergenic
1129898001 15:79122828-79122850 CCACTCAGGTGGAAGGGGAGAGG + Intergenic
1130162497 15:81415182-81415204 CCTCACAAGTGGAAGTGGCAAGG - Intergenic
1130510315 15:84583504-84583526 CCTTATAAGTGGATGGGGAAAGG - Intergenic
1132999297 16:2841072-2841094 CCTCAGACCTGGGAGGGGAATGG + Intergenic
1134056200 16:11171204-11171226 CCTCTCAGCTGGAAGGGGGAAGG + Intronic
1134572825 16:15306254-15306276 CCTCATATGTGGAAGGTGGAAGG - Intergenic
1134729561 16:16449782-16449804 CCTCATATGTGGAAGTTGGAAGG + Intergenic
1134937875 16:18262124-18262146 CCTCATATGTGGAAGGTGGAAGG - Intergenic
1135043609 16:19136504-19136526 GTTCACATCTGGATGGGGAAAGG - Intronic
1137791153 16:51175925-51175947 CATCACATGTGAGAGAGGAAGGG - Intergenic
1138121679 16:54405364-54405386 CCTCATCTGTAGAATGGGAAGGG + Intergenic
1139327610 16:66164320-66164342 CCTCAAATGGGGCAGGGGGAAGG + Intergenic
1139336441 16:66235032-66235054 CCTCACATGGTGAAGGGAGAAGG - Intergenic
1139482785 16:67239910-67239932 ACACAGATGAGGAAGGGGAATGG + Intronic
1140455103 16:75100394-75100416 CCTCACTAGGGGAAAGGGAAGGG - Intronic
1140690301 16:77477398-77477420 CCTCACATGGTGAAGGTGGAGGG + Intergenic
1141499625 16:84434888-84434910 CATCCCATATGGCAGGGGAAGGG - Intronic
1141926494 16:87173652-87173674 CGTCCCAAGAGGAAGGGGAAAGG - Intronic
1144779560 17:17800987-17801009 CCTGGCATGTGGAAGGGGCTTGG + Intronic
1146004879 17:29154872-29154894 CCACACATGAGGGAGGGGCAGGG + Intronic
1149576197 17:57715377-57715399 CCTCACCTGTGCAATGGGGAGGG - Intergenic
1149633923 17:58150846-58150868 CCGCAGGTGTGCAAGGGGAAGGG - Intergenic
1151759080 17:76090502-76090524 CGTCAGATGGGGATGGGGAAGGG + Intronic
1152326136 17:79638824-79638846 CCACTCATGTAGAAGGTGAAGGG - Intergenic
1152966592 18:121031-121053 CCTCATATGAGTAAGAGGAAGGG + Intergenic
1153280613 18:3411105-3411127 CCTCCCAGGTAGCAGGGGAAAGG + Intergenic
1153280844 18:3412476-3412498 CCTCCCAGGTAGCAGGGGAAAGG - Intronic
1154486301 18:14874054-14874076 CCTCACCTGTAGAATGGGAATGG + Intergenic
1154927394 18:20951035-20951057 CCTCATATGAGTAAGAGGAAGGG - Exonic
1156367217 18:36440388-36440410 CCTCAAATAAGGAAGGGGAGTGG - Intronic
1156659064 18:39325218-39325240 TCTCCCAGGTGGGAGGGGAAAGG - Intergenic
1157035115 18:43962264-43962286 ATTCATATGTGGAAGAGGAAAGG - Intergenic
1157403978 18:47408428-47408450 CCTGAGAAGGGGAAGGGGAAGGG + Intergenic
1158299527 18:56035687-56035709 TCTCACATGGGGGAAGGGAAAGG + Intergenic
1159371777 18:67536795-67536817 CCTCAAATTTAGAAGAGGAAAGG + Intergenic
1160044185 18:75371492-75371514 CCTCATCTGTGGGATGGGAATGG + Intergenic
1160368464 18:78349972-78349994 CAGCACCTGAGGAAGGGGAAGGG - Intergenic
