ID: 995287559

View in Genome Browser
Species Human (GRCh38)
Location 5:110408706-110408728
Sequence ACTCCTGATGTTACTTATTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 461
Summary {0: 1, 1: 0, 2: 1, 3: 50, 4: 409}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995287559 Original CRISPR ACTCCTGATGTTACTTATTT GGG (reversed) Intronic
903099232 1:21013789-21013811 ACTCCTGATGTTACCCATCATGG + Intronic
904448967 1:30598826-30598848 AGTCCTGATGCTGCTTACTTGGG - Intergenic
905986366 1:42286935-42286957 AGTCCTGGTATTAATTATTTTGG + Intronic
906038576 1:42768117-42768139 CCTCCTTATTTGACTTATTTTGG - Intronic
909421024 1:75465663-75465685 ATTTCTGATTTTATTTATTTGGG - Intronic
909573893 1:77150629-77150651 ATCCCTGATTTTATTTATTTGGG - Intronic
909903196 1:81163605-81163627 ACTTCTGATTTTATTTATTTGGG - Intergenic
910716063 1:90232206-90232228 ATCCCTGATTTTATTTATTTGGG + Intergenic
910896945 1:92079671-92079693 ACTACTGAGTTTCCTTATTTTGG + Intergenic
910974372 1:92891177-92891199 ATTTCTGATTTTATTTATTTAGG + Intronic
911838274 1:102649082-102649104 CCTCTTGATGTTACATATTTTGG - Intergenic
911961243 1:104305499-104305521 ATTTCTGATTTTATTTATTTGGG - Intergenic
912285618 1:108365472-108365494 TCTCCTAATGTTCCCTATTTTGG - Intergenic
915178231 1:154035155-154035177 ACCGCTGATTTTATTTATTTTGG + Intronic
915746711 1:158166355-158166377 ACCTCTGATTTTATTTATTTGGG - Intergenic
915753196 1:158232051-158232073 ATTCCTGATTTTATTTATTTGGG - Intergenic
915792537 1:158689893-158689915 AATCCTGATTTTAATTCTTTTGG - Intergenic
915853607 1:159355050-159355072 ATTTTTGATGTTATTTATTTGGG + Intergenic
915858467 1:159416937-159416959 ATTTCTGATTTTATTTATTTGGG + Intergenic
916616059 1:166441396-166441418 CATCCTGATTTTATTTATTTGGG + Intergenic
916642794 1:166749123-166749145 ACTTTTGATTTTATTTATTTTGG - Intergenic
916768986 1:167889892-167889914 ATTTCTGATTTTATTTATTTGGG + Intronic
917601864 1:176583098-176583120 ATTTCTGATTTTATTTATTTGGG + Intronic
918760520 1:188399015-188399037 ATTTCTGATTTTATTTATTTGGG - Intergenic
920337655 1:205256041-205256063 ACTCCTGATCTCAGTGATTTTGG + Intronic
920384349 1:205558125-205558147 GCTTCTGATTTTATTTATTTGGG - Intergenic
921082275 1:211751515-211751537 ACTACTGATATTACCGATTTGGG - Intronic
922627440 1:227063371-227063393 ACTCCTGAGATTATTTCTTTTGG - Intronic
923432582 1:233937500-233937522 AGTCCTCATTTTGCTTATTTTGG - Intronic
923960341 1:239075074-239075096 ACCTCTGATTTTATTTATTTGGG - Intergenic
924588495 1:245380777-245380799 ACTCCTGACGTGATTTCTTTGGG + Intronic
1065467451 10:26039738-26039760 AATTCTGATTTTACTTAATTGGG + Intronic
1065670991 10:28116934-28116956 GCTCCTGATTTTACTTACCTTGG + Intronic
1066045421 10:31590595-31590617 ACTTCTGATTTTAGTAATTTAGG + Intergenic
1067655869 10:48190681-48190703 ACTTCTGATGTGAGTTATTAAGG + Intronic
1068713523 10:60160185-60160207 ATCCCTGATCTTATTTATTTGGG - Intronic
1069269729 10:66511244-66511266 ATTTCTGATATTATTTATTTAGG + Intronic
1071928928 10:90443521-90443543 ATTTCTCATGTTACTTATTTGGG - Intergenic
1072491973 10:95916258-95916280 ATTTCTGATTTTATTTATTTGGG + Intronic
1074633968 10:115292212-115292234 ACTTCTGATTTTATTTATCTGGG + Intronic
1075958033 10:126541837-126541859 ACCCCTGTTTTTAATTATTTGGG - Intronic
1079027276 11:16959586-16959608 AGACCTGATGTTACTTCTTATGG - Intronic
1079152869 11:17916884-17916906 AATGCTGATGCTACTGATTTAGG - Intronic
1079529754 11:21436501-21436523 ATTTCTGATTTTATTTATTTGGG + Intronic
1079722923 11:23842128-23842150 ACCTCTGATGTTATTTATTTAGG + Intergenic
1079899430 11:26163336-26163358 AATCTTGCTGTTACTGATTTGGG - Intergenic
1081001882 11:37683852-37683874 ATTTCTGATTTTATTTATTTGGG - Intergenic
1081253255 11:40861536-40861558 ACTCCTGATCTTACTCCTTCGGG - Intronic
1082211066 11:49502024-49502046 ATTCCTGATTTTATTTATTTGGG - Intergenic
1086020394 11:82221761-82221783 GATCCTGATTTTAATTATTTTGG + Intergenic
1086548003 11:88021222-88021244 TCATCTGATTTTACTTATTTGGG - Intergenic
1086638578 11:89123016-89123038 ATTCCTGATTTTATTTATTTGGG + Intergenic
1086767389 11:90714476-90714498 ATTTCTGATTTTATTTATTTGGG + Intergenic
