ID: 995285021

View in Genome Browser
Species Human (GRCh38)
Location 5:110378237-110378259
Sequence GATGGAATCCACATTCTTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 102}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995285013_995285021 25 Left 995285013 5:110378189-110378211 CCAGAGCATTTTCTACATGTTTC 0: 1
1: 0
2: 3
3: 38
4: 301
Right 995285021 5:110378237-110378259 GATGGAATCCACATTCTTAGAGG 0: 1
1: 0
2: 0
3: 12
4: 102
995285015_995285021 0 Left 995285015 5:110378214-110378236 CCCTAAGAGACCTGTCCTCCTTT 0: 1
1: 0
2: 0
3: 25
4: 221
Right 995285021 5:110378237-110378259 GATGGAATCCACATTCTTAGAGG 0: 1
1: 0
2: 0
3: 12
4: 102
995285014_995285021 1 Left 995285014 5:110378213-110378235 CCCCTAAGAGACCTGTCCTCCTT 0: 1
1: 0
2: 4
3: 13
4: 156
Right 995285021 5:110378237-110378259 GATGGAATCCACATTCTTAGAGG 0: 1
1: 0
2: 0
3: 12
4: 102
995285016_995285021 -1 Left 995285016 5:110378215-110378237 CCTAAGAGACCTGTCCTCCTTTG 0: 1
1: 0
2: 0
3: 16
4: 173
Right 995285021 5:110378237-110378259 GATGGAATCCACATTCTTAGAGG 0: 1
1: 0
2: 0
3: 12
4: 102
995285018_995285021 -10 Left 995285018 5:110378224-110378246 CCTGTCCTCCTTTGATGGAATCC 0: 1
1: 0
2: 2
3: 10
4: 192
Right 995285021 5:110378237-110378259 GATGGAATCCACATTCTTAGAGG 0: 1
1: 0
2: 0
3: 12
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995285021 Original CRISPR GATGGAATCCACATTCTTAG AGG Intronic
900501344 1:3006348-3006370 AATGTAATCCTCAATCTTAGAGG + Intergenic
901869716 1:12130842-12130864 GATAGAATCAACATTTTTAGGGG + Intronic
902606109 1:17570214-17570236 CATGGAGTCCACATTCTCATAGG + Intronic
904575620 1:31503371-31503393 CAGGGGATCCACATTCATAGAGG + Intergenic
909706148 1:78587362-78587384 AGTGGAATCCACATTCTTCCAGG - Intergenic
909976212 1:82048543-82048565 CAGGTAATCCTCATTCTTAGTGG + Intergenic
910467510 1:87515909-87515931 GCTTGAGTCCACATTCTTAGGGG + Intergenic
910951958 1:92658006-92658028 GATGTAATCCTCATTGTTGGAGG - Intronic
917067394 1:171111843-171111865 CATGGAACCTACATTCTAAGTGG + Intronic
917671917 1:177281188-177281210 CATGTAACCCAAATTCTTAGAGG - Exonic
921881031 1:220254126-220254148 AATGGAATCCACATTCTTCTTGG - Intronic
923385931 1:233465300-233465322 GATGGAATCCAGAAGTTTAGAGG - Intergenic
924069252 1:240258949-240258971 AATAGAATCCACATTCATAAAGG - Intronic
1065560792 10:26961969-26961991 GAAGGAAAACACATTCTGAGGGG + Intergenic
1080009238 11:27440859-27440881 GATGGAATCAAAAATCCTAGAGG + Intronic
1090432076 11:126654485-126654507 AATGGAAACCCCTTTCTTAGAGG - Intronic
1091246270 11:134098056-134098078 GATCTGATCCACATTTTTAGGGG - Intronic
1091819694 12:3466535-3466557 GATGGAAACCAAAATATTAGAGG + Intronic
1092803828 12:12200262-12200284 AATGGAATCCACATTCTTCCTGG + Intronic
1095536571 12:43255668-43255690 GGTGTAATTCACATTCTGAGAGG + Intergenic
1097288033 12:57892647-57892669 GATGGAGTCCCTACTCTTAGGGG + Intergenic
1098378952 12:69847534-69847556 GATGGAATCCAAAATGTTAATGG - Intronic
1101065526 12:101016492-101016514 AATGGAATCCCCAGTGTTAGAGG - Intronic
1103156314 12:118688178-118688200 GAGGGATCCCACATTCTTTGAGG + Intergenic
1103469109 12:121165826-121165848 GATGGAAGCCACAGTCTTTGGGG + Intronic