1160378615 18:78431967-78431989 GCTCACGTGAAGAAGGGGAAGGG - Intergenic
1160428010 18:78791589-78791611 CCTCACTTGTGGAATGGGAGTGG - Intergenic
1160565737 18:79785758-79785780 CCTCACCTGTGCAATGAGAAGGG + Intergenic
1160689129 19:452918-452940 CTTCACTTGTGGAAGGGAACGGG - Intronic
1161476967 19:4491551-4491573 ACCGACATCTGGAAGGGGAACGG - Exonic
1161616907 19:5276019-5276041 CCTCACATGTAAAATGGGGATGG - Intronic
1161684251 19:5695245-5695267 CAGCACATGAGGAAGGGGACTGG + Intronic
1161772813 19:6240489-6240511 CCTCACCTGTGAAGTGGGAAAGG + Intronic
1162095882 19:8309713-8309735 CCTGCCCTCTGGAAGGGGAAAGG - Intronic
1165146582 19:33734806-33734828 CCTGACATGGGGACAGGGAAAGG + Intronic
1167593785 19:50417379-50417401 GCTCACAGCTGGAAGGGGATGGG - Intronic
1168334992 19:55592514-55592536 CCGCAGATGTGGCAAGGGAAGGG + Exonic
1168523253 19:57069183-57069205 CCTCCCATGGAGAAGGGGAGCGG - Intergenic
926370178 2:12171408-12171430 CCCCACATGTGGAGGGAGAGAGG - Intergenic
926396441 2:12447380-12447402 CCTCACATGGCAAAAGGGAAGGG - Intergenic
927204150 2:20596463-20596485 CCTCACATGTGAAAGTGGCAAGG - Intronic
928205631 2:29281278-29281300 CCTCAGCTCTGGATGGGGAAAGG + Intronic
929252079 2:39769254-39769276 CCTCAGATGTTTAAGAGGAATGG - Intronic
930399085 2:50860449-50860471 CCTGACATGTGGAAGGGTTGGGG + Intronic
930567199 2:53035799-53035821 GAGCACAGGTGGAAGGGGAATGG + Intergenic
930884907 2:56314391-56314413 CCTCATCTGTGGAATGAGAAGGG + Intronic
935074992 2:99732706-99732728 CCTAACATGTGCATGAGGAAGGG - Intronic
935219217 2:100997785-100997807 CCTCCCATGTAGAATGGGGATGG + Intergenic
935277807 2:101490885-101490907 CCTCACATGTAGAAGGCAGAAGG - Intergenic
935697229 2:105780770-105780792 CCTCACATGCTGAAGGGGTGAGG - Intronic
936920707 2:117685829-117685851 TCTTTCATGTGGAAGAGGAATGG - Intergenic
937157428 2:119730841-119730863 CCACACTCGTGGGAGGGGAATGG + Intergenic
937257177 2:120563945-120563967 CCTCACATGTGGAGTGGGTTTGG - Intergenic
938985378 2:136570420-136570442 CCACAGATGTGGATGGGGGAGGG + Intergenic
939834939 2:147118375-147118397 CTTCTCATTTGGAATGGGAAAGG + Intergenic
940641854 2:156353295-156353317 CCGCACAAGAGAAAGGGGAAGGG - Intergenic
942464353 2:176191576-176191598 CCTCACAAAAGGAAGAGGAAAGG + Intergenic
944276179 2:197840748-197840770 CCTCATACGTGGAAGCCGAATGG + Intronic
945239004 2:207659623-207659645 CCCCACATCTGGAAGTGGAAGGG + Intergenic
945823919 2:214697660-214697682 CCTGACAAGGGAAAGGGGAAGGG - Intergenic
945861619 2:215129228-215129250 CCCCAACTGTGGAAGTGGAAAGG - Intronic
946302221 2:218830894-218830916 GCTCATCTCTGGAAGGGGAATGG + Exonic