1087675982 11:101162147-101162169 ATTTCTGATGTTACTTATTTGGG + Intergenic
1088405588 11:109473578-109473600 ATTTCTGATTTTAGTTATTTGGG - Intergenic
1088444154 11:109905236-109905258 ATTTCTGATTTTACTTATTTGGG - Intergenic
1088703965 11:112444133-112444155 AGTCCTGATTTTAATTCTTTAGG + Intergenic
1090111482 11:123914686-123914708 ACCTCTGATTTTATTTATTTGGG - Intergenic
1090148002 11:124348115-124348137 ATTTCTGATTTTATTTATTTGGG - Intergenic
1091911758 12:4237199-4237221 ATTTCTGATTTTGCTTATTTGGG + Intergenic
1092089537 12:5793181-5793203 ACTGCTGATTTCCCTTATTTTGG - Intronic
1092688856 12:11084591-11084613 TATTCTGATGTTACTTATTTTGG - Intronic
1093127839 12:15351898-15351920 TTTCCTGAGGTTATTTATTTAGG - Intronic
1093393157 12:18648473-18648495 ACTCATAATCTTACTTATTGAGG + Intergenic
1093531632 12:20172219-20172241 ACCTCTGATTTTATTTATTTGGG + Intergenic
1093606780 12:21100937-21100959 ATTTCTGATTTTATTTATTTGGG + Intronic
1094532546 12:31290602-31290624 TCTGTTGATGTTAATTATTTAGG - Intronic
1095531149 12:43188433-43188455 TCTCCTCATTTTATTTATTTTGG + Intergenic
1095726097 12:45454756-45454778 ACTCATGATCTTACTAATTTTGG + Intergenic
1096450195 12:51733927-51733949 ATTTCTGATTTTATTTATTTGGG + Intronic
1097569513 12:61315750-61315772 ACACATGTTTTTACTTATTTTGG + Intergenic
1097645355 12:62230085-62230107 ATTTCTGATTTTATTTATTTGGG + Intronic
1097660793 12:62428805-62428827 AATCCTGATTTTAATTTTTTGGG + Intergenic
1097770245 12:63575579-63575601 ACCTCTGATTTTATTTATTTGGG - Intronic
1099381050 12:81953103-81953125 ACTTCTAATGTTTCTTTTTTAGG - Intergenic
1099529903 12:83765149-83765171 ACACCTGTTATTACTTATTGGGG - Intergenic
1100056070 12:90511302-90511324 CCTCTTGATGATACTTATTTTGG + Intergenic
1100629418 12:96372704-96372726 TCTTCTAATTTTACTTATTTAGG + Intronic
1100890979 12:99125545-99125567 ACTACTGATGAGACTGATTTAGG + Intronic
1101178705 12:102186178-102186200 ATTTCTGATTTTATTTATTTGGG + Intronic
1101378980 12:104196782-104196804 ATTTCTGATTTTATTTATTTGGG + Intergenic
1101463575 12:104923602-104923624 ATTTCTAATTTTACTTATTTGGG - Intronic
1103071315 12:117944894-117944916 ACTCCAGATTTTATTTTTTTAGG - Intronic
1103816815 12:123664721-123664743 ATCTCTGATTTTACTTATTTGGG + Intergenic
1104314268 12:127682290-127682312 AATCCTAATTTTACTTCTTTTGG - Intergenic
1104660664 12:130609591-130609613 ACACATGAAGATACTTATTTGGG + Intronic
1105337746 13:19489528-19489550 ACTACTGATGTTATTAATTTGGG + Intronic
1105460259 13:20578893-20578915 ATCTCTGATTTTACTTATTTTGG + Intronic
1106985855 13:35348487-35348509 ACTACAGAAGTTACTTATTTAGG - Intronic
1108633080 13:52305194-52305216 ACTACTGATGTTATTAATTGGGG + Intergenic
1108653611 13:52507362-52507384 ACTACTGATGTTATTAATTGGGG - Intergenic
1108878858 13:55084343-55084365 ATTTCTGATTTTATTTATTTGGG + Intergenic
1109155505 13:58904742-58904764 AGTCCTGATGTTTCCTTTTTGGG + Intergenic
1109218921 13:59621085-59621107 ACTTCTGATTTTACGTATTTGGG - Intergenic
1109838944 13:67897797-67897819 ACTCCTTTTGTTACTAATTTTGG - Intergenic
1110665469 13:78112293-78112315 ATCCCTGATTTTATTTATTTTGG + Intergenic
1110888896 13:80673804-80673826 ATTTCTGATTTTATTTATTTGGG + Intergenic
1111449178 13:88391431-88391453 ATTCCTAATGTTCCTTATTTAGG + Intergenic
1111847848 13:93534112-93534134 GCTTCTGCTTTTACTTATTTTGG - Intronic
1113410600 13:110084501-110084523 ACCACTGATTTTATTTATTTGGG - Intergenic
1113825475 13:113249587-113249609 ACACCTGCGGTCACTTATTTTGG + Intronic
1114857002 14:26459760-26459782 ACTTCCAATGTTACTTAGTTTGG - Intronic
1115207018 14:30918809-30918831 GCTCTTGATGTAACTAATTTAGG - Intronic
1115288849 14:31747670-31747692 ACTTCTGATTTTATTTATCTGGG + Intronic
1115393308 14:32877932-32877954 ATTTCTGATTTTGCTTATTTGGG + Intergenic
1115907653 14:38218628-38218650 ACTAGTGATGTTATTTATTTGGG + Intergenic
1116555466 14:46298821-46298843 ATTTCTGATTTTATTTATTTGGG + Intergenic
1116954403 14:50909377-50909399 CCTCCAAATGTTACTTCTTTGGG + Intronic
1117186893 14:53248775-53248797 ACTCCTAATGTATCTTATTATGG + Intergenic
1117795069 14:59384612-59384634 ATCTCTGATTTTACTTATTTGGG + Intergenic
1118449279 14:65883922-65883944 ATTCCTGATTTTATTTATTTGGG + Intergenic