1103992861 12:124810851-124810873 GATGGAGTTCACATTCATTGTGG - Intronic
1106776049 13:33010847-33010869 TATGGAGTTCACATTCTTATGGG + Intergenic
1113571294 13:111360086-111360108 AATCGAATCCACTTTCTTCGCGG + Intergenic
1116491571 14:45509588-45509610 CATGGAACATACATTCTTAGAGG - Intergenic
1118052037 14:62039803-62039825 GATGGAAGCCAAATTCAGAGGGG + Intronic
1122492888 14:102131850-102131872 CATGGATTCCATATTCTTACAGG - Intronic
1129864404 15:78893555-78893577 AATGGAATCCACATTCTTCTTGG - Exonic
1132113759 15:99120906-99120928 AATGGAATGCACATTCCTAGGGG + Intronic
1133992871 16:10723643-10723665 GATCAAATCCACATTCATAAGGG + Intergenic
1135140396 16:19916325-19916347 GATGAAAACCACATGCTAAGGGG + Intergenic
1140925251 16:79576295-79576317 GATGGAATTCACATTGTATGGGG - Intergenic
1142318676 16:89366905-89366927 GATGGTCTTCACATTCTTAAAGG - Intronic
1146630931 17:34468856-34468878 AATGGAATCCACATCCTATGGGG - Intergenic
1147796819 17:43049722-43049744 GCTGGAATCCATATACTCAGGGG + Intronic
1151171990 17:72254518-72254540 GTTGTAATCCCCATTGTTAGAGG + Intergenic
1152727763 17:81956032-81956054 GAAGGAAGCCACATTCTGTGGGG - Intronic
1153421054 18:4905535-4905557 AATGTAATTCCCATTCTTAGTGG - Intergenic
1155332131 18:24729143-24729165 GATACAATCTACATTCTGAGTGG + Intergenic
1156788148 18:40939985-40940007 GAGGGAAAGCACATTATTAGTGG + Intergenic
1160003095 18:75046375-75046397 GATTTAATCCACATCCTCAGAGG + Intronic
1164571497 19:29377984-29378006 GATGGAACCCACGTTTTCAGAGG + Intergenic
1167490171 19:49788398-49788420 GATAGAATCCGCGTCCTTAGAGG + Intronic
925593045 2:5528804-5528826 GATGGAAACCACCTTCTGGGGGG + Intergenic
925900528 2:8506121-8506143 AATGGAATCCCCATTGTTGGAGG + Intergenic
936415660 2:112307743-112307765 GATGGAACGTGCATTCTTAGGGG + Intronic
938878968 2:135564738-135564760 TATGTAATACACATTCATAGAGG + Intronic
939129332 2:138215641-138215663 GATTGAATCCACATGTGTAGAGG - Intergenic
940220196 2:151343548-151343570 GAAGGATTCCACTTTCTTAAAGG + Intergenic
941260285 2:163288575-163288597 GATGAAGTCCACATCCATAGTGG - Intergenic
942127798 2:172844992-172845014 AATGGAATCCATCTTCTTATTGG + Intronic
942989744 2:182185819-182185841 GAAGTAATCCAAACTCTTAGAGG + Intronic
945119006 2:206439722-206439744 CATGGTTTTCACATTCTTAGAGG + Intergenic
1169711559 20:8570309-8570331 GGTGGAAGCCACAGACTTAGAGG - Intronic
1170006391 20:11674269-11674291 GATGGAATCTACAGTTATAGTGG - Intergenic
1170717647 20:18845836-18845858 GATGTAATCCCCATTGTTGGAGG + Intergenic
1177023500 21:15893144-15893166 GAAGGAAACAATATTCTTAGTGG + Intergenic
954083427 3:48225656-48225678 GATGGCATTCCCATTCTCAGTGG + Intergenic
955649759 3:61181413-61181435 GAAGGAACACCCATTCTTAGAGG - Intronic
966447770 3:180022824-180022846 GATGGAGTGCACTTGCTTAGTGG - Intronic
967253528 3:187567035-187567057 GCTGGCATACACATTCTCAGGGG - Intergenic
970161245 4:13191498-13191520 TATGGAATGCACATTTTTGGAGG + Intergenic
971335536 4:25720317-25720339 GGTCAAATCCACATTCATAGGGG + Intergenic
971456213 4:26847198-26847220 GATGGAACTCACATTCTCATGGG + Intergenic
973893617 4:55391561-55391583 GATGGACTCTACATTATCAGAGG + Intergenic
975236537 4:72003718-72003740 GATGAAAAACACATTCTTTGAGG - Intergenic