948382096 2:237557932-237557954 CCTCACAGCTGGAAGGGGCCAGG - Intergenic
948618285 2:239215502-239215524 CCTCACATCTGGAGTGGGCAAGG + Intronic
948815111 2:240506596-240506618 CCAGGCATTTGGAAGGGGAAGGG - Intronic
1168888385 20:1276206-1276228 CCCCTCCTGTGGAGGGGGAAGGG - Intronic
1169056777 20:2628687-2628709 ACTTACAGGTGGAAGGTGAAGGG - Intronic
1169567991 20:6876525-6876547 TCTCACTTGTGGGAAGGGAAAGG - Intergenic
1169950640 20:11039677-11039699 CCTCACATCTGGAAGTAGCAGGG + Intergenic
1170935399 20:20805222-20805244 GCTCATAGGTGGAAAGGGAAAGG - Intergenic
1171180796 20:23089024-23089046 GCCTACATGTGGAAGGGGACTGG + Intergenic
1172022423 20:31924081-31924103 AACCAGATGTGGAAGGGGAAGGG - Intronic
1172039014 20:32030939-32030961 CTTCCCCTGTGGAAGGGAAAGGG + Intronic
1172497082 20:35395206-35395228 CCTGACTTTTGGAAGGGGAGAGG - Intronic
1173922917 20:46759310-46759332 GTTCACATGAGAAAGGGGAAAGG + Intergenic
1174174795 20:48637745-48637767 CTTCCCATCTGGAAGGAGAAGGG + Exonic
1174181084 20:48675220-48675242 CCTCTCATGGGGAAAGGGATGGG - Intronic
1175218288 20:57402919-57402941 AACCACATGGGGAAGGGGAAGGG - Intronic
1175479023 20:59298740-59298762 CCTCAGTTGTGGAAGGGTCAAGG - Intergenic
1175865340 20:62172960-62172982 ACCCACATGTGGCAGGGGCAGGG - Intronic
1176369324 21:6052939-6052961 CCTCACACGTGGAAGGAGCAAGG - Intergenic
1176795000 21:13365325-13365347 CCTCACCTGTAGAATAGGAATGG - Intergenic
1178421263 21:32445309-32445331 CCACAGATGTGGAATGGGACAGG - Intronic
1178790584 21:35696133-35696155 AATCACTTGTGGAAGGGGATAGG - Intronic
1179015970 21:37594727-37594749 CCGCAGAAGTGGAAGGGAAATGG + Intergenic
1179106856 21:38408800-38408822 CCACACATGTGTAGGAGGAAGGG + Intronic
1179754195 21:43485602-43485624 CCTCACACGTGGAAGGAGCAAGG + Intergenic
1181086760 22:20443438-20443460 CCTTAAAAGTGGAAGGGGAGAGG + Intronic
1181235676 22:21446489-21446511 CCACAGATGTTGCAGGGGAAGGG - Exonic
1181633121 22:24161801-24161823 CCACACAGGAGGAAGGGGCATGG - Intronic
1181802777 22:25358261-25358283 CCTCATCTGTGAAAGAGGAAGGG - Intronic
1182757778 22:32694290-32694312 GCTTATATGTGGCAGGGGAAGGG - Intronic
1183413259 22:37667719-37667741 CCTTACTGGTGGAAGGGGAAGGG - Intergenic
1184043208 22:41956711-41956733 CCTCCCCTATGGAAGGGGAAAGG - Intergenic
1184169974 22:42752956-42752978 CCTCACAGCTGGAGGGGGATTGG - Intergenic
1184252667 22:43269628-43269650 CCTCCCAAGTTGAGGGGGAAGGG - Intronic
1184598982 22:45531693-45531715 CCCTAGATCTGGAAGGGGAAAGG - Intronic
1184962439 22:47941310-47941332 CCATCCATGAGGAAGGGGAAAGG + Intergenic
949313081 3:2721938-2721960 CCTCACATAGCAAAGGGGAAAGG - Intronic