1118562777 14:67104713-67104735 ATTTCTGATTTTGCTTATTTGGG + Intronic
1118951230 14:70438265-70438287 ACTCCTCATGTTACATCTGTGGG - Intergenic
1120276460 14:82380279-82380301 ATTCCTGATTTTAGTAATTTAGG - Intergenic
1120461367 14:84800975-84800997 GTTCCTGCTGTCACTTATTTTGG - Intergenic
1120962486 14:90138278-90138300 ACTCCTAATAGTAGTTATTTTGG - Intronic
1122659354 14:103284229-103284251 GCTCCTGCTGTTACTTGATTTGG + Intergenic
1124131614 15:26993068-26993090 ATTTCCAATGTTACTTATTTGGG + Intronic
1125266991 15:37893355-37893377 ACTGCTGATGAAACTTATTTAGG - Intergenic
1125324501 15:38523122-38523144 GCTTCTGATGTTACTGGTTTAGG + Intronic
1126745384 15:51821055-51821077 ATTTCTGATTTTATTTATTTGGG - Intergenic
1127188224 15:56503070-56503092 ACTTCTGATTTTATTGATTTGGG - Intergenic
1129558460 15:76539481-76539503 ACTCCTGATCCAAATTATTTTGG + Intronic
1130187324 15:81697120-81697142 ACTCCTAATATTGTTTATTTGGG - Intergenic
1130400108 15:83543874-83543896 ATCCCTGATTTTATTTATTTGGG + Intronic
1131485648 15:92818037-92818059 ATCCCTGAAGTTACTTATTAGGG + Intergenic
1131658574 15:94488412-94488434 ATTTCTGATTTTATTTATTTGGG - Intergenic
1131963468 15:97812786-97812808 GATCCTGATTTTAATTATTTTGG + Intergenic
1133090188 16:3398196-3398218 AATCGTGATGTTATTTAATTGGG - Intronic
1135237649 16:20773230-20773252 ATTTCTGATTTTATTTATTTGGG + Intronic
1137707807 16:50547875-50547897 ACTCCTCTAGTTTCTTATTTGGG - Intergenic
1138006334 16:53341354-53341376 ACTCTAGATGTTTATTATTTGGG + Intergenic
1138666625 16:58574850-58574872 AATGAAGATGTTACTTATTTTGG - Intronic
1138717361 16:59038936-59038958 ACTCATGATTTTACTTAATTGGG + Intergenic
1138959759 16:62014916-62014938 ATTCCTTATATTGCTTATTTTGG - Intronic
1139076072 16:63449989-63450011 GATCCTGATTTTAATTATTTTGG + Intergenic
1140952825 16:79835575-79835597 GATCCTGTTGTTTCTTATTTTGG + Intergenic
1142946080 17:3428592-3428614 ATTTCTGATTTTATTTATTTGGG - Intergenic
1143420158 17:6783534-6783556 TCTCTTGATTTTATTTATTTGGG - Intronic
1145751514 17:27358209-27358231 ACTTCTGATTTTGATTATTTTGG - Intergenic
1145770771 17:27491546-27491568 ACTCCTAATAGTACTTACTTGGG + Intronic
1146306671 17:31735274-31735296 TCTCCTAATGTTGCATATTTAGG - Intergenic
1148672004 17:49418070-49418092 ATTTCTGATTTTATTTATTTGGG + Intronic
1149024688 17:52013191-52013213 CCTCCTGTTGTTTCTAATTTTGG - Intronic
1150715164 17:67566675-67566697 ACTCCTGCTTTTCCTGATTTGGG + Intronic
1151469250 17:74307794-74307816 TCTCCAGATGTTTCTTTTTTTGG + Intronic
1154229089 18:12538284-12538306 ACCCCTGATGTCTCTTTTTTTGG - Intronic
1154308682 18:13250515-13250537 ACTTCTGATTTTATTTATTTGGG - Intronic
1155282554 18:24254983-24255005 ATCCCTGATTTTATTTATTTAGG - Intronic
1155412113 18:25557915-25557937 ACTCAAGATGTTACTTTTTAAGG - Intergenic
1156006766 18:32451484-32451506 AGTCCTGAGGTTACTGACTTGGG - Intronic
1156086464 18:33411003-33411025 ATTACTGATCTTGCTTATTTTGG - Intronic
1156572400 18:38272056-38272078 AGCTCTGATTTTACTTATTTGGG + Intergenic
1157844228 18:50987915-50987937 ACTCATTATGTCACTAATTTTGG - Exonic
1158480495 18:57817422-57817444 TCTCCCCATGTGACTTATTTTGG + Intergenic
1158735885 18:60078641-60078663 ATTTCTGATTTTATTTATTTAGG - Intergenic
1158948731 18:62471746-62471768 ATTGCTAATTTTACTTATTTGGG + Intergenic
1159239156 18:65718794-65718816 ATTTCTGATTTTATTTATTTTGG - Intergenic
1159360348 18:67393293-67393315 ACTTCTGATTTTATTCATTTGGG + Intergenic
1159705795 18:71685381-71685403 ATTTCTGATTTTATTTATTTGGG - Intergenic
1163188302 19:15656145-15656167 ACACATGATCTTACTTATCTTGG - Intronic
1163216476 19:15881903-15881925 ACACATGATCTTACTTATCTTGG + Intronic
1165645906 19:37436605-37436627 ATCTCTGATTTTACTTATTTGGG - Intronic
1165717748 19:38057517-38057539 ACTCCTGGTGTTGCTCATTGAGG + Intronic
1168719413 19:58546678-58546700 AGCCCTGATGCTACATATTTTGG + Intronic
925320418 2:2962111-2962133 AGTCCGAATGTTACTTATTTTGG - Intergenic
925477377 2:4232445-4232467 ATTGCTGATGATACTTATTCAGG + Intergenic
926519484 2:13892694-13892716 ATTGCTGATTTTATTTATTTGGG + Intergenic
926681878 2:15670353-15670375 GTTCCTGATTTTACTTCTTTGGG + Intergenic