975816590 4:78223258-78223280 GATGGGATCCACATCCCTGGGGG + Intronic
982786787 4:159545506-159545528 CATGGAATTCACATTCTTCCAGG - Intergenic
983948797 4:173616329-173616351 AATGGAATCCACATTCTTCTCGG + Intergenic
986564180 5:9094527-9094549 GATGGAATCCAGACATTTAGAGG - Intronic
988425624 5:31059991-31060013 GCTGGAAACCAAATTCTTAATGG + Intergenic
989292016 5:39779105-39779127 GATGGAATCCCCAATGTTGGAGG + Intergenic
990632648 5:57687649-57687671 AATGGAATTCACATTTTTAGAGG - Intergenic
992765315 5:79993076-79993098 GAGTGAATGAACATTCTTAGTGG + Intronic
994768655 5:103954095-103954117 GGTGGGACCCACACTCTTAGCGG - Intergenic
994987905 5:106961566-106961588 GATGAAATCAATATTCTTGGGGG - Intergenic
995285021 5:110378237-110378259 GATGGAATCCACATTCTTAGAGG + Intronic
996053754 5:118962361-118962383 GATGAAAACCACTTTTTTAGGGG - Intronic
998701191 5:144701817-144701839 GATGAAGTACACATTCATAGAGG - Intergenic
998939543 5:147266229-147266251 GATGGAGTCCACAATCTCAGTGG + Intronic
999087035 5:148902029-148902051 GATGGAATCCAGAGTGATAGTGG + Intergenic
1001026465 5:168228316-168228338 GATGGATTCTACCTTCTGAGTGG - Intronic
1006040658 6:31251822-31251844 GATGGAATCCCCAGCATTAGAGG + Intergenic
1006632094 6:35436868-35436890 GATGCATCCCAAATTCTTAGAGG - Intergenic
1012390680 6:98735954-98735976 GATGTGATACACATTCTTAGTGG - Intergenic
1012940398 6:105409260-105409282 GATGTAATCCCCAGTATTAGAGG - Intergenic
1014665999 6:124238458-124238480 AATAGAAGTCACATTCTTAGAGG + Intronic
1017368037 6:153668281-153668303 GGTGAAACCCACATTCTTAGGGG - Intergenic
1017900624 6:158715916-158715938 GAGGGAAGCCTCATTCTGAGGGG + Intronic
1018287469 6:162256473-162256495 GCTGGATTCCACTTTCTTAAAGG - Intronic
1018354546 6:162999212-162999234 GCTGGAAGCCCCATTCTTATTGG + Intronic
1020677031 7:11195408-11195430 GATAGTTTCCAAATTCTTAGAGG - Intergenic
1023646783 7:42325859-42325881 AATGGAAACTCCATTCTTAGTGG - Intergenic
1029097854 7:98103470-98103492 GATGTAATCCACAGTTTTGGAGG - Intergenic
1034129552 7:148702434-148702456 CATGGAATCCACATACTTTCGGG - Intronic
1038316944 8:26492816-26492838 GATTGAATTTACATTTTTAGGGG + Intronic
1039415493 8:37390412-37390434 AAAGGAGTCCACATTCTCAGAGG - Intergenic
1041778194 8:61547787-61547809 GATGTAAGCCACATTCCTTGGGG + Intronic
1043172118 8:76978692-76978714 CATGGAGTTTACATTCTTAGAGG - Intergenic
1045549846 8:103161857-103161879 GATGGCAACTTCATTCTTAGAGG - Intronic
1051820871 9:21166193-21166215 GATGGAGTCCACATTCATCAGGG + Exonic
1051831106 9:21278200-21278222 GATGGAGTCCACATTCCTCAGGG + Intergenic
1058180617 9:101793630-101793652 GGTCGAATCCGCATTCATAGGGG + Intergenic
1059711103 9:116868445-116868467 GATTGAACACACATTCTTACGGG - Intronic
1060561575 9:124549314-124549336 GATGGAATGCAGATTGTGAGTGG + Intronic
1188024124 X:25190624-25190646 AATGGAATCAACATGCTTATGGG - Intergenic
1189647082 X:43144966-43144988 GAGGGATTCTTCATTCTTAGAGG + Intergenic
1194007334 X:88511740-88511762 GGTGTAATCCACATTTTGAGTGG - Intergenic
1201336002 Y:12880434-12880456 GATGTAATCCATAATGTTAGAGG + Intergenic
1201851162 Y:18481907-18481929 AAAGGTATCCACATCCTTAGGGG + Intergenic
1201882157 Y:18838471-18838493 AAAGGTATCCACATCCTTAGGGG - Intergenic