949426137 3:3918268-3918290 CCTCACAGTTTGAAGGGGCAGGG + Intronic
950178555 3:10894325-10894347 CCTGAGAGGTGGAAGGAGAATGG + Intronic
950704705 3:14772679-14772701 CCTCACCTGTGCAAGGGAGAGGG + Intronic
951089282 3:18553513-18553535 ACCCGCATTTGGAAGGGGAAGGG - Intergenic
951308745 3:21098557-21098579 GCTCATCTGTGGAATGGGAATGG - Intergenic
952685672 3:36145380-36145402 CCTCACATGGAGAAAGGGCAAGG + Intergenic
954584404 3:51720965-51720987 CCTGACATGGGAAAGGGGGAGGG + Intergenic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
954692645 3:52403880-52403902 CCCCACAGGTATAAGGGGAAGGG - Exonic
954695199 3:52420773-52420795 CCACACATGGGGAAGAGGAGAGG - Intronic
955530729 3:59870284-59870306 CCTCACCTGTGACATGGGAATGG - Intronic
955957498 3:64305452-64305474 CCTCTCTTATGGGAGGGGAAGGG + Intronic
956239009 3:67108055-67108077 AATAACATTTGGAAGGGGAATGG + Intergenic
957347346 3:78979206-78979228 ACTCATTTATGGAAGGGGAATGG - Intronic
957481596 3:80804978-80805000 GCTCACATGTGGTAGGAAAAAGG + Intergenic
957994006 3:87665204-87665226 CATCCCAGGTGGAAGGGAAATGG + Intergenic
963713001 3:148768825-148768847 CCTCACATGGTGGAGGGGCAGGG - Intergenic
964313094 3:155414949-155414971 CCTCACATGAGAAAGAGAAAGGG - Intronic
965285312 3:166811767-166811789 GTGCACATATGGAAGGGGAAGGG + Intergenic
967123459 3:186404525-186404547 CCTCACATGGTGAAAGGGCAAGG - Intergenic
968742037 4:2335943-2335965 CCTCATATGTGCAAGGGGCTGGG + Intronic
968980180 4:3843747-3843769 CCTCACTTGTTGAAGAGGAATGG - Intergenic
969656716 4:8503029-8503051 CCTCTCATGTGGGAGGTGAGGGG - Intergenic
970237711 4:13975402-13975424 CCTCACATGGCGAAAGGGGAAGG + Intergenic
970412740 4:15825291-15825313 CCACTCATGGAGAAGGGGAAGGG + Intronic
971474477 4:27059148-27059170 CCTCACGTGTGAAATGGGGATGG + Intergenic
972647485 4:40982861-40982883 TGTCACATGTTGAGGGGGAATGG - Intronic
973534900 4:51871542-51871564 TTGCACATGTGGAAGGGGAGGGG + Intronic
974841995 4:67309465-67309487 CCTGAAATGTGGCAGAGGAAAGG - Intergenic
977667906 4:99662360-99662382 ACTCACATGTAGTAGGAGAAGGG - Intergenic
978699134 4:111621915-111621937 CCCCACATGTTGAGGGAGAAAGG - Intergenic
979114280 4:116801653-116801675 CCCCACATGTGGAGGGAGAGAGG - Intergenic
979862849 4:125715906-125715928 CTTCACATGGTGAAGGGAAAAGG - Intergenic
981552973 4:145960417-145960439 CCTCACAAGGTGAAAGGGAAAGG + Intergenic
981936480 4:150245515-150245537 CCTGTCATGGGGTAGGGGAAGGG - Intronic
983642727 4:169958146-169958168 CCACCCAGGTGCAAGGGGAAGGG + Intergenic
984469444 4:180148172-180148194 CCTCCCATCTGCAACGGGAAAGG - Intergenic
984649521 4:182255181-182255203 TCTAACATGTGCAAGGGGAAAGG - Intronic