929027704 2:37620786-37620808 TCACCTGATGTTACTTAGCTGGG + Intergenic
929231120 2:39561246-39561268 ATTTCTGATTTTATTTATTTGGG + Intergenic
929281359 2:40083593-40083615 ATCTCTGATTTTACTTATTTGGG + Intergenic
930256171 2:49094930-49094952 ATTCCTGATTTTAGTAATTTGGG - Intronic
931141770 2:59467335-59467357 ACTCCTGATTTGAATTATCTTGG + Intergenic
932050574 2:68393977-68393999 CCTTCTGCTCTTACTTATTTTGG + Intronic
932905262 2:75742258-75742280 ATTTCTGATTTTATTTATTTTGG - Intergenic
932945784 2:76228938-76228960 ACTGCTGATTTAATTTATTTGGG - Intergenic
932946317 2:76235942-76235964 ACTGCTGATTTAATTTATTTGGG + Intergenic
933341382 2:81030124-81030146 ATTTCTGATTTTATTTATTTGGG + Intergenic
933468135 2:82682613-82682635 CCTCCAGATGTTACTTACATAGG + Intergenic
933496654 2:83058335-83058357 ACTCCTAATTTTAGTTGTTTAGG - Intergenic
933509180 2:83218181-83218203 ACTACTCATGTTACACATTTTGG + Intergenic
935837743 2:107073918-107073940 ACTTATGATGTTACATATCTTGG + Intergenic
935899506 2:107775588-107775610 ACTCCTCATGCCTCTTATTTGGG - Intergenic
936102845 2:109598540-109598562 CCTCCCGATGATAATTATTTAGG - Intronic
936120494 2:109738668-109738690 ACTTCTGATTTTATTTATTTGGG + Intergenic
936224201 2:110632778-110632800 ACTTCTGATTTTATTTATTTGGG - Intergenic
936883981 2:117287121-117287143 ATTTCTGATTTTATTTATTTTGG - Intergenic
936988596 2:118337086-118337108 AATCCTAATGTTATTTTTTTAGG - Intergenic
937172522 2:119889487-119889509 ATTTCTGATTTTACTTATTTGGG + Intronic
937959665 2:127446562-127446584 ACTTCTGATATTAGTGATTTGGG + Intronic
940516805 2:154693793-154693815 ATTCATGATATTACTAATTTTGG + Intergenic
940860234 2:158763617-158763639 AGTCCTGCTTTTACTTCTTTTGG - Intergenic
941058957 2:160823646-160823668 ATTTCTGATTTTATTTATTTGGG + Intergenic
941480329 2:166001085-166001107 ACACATGATGATATTTATTTGGG - Intronic
942659427 2:178248505-178248527 AACCCTGATGTTAGTTGTTTTGG + Intronic
942906219 2:181183980-181184002 GCTTCTGTTGTTTCTTATTTGGG - Intergenic
942962620 2:181850448-181850470 ACTAGTTATGTTAATTATTTGGG + Intergenic
943210787 2:184963525-184963547 ACTCCTTAAATTACCTATTTTGG + Intergenic
943315384 2:186381014-186381036 AATCCTGATTTCAATTATTTTGG - Intergenic
943475967 2:188355313-188355335 ATTTCTGATTTTATTTATTTTGG - Intronic
943659328 2:190541078-190541100 ATTTCTGATTTTATTTATTTGGG + Intergenic
943714465 2:191135185-191135207 ATTTCTGATTTTATTTATTTGGG - Intronic
943857903 2:192822364-192822386 ATTTCTGATTTGACTTATTTGGG - Intergenic
944269293 2:197763006-197763028 ATTGCTGATTTTATTTATTTGGG - Intronic
944366507 2:198927118-198927140 ACTCCTGTTTTTAATTCTTTTGG - Intergenic
944521145 2:200568448-200568470 ATTTCAGATGTTGCTTATTTTGG - Intronic
944897281 2:204177982-204178004 ACTCCTGAAGTGAGTTGTTTGGG + Intergenic
945134445 2:206612098-206612120 ACTCCTGAAGTTACATGTTCTGG - Intronic
945379005 2:209116727-209116749 ACTCCTGCTTTTATTCATTTTGG + Intergenic
945463728 2:210142357-210142379 ATTTCTGATGTTATATATTTGGG + Intronic
945713727 2:213332173-213332195 CCATCTGATTTTACTTATTTGGG - Intronic
945754180 2:213826113-213826135 ATCCCTGATTTTATTTATTTGGG + Intronic
945970875 2:216230241-216230263 ATTTCTGATTTTATTTATTTGGG + Intergenic
947106323 2:226671503-226671525 TCTCCTGCTTTTACTTTTTTTGG - Intergenic
947175479 2:227362772-227362794 ACTTCTGATCTTAATCATTTTGG + Exonic
947908387 2:233783902-233783924 ATTTCTGATTTTATTTATTTGGG + Intronic
948323691 2:237093450-237093472 ACTCCTGAGTTTATTTAATTGGG + Intronic
949005857 2:241647145-241647167 ACTACAGATGTTCCTTAATTAGG - Intronic
1169474811 20:5921830-5921852 AATCTTGATATTTCTTATTTTGG + Intronic
1169986369 20:11449833-11449855 AGTTCTGTTGTTACTCATTTAGG - Intergenic
1170005541 20:11664662-11664684 ATTCGTAAAGTTACTTATTTGGG + Intergenic
1170410502 20:16085067-16085089 ATTCCTGATTTTGTTTATTTGGG - Intergenic
1170916997 20:20636638-20636660 ACACGAGATGTTACTTTTTTGGG - Intronic
1172434944 20:34922094-34922116 ATTCCTGATGGTACCTTTTTGGG + Intronic
1174207132 20:48848652-48848674 ACTGCTGATGGTAGTTATTCTGG - Intergenic
1174510689 20:51049890-51049912 ATTCCTGATTTTATTTCTTTTGG - Intergenic
1174939148 20:54905226-54905248 ACCTCTGATTTTATTTATTTTGG - Intergenic
1176736437 21:10551692-10551714 GTTTCTGATTTTACTTATTTGGG - Intronic
1177567590 21:22844489-22844511 AATCCTGAGGTTACCTTTTTGGG - Intergenic
1177904517 21:26959286-26959308 ACTCCTGATGTTAATGATGAGGG - Intronic
1178911969 21:36682041-36682063 AATTCTGATGTTAATTAATTTGG - Intergenic
1179060294 21:37973263-37973285 CATCCTGATGTGGCTTATTTTGG - Intronic
1181281806 22:21725996-21726018 AGTACTGATGTTTCTTTTTTTGG - Intronic
1182987417 22:34733428-34733450 ACTCCTGGTGTTAATATTTTAGG - Intergenic
1183532705 22:38371011-38371033 GTTTCTGATTTTACTTATTTGGG + Intronic
1183533330 22:38377011-38377033 ACTACTGATGTTATTAATTTGGG + Intronic
1183533333 22:38377271-38377293 ACTACTGATGTTATTAATTTGGG - Intronic
1184241872 22:43215285-43215307 ATTCCTGATGTTATTTAGTTCGG - Intronic
1184811394 22:46835042-46835064 ACTCCTCTTGTTCCCTATTTGGG - Intronic
951241577 3:20292051-20292073 ATTTCTGATTTTATTTATTTGGG + Intergenic
951255296 3:20442274-20442296 ATCTCTGATTTTACTTATTTGGG - Intergenic
951259622 3:20491896-20491918 ATTTCTGATTTTATTTATTTAGG + Intergenic
951334275 3:21402513-21402535 ATTTCTGATTTTACTTATTTGGG - Intergenic
951414243 3:22403650-22403672 AAACCTGATAATACTTATTTAGG - Intergenic
952639957 3:35581392-35581414 ATTTCTGATTTTATTTATTTGGG - Intergenic
953012883 3:39044941-39044963 ATTTCTGATTTTATTTATTTGGG - Intergenic
953229151 3:41048760-41048782 ACCTCTGATTTTGCTTATTTGGG + Intergenic
953450353 3:43000264-43000286 ACTACTGATTTTTCTTGTTTTGG - Intronic
953692940 3:45134882-45134904 ACTTCTGATGTAGGTTATTTTGG - Intronic
953711898 3:45279696-45279718 ACTTCTGATTTTCTTTATTTGGG - Intergenic
954497690 3:50980813-50980835 ATTTCTGATTTTATTTATTTGGG + Intronic
956214920 3:66838788-66838810 ACTTCTGATGATACTTGCTTTGG - Intergenic
957267899 3:77990683-77990705 ATTTCTGATTTTATTTATTTGGG + Intergenic
958596543 3:96232662-96232684 GGTCCTGATGTAAATTATTTGGG + Intergenic
960038339 3:113124217-113124239 ACTCCTCATTTTACTTAATTAGG - Intergenic
960214394 3:115013316-115013338 ATCTCTGATTTTACTTATTTGGG - Intronic
960319673 3:116219439-116219461 GATCTTGATTTTACTTATTTTGG + Intronic
961912579 3:130335212-130335234 ATTTCTGATTTTATTTATTTTGG - Intergenic
963443956 3:145378238-145378260 ATTGCTGATTTTATTTATTTGGG - Intergenic
963528422 3:146443617-146443639 ATCTCTGATGTTATTTATTTGGG + Intronic
963763009 3:149303969-149303991 ATCCCTGATTTTATTTATTTGGG + Intergenic
964274159 3:154990802-154990824 ATTTCTGATTTTATTTATTTGGG - Intergenic
964537386 3:157738721-157738743 GTTCCTGATGTTATTTATATGGG - Intergenic
964866061 3:161262792-161262814 ACCTCTGATTTTATTTATTTGGG + Intergenic
964925101 3:161946255-161946277 CCTCCTAATGTTACTTTATTTGG + Intergenic
965179764 3:165387586-165387608 AATTTTGATGTTACTAATTTTGG - Intergenic
965452412 3:168854306-168854328 ATTTCTGATTTTATTTATTTGGG + Intergenic
966337819 3:178889805-178889827 ACCTCTGATTTTATTTATTTGGG - Intergenic
966634059 3:182112675-182112697 ACTCCTAATGTGACTTGATTTGG + Intergenic
967407840 3:189137372-189137394 ATTGCTGCTGTTACTTGTTTTGG - Intronic
967411309 3:189169085-189169107 ACGTATGTTGTTACTTATTTAGG - Intronic
967524595 3:190476407-190476429 ATTTCTGATATTATTTATTTAGG - Intergenic
970311320 4:14785279-14785301 GATCCTGATTTCACTTATTTTGG - Intergenic
970784450 4:19779824-19779846 ATTTCTGATTTCACTTATTTGGG + Intergenic
970969364 4:21963566-21963588 CCTCCTGCTGATACTAATTTAGG - Intergenic
971568825 4:28183844-28183866 ATTTCTGATGTTATTTATTTGGG + Intergenic
971797518 4:31247538-31247560 ACTTCTGAGATTATTTATTTGGG - Intergenic
972256128 4:37357713-37357735 ACTGTTTATCTTACTTATTTGGG - Intronic
972415521 4:38836262-38836284 ATTTCTGATTTTATTTATTTTGG - Intronic
973049878 4:45583807-45583829 TCTTCTGATTTTATTTATTTGGG + Intergenic
973074506 4:45905423-45905445 GCTTCTGATTTTACTGATTTGGG - Intergenic
976073323 4:81267638-81267660 ATTTCTGATTTTACTTATTTGGG + Intergenic
976136314 4:81940354-81940376 GCTTCTGATTTTATTTATTTGGG - Intronic
976161499 4:82205031-82205053 ATTTCTGATTTTATTTATTTGGG - Intergenic
976310848 4:83611455-83611477 ACTTCTGATTTTATATATTTGGG + Intergenic