984807607 4:183765912-183765934 CCTCAAATATGTGAGGGGAAGGG + Intergenic
985167041 4:187107568-187107590 CCACACATATGGTAGGGGCAGGG + Intergenic
985380411 4:189388958-189388980 CCTCACATGTGGCAGGTGGTGGG - Intergenic
987889574 5:23859049-23859071 CCTTACATATGGAAGAGGGATGG + Intergenic
987970669 5:24939690-24939712 CCTTAGATGTGGAAGGGAAGTGG + Intergenic
989062275 5:37421080-37421102 CCTCACCTGTCGAAAGGGGATGG - Intronic
990465451 5:56067244-56067266 CCTCACATGGAGAAAGGGTAAGG - Intergenic
991408969 5:66328330-66328352 CCTCCCATGTGGAAGGCAGAAGG - Intergenic
992803360 5:80313340-80313362 CCTCTCATGGGGTGGGGGAAGGG - Intergenic
992947117 5:81821953-81821975 ACTCAGTTGTGGAAGGGGGATGG + Intergenic
995280647 5:110331758-110331780 CCTCACATGTGGAAGGGGAAGGG - Intronic
996284586 5:121774135-121774157 CCTCTCATATAGAAGGGAAAAGG - Intergenic
998068287 5:139176660-139176682 CCTCACATGCAGAAGAGGCAAGG + Intronic
998130132 5:139647754-139647776 CCTCACCTGAGAAATGGGAACGG + Intronic
998404704 5:141867761-141867783 CAGCCCATGGGGAAGGGGAAAGG + Intronic
998498446 5:142611363-142611385 CCTCACCTGTGGAATGGGAATGG - Intronic
1000003050 5:157158308-157158330 CAGCACCTGTGGAAGGGAAAAGG + Intronic
1000812430 5:165879376-165879398 TCTCACATGTAGAACAGGAAAGG + Intergenic
1000958581 5:167571984-167572006 GCTCAGATGTAGAAGGGAAAAGG - Intronic
1001087493 5:168711261-168711283 CCTCAGAAGTGGAAGGGGCTGGG - Intronic
1001401761 5:171450460-171450482 CCTCATCTGTGGAATGGGGATGG - Intronic
1002592114 5:180298055-180298077 CATCACATGTGGCAGGGGTTAGG - Intergenic
1003776711 6:9374589-9374611 CCACTCATCAGGAAGGGGAATGG + Intergenic
1004099368 6:12592989-12593011 CAACACATGTGGAAGGGAAGAGG - Intergenic
1005214519 6:23509606-23509628 CCTCACATGGAGGAAGGGAAAGG - Intergenic
1006386005 6:33731279-33731301 CCTCACGTGTGGCAGGGCCAGGG - Intronic
1007079825 6:39092065-39092087 CCTGTTAAGTGGAAGGGGAAGGG - Intergenic
1007272130 6:40645887-40645909 CAGCACATGTAGAAGGGGAGGGG + Intergenic
1007782192 6:44260692-44260714 CCTCAAAAGTCTAAGGGGAAAGG + Intronic
1007828700 6:44621517-44621539 CTTCCCAGGTGGAAGGGGCAGGG + Intergenic
1008069390 6:47084358-47084380 CCTCACATCAGGAAGAGGCAAGG + Intergenic
1010176390 6:73032899-73032921 CTTCACCTGTGGCAGGTGAAGGG + Intronic
1010249468 6:73693250-73693272 CCACTCATGTGGAAGGGGAAGGG + Intergenic
1011210586 6:84952077-84952099 CCTATGAGGTGGAAGGGGAATGG + Intergenic
1011258898 6:85451668-85451690 CCACAAGTGTGGAAGGGAAAGGG + Intronic
1012609187 6:101194439-101194461 CCTGTCATGTGGTCGGGGAAGGG + Intergenic
1012753337 6:103191257-103191279 CCACTCATGTGGAAGGTGAAAGG + Intergenic
1012774045 6:103480252-103480274 CCTCATATGCAGAAGGGGAGAGG + Intergenic
1012983009 6:105849825-105849847 CCTCACATGTTGAATGCAAAAGG - Intergenic
1013985980 6:116194440-116194462 GCTAAGATGTGGAAGGGGACTGG + Intronic
1014061960 6:117082023-117082045 CCTGTCATGGGGTAGGGGAAGGG + Intergenic
1014815189 6:125927803-125927825 CCTCAGTTGGGGAAGGGGATAGG + Intronic
1015139425 6:129912881-129912903 CCTGACAGGAGGAAGGGGAAAGG + Intergenic
1015641171 6:135334334-135334356 CTTCACAAGTGGAAAGGGCAGGG - Intronic
1016022990 6:139255456-139255478 CCTCCTATGTGGCAGGGGATGGG - Intronic
1016150355 6:140734073-140734095 CCTCACATGTGGAAAGAACAGGG - Intergenic
1017268303 6:152477294-152477316 CATCAAATGGGAAAGGGGAAGGG + Intronic
1017595645 6:156025901-156025923 CCTCACATGGTGGAGGGGGAGGG - Intergenic
1018937766 6:168284699-168284721 CCTGAAATAGGGAAGGGGAATGG - Intergenic
1019338842 7:498567-498589 CCTCACATCTGCAGGGAGAAGGG + Exonic
1020690074 7:11343589-11343611 CCTCTGAAATGGAAGGGGAAGGG - Intergenic
1020919521 7:14244770-14244792 CCTCACATGTGAGAGGGCCAAGG - Intronic
1023809570 7:43901661-43901683 CCACACTGGGGGAAGGGGAAAGG - Intronic
1024390588 7:48807204-48807226 CCTCACATGGTGAAGGGGCAAGG - Intergenic
1027342197 7:77221492-77221514 AATCACATGTGGATGTGGAAAGG + Intronic
1028798344 7:94930736-94930758 CTGCACATCAGGAAGGGGAAAGG + Intronic
1029433340 7:100546710-100546732 CCTGACATTCTGAAGGGGAAGGG + Intronic
1031058055 7:117015671-117015693 CCTTACATCTGGTAGGGTAAAGG + Intronic
1033473290 7:141667838-141667860 CCTGGCATGGGGTAGGGGAATGG - Intronic
1034949835 7:155289838-155289860 CCTCACATGGTGAAGGGGCCAGG + Intergenic
1037937300 8:22923789-22923811 CTTCACATGGGGGAAGGGAAGGG - Intronic
1040315722 8:46259846-46259868 CCACACAAGTGAAAGCGGAACGG + Intergenic
1040722466 8:50342827-50342849 CCTAACATGTTAAAGTGGAAAGG + Intronic
1040858090 8:51970762-51970784 ACTCAGAAGTGGAAGGGGGAAGG - Intergenic
1041373414 8:57188743-57188765 CAAAACATGTGGAAGGGGAGTGG + Intergenic
1042401505 8:68353953-68353975 CCTCAGATGCAGAAGGGGATTGG - Intronic
1042938757 8:74086801-74086823 TCTCACATGGGGAAGGAGCAAGG - Intergenic
1043447690 8:80335191-80335213 CCTTACATTTGGAAAAGGAATGG - Intergenic
1043651033 8:82592386-82592408 CCTCACATGTGGAAAGGGCAAGG + Intergenic
1044017022 8:87057519-87057541 CATGACATGTGGAAGGGGCCAGG - Intronic
1044892422 8:96851541-96851563 CCTCACATGTGGAAGAACAGAGG + Intronic
1045641578 8:104257320-104257342 CATCACATGGGGCTGGGGAATGG - Intergenic
1046218350 8:111179836-111179858 CCTGTCATGGGGTAGGGGAAGGG - Intergenic