976391651 4:84511744-84511766 ACTACTGCTGTTAACTATTTAGG - Intergenic
976467631 4:85388871-85388893 ACTTCAGATGTTACTAATTAAGG + Intergenic
976736031 4:88310694-88310716 ATCCCTGATTTTATTTATTTAGG + Intergenic
976742584 4:88371978-88372000 ATTTCTGATTTTATTTATTTGGG - Intergenic
976833567 4:89344143-89344165 ATTTCTGATTTTATTTATTTGGG + Intergenic
977134187 4:93281702-93281724 ACTTCTTATATTACATATTTAGG - Intronic
977398214 4:96498149-96498171 ATTCTTGATTTTATTTATTTTGG - Intergenic
977434371 4:96974768-96974790 TCTCTTGATGTTATTTCTTTAGG + Intergenic
978082644 4:104613029-104613051 ACCTCTGATTTTATTTATTTGGG + Intergenic
978619874 4:110627536-110627558 TCTCCTTATTTTACTTAGTTCGG - Intronic
978709594 4:111763383-111763405 ATCTCTGATTTTACTTATTTGGG - Intergenic
979964304 4:127059453-127059475 ATTTCTGATTTTATTTATTTGGG - Intergenic
980008932 4:127574726-127574748 ACTCCTGATCTTTCTTGTTCTGG - Intergenic
980449482 4:132951130-132951152 ATTTCTCATTTTACTTATTTGGG - Intergenic
980818857 4:137986495-137986517 AGTTCTGATTTTATTTATTTGGG - Intergenic
981002782 4:139843674-139843696 ACTCCTGAAGTATCTTAATTCGG + Intronic
981168041 4:141585611-141585633 ACCCCTGATTTTATTTATTTAGG + Intergenic
981453523 4:144927310-144927332 ATCTCTGATTTTACTTATTTGGG + Intergenic
982227264 4:153177645-153177667 ACTCCTGATTTTTTTTTTTTTGG - Intronic
982340177 4:154289220-154289242 ACCTCTGATTTTATTTATTTAGG - Intronic
982608508 4:157543347-157543369 ATTTCTGATTTTATTTATTTGGG + Intergenic
982665802 4:158261175-158261197 ACTCATGATGCTTCTTATTGAGG + Intergenic
982822726 4:159963955-159963977 ACTTATGATTTTATTTATTTGGG + Intergenic
983017510 4:162632017-162632039 ATTTCTGATTTTATTTATTTGGG - Intergenic
983619973 4:169750970-169750992 ATTCCTGTTGTTTCTTATTTTGG + Intronic
983755950 4:171336219-171336241 ATTTCTGATTTTATTTATTTGGG - Intergenic
984071053 4:175113102-175113124 ATTTCTGATTTTACTCATTTGGG - Intergenic
984615637 4:181894169-181894191 AATGATGATGTTACTAATTTCGG + Intergenic
986544305 5:8879121-8879143 ATTTCTGATTTTATTTATTTGGG + Intergenic
986588459 5:9343896-9343918 AAGCCTGATGTATCTTATTTTGG - Intronic
986619324 5:9654984-9655006 ACCCATGTTGTTACATATTTTGG - Intronic
987665223 5:20929048-20929070 ACTTCTGATTTTATTTATTTGGG + Intergenic
988690289 5:33565046-33565068 ATTCCTGAAGCTATTTATTTGGG - Intronic
988757466 5:34273135-34273157 ACTTCTGATTTTATTTATTTGGG - Intergenic
988962988 5:36387988-36388010 ACTGCTGAGTTTACCTATTTGGG + Intergenic
989751232 5:44896047-44896069 ATTCCTGAAGTAACTTTTTTAGG + Intergenic
991588093 5:68220188-68220210 TTTCCTGAGGTTACATATTTAGG + Intronic
991927872 5:71722736-71722758 TTTCCTGATCTGACTTATTTAGG - Intergenic
992344123 5:75858949-75858971 ATCCCTGATTTTATTTATTTGGG + Intergenic
992363935 5:76072214-76072236 ACTCTTGATAATCCTTATTTTGG + Intergenic
992587717 5:78258699-78258721 ACTCCTGATTTTCTTTCTTTTGG - Intronic
992768560 5:80025891-80025913 ACTAGTGATGTTGATTATTTTGG - Intronic
992945600 5:81806251-81806273 ACTTCTGATTTTATTTATTTGGG - Intergenic
993206781 5:84891768-84891790 AACCCTGATTTTATTTATTTAGG + Intergenic
993697535 5:91079530-91079552 ACTCCTGATGTTATTGTTCTAGG - Intronic
993990865 5:94656833-94656855 ACTTCTGATTTTATTTATTTGGG + Intronic
994357167 5:98806254-98806276 ATTTCTGATTTTATTTATTTGGG - Intergenic
994596908 5:101850307-101850329 ATTTCTGATTTTATTTATTTGGG + Intergenic
995287559 5:110408706-110408728 ACTCCTGATGTTACTTATTTGGG - Intronic
995537720 5:113153719-113153741 AGTCCAGATGTTTCTTATTGAGG - Intronic
996143638 5:119946457-119946479 ATTTCTGATTTTACTTATTTGGG - Intergenic
996653367 5:125909972-125909994 ATTTCTGATTTTATTTATTTGGG + Intergenic
996921859 5:128777461-128777483 ACCCCTGATGTTACATTCTTCGG + Intronic
997171029 5:131720986-131721008 GATCCTGATTTTAATTATTTTGG - Intronic
997183941 5:131862303-131862325 ATTCCTGATTTTGTTTATTTGGG + Intronic
997190089 5:131924310-131924332 GATCCTGATTTTAATTATTTTGG + Intronic
998613406 5:143713730-143713752 TCTCATGATGTGATTTATTTTGG - Intergenic
998752927 5:145343796-145343818 ATTTCTGATTTTGCTTATTTGGG - Intergenic
1000616410 5:163432782-163432804 ACTCCTGATCTGAGTTTTTTAGG - Intergenic