1047539258 8:125748393-125748415 CCTCACATGGTAAAGGGGCAAGG + Intergenic
1047576590 8:126162336-126162358 CCCCACATGTGGAATGGCTATGG - Intergenic
1047805192 8:128352044-128352066 GCTACCATGTGGAAGGGGCAAGG - Intergenic
1048120725 8:131578620-131578642 CCTCACATCTGGAAGTAAAATGG + Intergenic
1048354582 8:133642788-133642810 CCCCACCTGTGGAAGGCGGAAGG + Intergenic
1049286471 8:141778136-141778158 CCTTACATGTGGGAGGAGAGGGG - Intergenic
1050339247 9:4619468-4619490 CAGCACATGTGGAAGGGAGAAGG + Intronic
1052207839 9:25865199-25865221 CCTCACCTCTGGAAGGACAAGGG - Intergenic
1052745351 9:32434902-32434924 CCTAACAAGGGGAAGGGGAGAGG + Intronic
1052991946 9:34523492-34523514 CCTCACATGTGGAAATGCAGAGG - Intergenic
1053887222 9:42652866-42652888 CCTCACCTGTAGAATGGGAATGG + Intergenic
1054226242 9:62460317-62460339 CCTCACCTGTAGAATGGGAATGG + Intergenic
1055477441 9:76677432-76677454 CCTCACCTGTGAAACAGGAACGG - Intronic
1056262519 9:84862946-84862968 CCTCACATCTGGAAGGTGGTTGG + Intronic
1056735468 9:89205961-89205983 CTTCACAGGTGGGAGGGGAGTGG - Intergenic
1057634999 9:96756545-96756567 CCTCACTTGTGGAATGAAAATGG - Exonic
1057813792 9:98279101-98279123 CCTTACTTGGTGAAGGGGAAAGG + Intergenic
1058707391 9:107648615-107648637 CCTCACAAGTGGAGACGGAAAGG + Intergenic
1059063249 9:111055376-111055398 CTTCACATGTGAAAGGGGTCAGG - Intergenic
1060785734 9:126450502-126450524 CCTCACATGGGGATGGAGCAGGG - Intronic
1061596812 9:131635812-131635834 CCACACCTGTGAAAGGGGCAAGG + Intronic
1062016585 9:134294200-134294222 CCTCACAGGTGGCCCGGGAAAGG - Intergenic
1062432628 9:136532831-136532853 CCCCACACCTGGAAGGGGGAAGG + Intronic
1186670719 X:11764847-11764869 ACTGACATGGGGAAAGGGAAAGG - Intronic
1188391785 X:29630157-29630179 CCTCACATGGTGAAGGGAGAAGG + Intronic
1188678215 X:32969072-32969094 CCTCACATGGTGGAGGGGAAAGG - Intronic
1189407966 X:40742927-40742949 CCTCACCTCTGGAAGGGGCAAGG + Intergenic
1192043030 X:67643361-67643383 TCTCACATGTGGAAGCTGCAAGG + Exonic
1192594797 X:72395214-72395236 CCTCAAATTTGGAACTGGAAAGG - Intronic
1193231490 X:79052148-79052170 TTTCACATGTGGAAGAGGCAAGG + Intergenic
1194025259 X:88743634-88743656 TCTTGCATGTGGAAGCGGAAAGG - Intergenic
1196224700 X:113152090-113152112 TCTCACATGTGGAAGGGAAAAGG - Intergenic
1198095553 X:133376709-133376731 GCTCACAAGTGCAAGGGGATGGG - Intronic
1198330463 X:135618033-135618055 CCTCACACGTTGAAGAGGCATGG - Intergenic
1198336464 X:135670966-135670988 CCTCACACGTTGAAGAGGCATGG + Intergenic
1198363173 X:135915660-135915682 CCTCACATGTTGAAGAAGCATGG - Intergenic
1198938850 X:141931169-141931191 CTTTGCATGTGGAAAGGGAAAGG - Intergenic