1000896923 5:166866740-166866762 AGTCCTTATGTTACTAATGTAGG + Intergenic
1003386250 6:5670258-5670280 AGTATTGATGTAACTTATTTGGG - Intronic
1008247787 6:49200247-49200269 ACTCCTGATGTTGCCTTTGTAGG + Intergenic
1008895557 6:56550440-56550462 AATGGTAATGTTACTTATTTGGG + Intronic
1009282168 6:61766334-61766356 ACCTCTGATTTTATTTATTTGGG + Intronic
1009408607 6:63338559-63338581 ATTTCTAATTTTACTTATTTGGG + Intergenic
1009551366 6:65097505-65097527 AGTCCTGATTTCAATTATTTTGG - Intronic
1009847062 6:69147012-69147034 ATTTCTGATTTTATTTATTTGGG + Intronic
1012153958 6:95793232-95793254 ACTCTCGATGTTAATTATATAGG + Intergenic
1012350489 6:98244275-98244297 TCTCCTAATTTTACTTTTTTGGG - Intergenic
1013553211 6:111230550-111230572 ACTTCTGATGTAACTTAATGTGG + Intronic
1014186304 6:118438172-118438194 TTTTCTGATGTTATTTATTTGGG + Intergenic
1014833855 6:126135272-126135294 ATTTCTGATTTTATTTATTTGGG - Intergenic
1015837892 6:137441465-137441487 ATTTCTGATTTTATTTATTTTGG + Intergenic
1016195864 6:141339125-141339147 ATTTCTGATTTTATTTATTTGGG - Intergenic
1017991235 6:159491540-159491562 CCTCCTGATGTCAATGATTTTGG + Intergenic
1018558787 6:165078555-165078577 TCTCCTAATGTTACATATTTGGG + Intergenic
1018636769 6:165868300-165868322 GTTCCTGATTTTATTTATTTGGG - Intronic
1018985341 6:168632203-168632225 ACTTCTGATGTTCCTGAGTTAGG - Intronic
1020342736 7:7130316-7130338 ACTCCTGATTTCACACATTTAGG + Intergenic
1020499474 7:8898379-8898401 ACTCCATATGTTCATTATTTGGG - Intergenic
1020796449 7:12683576-12683598 TCTCCTGATGATTCTGATTTGGG + Intergenic
1021304726 7:19018840-19018862 ATTTCTGATTTTAGTTATTTGGG - Intergenic
1021782739 7:24122002-24122024 TCTACTGATATTACTTATTTTGG + Intergenic
1021843023 7:24737279-24737301 ATTTCTGATTTTATTTATTTGGG - Intronic
1022293490 7:29026625-29026647 ATTTCTGATTTTATTTATTTGGG - Intronic
1022758615 7:33322597-33322619 ATCTCTGATTTTACTTATTTGGG + Intronic
1023200302 7:37689757-37689779 ATTTCTGATTTTATTTATTTGGG + Intronic
1028334515 7:89635477-89635499 CTTTCTGATTTTACTTATTTGGG + Intergenic
1028560625 7:92171308-92171330 GATTCTGATTTTACTTATTTGGG - Intronic
1028616886 7:92778368-92778390 TCCCCTAATGTTACTTATTCTGG + Intronic
1028720544 7:94025962-94025984 ACTCCTGATGTTACTTGCAAAGG - Intergenic
1030170555 7:106598698-106598720 CCTCCAGATTTTATTTATTTGGG - Intergenic
1030278816 7:107748718-107748740 ACTGCTAATTTTATTTATTTTGG - Intronic
1031302078 7:120073014-120073036 ATTTCTGATTTTATTTATTTTGG - Intergenic
1031555912 7:123175886-123175908 ATTCTTGCTGTTACTGATTTGGG + Intronic
1032216115 7:129958593-129958615 AGCCCTGGTTTTACTTATTTTGG + Intergenic
1032429871 7:131851965-131851987 TCTCCTGATGCTATTAATTTAGG + Intergenic
1033729008 7:144155547-144155569 ATTCCAGATGTCACTTATCTAGG + Intergenic
1034110305 7:148530611-148530633 ACTCTTGATGATACTTTTTTGGG - Intergenic
1034297094 7:149983632-149983654 GGTCCTGATTTTAATTATTTTGG - Intergenic
1034808933 7:154113206-154113228 GGTCCTGATTTTAATTATTTTGG + Intronic
1034843305 7:154419848-154419870 CATCCTGATTTCACTTATTTTGG - Intronic
1035490005 7:159267289-159267311 ATTTCTGATTTTATTTATTTGGG + Intergenic
1035592368 8:825579-825601 ATTCCAGATGTTGCTAATTTGGG + Intergenic
1035875095 8:3179802-3179824 ACTGTGGATGTTACTTATGTAGG - Intronic
1036696352 8:10977516-10977538 AGTTCTGTTGTTACATATTTTGG - Intronic
1037025119 8:14025948-14025970 ATCTCTGATTTTACTTATTTGGG - Intergenic
1037558150 8:20046590-20046612 ATTCCTGCTTTTACTTGTTTGGG + Intergenic
1039666510 8:39537961-39537983 AATCCTGATTTTAATTCTTTTGG + Intergenic
1040050731 8:43011432-43011454 ACACATGCTGTTACTTATTTGGG - Intronic
1041783082 8:61599555-61599577 ATTTCTGATTTTATTTATTTGGG - Intronic
1042815133 8:72869848-72869870 AATCCTGATTTTAATTCTTTTGG - Intronic
1043046781 8:75334887-75334909 ACTGCTGAGGTTAATCATTTTGG + Intergenic
1043145169 8:76644509-76644531 ATTTCTGATTTTACTTATTTGGG - Intergenic
1043998350 8:86847020-86847042 ATCCCTGATTTTATTTATTTGGG - Intergenic
1046140126 8:110080613-110080635 AATCCTGATGTTAATTCATTTGG - Intergenic
1048028504 8:130609037-130609059 ACTCTTGATGTTTCCTAGTTGGG - Intergenic
1048079913 8:131114969-131114991 ATTTCTGATTTTATTTATTTGGG + Intergenic
1048676188 8:136784120-136784142 ATTTCTGATTTTATTTATTTGGG - Intergenic
1050407224 9:5322244-5322266 ACCCCTGATGTTTCTCCTTTGGG - Intergenic
1050414220 9:5398200-5398222 ACCCCTGATGTTTCTCCTTTGGG - Intronic
1050832585 9:10031934-10031956 ATTCCTGATTCCACTTATTTGGG - Intronic
1050906147 9:11009208-11009230 ACCTCTGATTTTATTTATTTAGG + Intergenic
1053465174 9:38301804-38301826 ACTCCTTATTTTCCTTACTTGGG - Intergenic
1054745225 9:68847386-68847408 ACTGCTGTTGTTGCTGATTTAGG - Intronic
1058016603 9:100039803-100039825 ATTTCTGATGTTATTTATTTAGG - Intronic
1058931913 9:109729006-109729028 AGTCCTGATGAGATTTATTTTGG + Intronic
1185567721 X:1108562-1108584 TGTCCTGATGTTACTTTTTCTGG - Intergenic
1187024620 X:15421425-15421447 ATTTCTGATTTTATTTATTTGGG - Intronic
1187651759 X:21416790-21416812 ACCTCTGATTTTATTTATTTGGG + Intronic
1188045300 X:25419277-25419299 ATTTCTGATTTTATTTATTTGGG + Intergenic
1188381765 X:29503152-29503174 GTTCCTGATTTTATTTATTTGGG + Intronic
1188420942 X:29990218-29990240 ACTTCTGATTTTATTTGTTTGGG + Intergenic
1188625381 X:32278094-32278116 ATTTCTGATTTTACTTATTTGGG - Intronic
1188730936 X:33646108-33646130 ACTAATGATTTGACTTATTTAGG - Intergenic
1190802804 X:53807724-53807746 ATTTCTGATTTTAGTTATTTGGG - Intergenic
1190944733 X:55080555-55080577 ATTTCTGATTTTATTTATTTGGG + Intergenic
1191052448 X:56208338-56208360 ATTTCTGATTTTATTTATTTGGG + Intergenic
1191758070 X:64616204-64616226 ATTTCTGATTTTATTTATTTGGG + Intergenic
1191819484 X:65287924-65287946 ACTTCTGATTTTGCTTATTAGGG - Intergenic
1191970286 X:66806667-66806689 AATCCTGATTTTAATTCTTTTGG + Intergenic
1191984734 X:66967922-66967944 ATTTCTGATTTTATTTATTTTGG + Intergenic
1192064730 X:67870736-67870758 AATCCTGATTTCAATTATTTTGG + Intergenic
1192201688 X:69070315-69070337 ACTGCTGGTGACACTTATTTAGG - Intergenic
1192435018 X:71137732-71137754 ACTCCTTATGTTTCTCATGTGGG + Exonic
1192463369 X:71336990-71337012 ATTTCTGATTTTAATTATTTGGG + Intergenic
1192737260 X:73861431-73861453 ACCCCTGATGTTGCTTACATGGG - Intergenic
1192892511 X:75406477-75406499 ACTTCTGATTCTATTTATTTGGG - Intronic
1193071712 X:77313199-77313221 ATTTCTGATTTTATTTATTTGGG - Intergenic
1193639346 X:83992893-83992915 ATTTATGATGTTACCTATTTTGG - Intergenic
1194375651 X:93129934-93129956 ACACCATATGTTAGTTATTTGGG - Intergenic
1194401365 X:93440869-93440891 ATTCCTGATTTTGCTTATTTGGG - Intergenic
1194412300 X:93572093-93572115 ATTCCTGTTGTTATTTATTCCGG - Intergenic
1194632659 X:96304508-96304530 ATTTCTGATTTTATTTATTTGGG + Intergenic
1194888088 X:99343540-99343562 ATTTCTGATTTTATTTATTTGGG + Intergenic
1194965439 X:100283465-100283487 ATTTCTGATTTTATTTATTTGGG + Intergenic
1195899911 X:109786853-109786875 ACCATTAATGTTACTTATTTGGG - Intergenic
1196157298 X:112444866-112444888 ATTTCTGATTTTATTTATTTAGG + Intergenic
1196217219 X:113067689-113067711 ATTTCTGATTTTATTTATTTGGG + Intergenic
1197072694 X:122319643-122319665 AAGCCTCATGTTACTGATTTTGG + Intergenic
1197078014 X:122376158-122376180 ATACCTGATTTTATTTATTTGGG + Intergenic
1197458249 X:126705360-126705382 ACTTCTGATTTTATTTATTTGGG - Intergenic
1197523919 X:127537704-127537726 ACTCCTGATATTACTGTATTAGG - Intergenic
1198133302 X:133721295-133721317 ATTCCTGATTTTAGTGATTTGGG - Intronic
1198298914 X:135314832-135314854 ATTTCTGATTTTATTTATTTGGG + Intronic
1198482991 X:137058006-137058028 AACCCTGATGATACTGATTTGGG - Intergenic
1198538007 X:137605448-137605470 ATCTCTGATGTTATTTATTTGGG - Intergenic
1199028496 X:142969543-142969565 ATTTCTGATTTTATTTATTTGGG - Intergenic
1199368038 X:147010798-147010820 ATCTCTGATTTTACTTATTTGGG + Intergenic
1199454717 X:148015182-148015204 ATCTCTGATTTTACTTATTTGGG + Intronic
1200435961 Y:3151128-3151150 ATTTCTGATTTTATTTATTTGGG + Intergenic
1200450742 Y:3325435-3325457 CATCCTAATTTTACTTATTTGGG + Intergenic
1202594107 Y:26518735-26518757 ACTACTGATGTTATTAATTTGGG + Intergenic
1202594109 Y:26519021-26519043 ACTACTGATGTTATTAATTTGGG - Intergenic
1202594710 Y:26524868-26524890 GTTTCTGATTTTACTTATTTGGG - Intergenic