ID: 995290372

View in Genome Browser
Species Human (GRCh38)
Location 5:110444374-110444396
Sequence AGGGAGAGCTCAGTGACTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 676
Summary {0: 1, 1: 20, 2: 43, 3: 119, 4: 493}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995290372_995290386 22 Left 995290372 5:110444374-110444396 CCCCCAGTCACTGAGCTCTCCCT 0: 1
1: 20
2: 43
3: 119
4: 493
Right 995290386 5:110444419-110444441 ACCATGTAGCCACAGCTGGGGGG 0: 1
1: 1
2: 1
3: 25
4: 148
995290372_995290384 20 Left 995290372 5:110444374-110444396 CCCCCAGTCACTGAGCTCTCCCT 0: 1
1: 20
2: 43
3: 119
4: 493
Right 995290384 5:110444417-110444439 GTACCATGTAGCCACAGCTGGGG No data
995290372_995290389 27 Left 995290372 5:110444374-110444396 CCCCCAGTCACTGAGCTCTCCCT 0: 1
1: 20
2: 43
3: 119
4: 493
Right 995290389 5:110444424-110444446 GTAGCCACAGCTGGGGGGTTGGG 0: 1
1: 1
2: 3
3: 19
4: 235
995290372_995290383 19 Left 995290372 5:110444374-110444396 CCCCCAGTCACTGAGCTCTCCCT 0: 1
1: 20
2: 43
3: 119
4: 493
Right 995290383 5:110444416-110444438 TGTACCATGTAGCCACAGCTGGG No data
995290372_995290382 18 Left 995290372 5:110444374-110444396 CCCCCAGTCACTGAGCTCTCCCT 0: 1
1: 20
2: 43
3: 119
4: 493
Right 995290382 5:110444415-110444437 CTGTACCATGTAGCCACAGCTGG 0: 1
1: 0
2: 5
3: 18
4: 172
995290372_995290385 21 Left 995290372 5:110444374-110444396 CCCCCAGTCACTGAGCTCTCCCT 0: 1
1: 20
2: 43
3: 119
4: 493
Right 995290385 5:110444418-110444440 TACCATGTAGCCACAGCTGGGGG 0: 1
1: 0
2: 6
3: 33
4: 205
995290372_995290388 26 Left 995290372 5:110444374-110444396 CCCCCAGTCACTGAGCTCTCCCT 0: 1
1: 20
2: 43
3: 119
4: 493
Right 995290388 5:110444423-110444445 TGTAGCCACAGCTGGGGGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995290372 Original CRISPR AGGGAGAGCTCAGTGACTGG GGG (reversed) Intronic
901143159 1:7048641-7048663 AGGGAAGGCTCAGGGACAGGTGG - Intronic
902348759 1:15837610-15837632 AGGGCGAGCTCATTGCCCGGTGG + Intergenic
902368426 1:15991572-15991594 TGGGAAGGGTCAGTGACTGGGGG + Intergenic
902600490 1:17537559-17537581 AGGGAGAGGTCAGGGAATGGAGG + Intergenic
902997099 1:20234669-20234691 AGAGAGAACTGGGTGACTGGAGG + Intergenic
904116969 1:28170038-28170060 AGTGAGAGCTCATTGAATGTTGG + Intronic
904381086 1:30111665-30111687 GGGCAGAGCTCAGTGGCTGGAGG - Intergenic
905507305 1:38490130-38490152 AGGGAGATCAGAGTGACTAGAGG + Intergenic
905739816 1:40360692-40360714 AAGGAGAGCACAGTGATTGTGGG + Intronic
906678120 1:47708071-47708093 AGGGGGAGCTCAGTGACTCGCGG - Intergenic
906827172 1:48993804-48993826 AGGGAGAGTGCAGTGATTGTGGG - Intronic
908363273 1:63390800-63390822 AGGGAGAGTGCAGTGACTATGGG - Intronic
909848910 1:80434818-80434840 AGGGAGATCTCAGTGACTGGGGG - Intergenic
910422437 1:87080768-87080790 GGGGAGAGCACAGTGATTGCGGG + Intronic
910470525 1:87547745-87547767 AGGGAGAGGACAGTGACTGTGGG - Intergenic
910801255 1:91149060-91149082 AGGGGGAGCACAGTGATTGTGGG - Intergenic
911052260 1:93681312-93681334 GGGGAGCGCTCAGCGATTGGCGG - Intronic
911942859 1:104069513-104069535 AGAGAGAGTGCAATGACTGGGGG - Intergenic
911960846 1:104300915-104300937 AGGGAGGGTGCAGTGACTGAAGG + Intergenic
912018548 1:105072980-105073002 AGGAAGAGTGCAGTGACTGAGGG - Intergenic
912643821 1:111372275-111372297 AGGGAGAGCACAGTGATTGTGGG + Intergenic
912871407 1:113310480-113310502 AGGGAGAGCACAGGGATTGTGGG + Intergenic
912899303 1:113630726-113630748 AGGGGGAGCACAGTGGCTGATGG - Intronic
913348957 1:117836777-117836799 AGAGAGAACTGAGTGGCTGGAGG + Intergenic
914824163 1:151129309-151129331 AAGGATAGGTCAGTAACTGGAGG - Intergenic
915168553 1:153962463-153962485 AGGGAGGGCTCTGGGGCTGGCGG - Intronic
915310749 1:155004818-155004840 AGGGAGGGGACAGTGTCTGGGGG - Intronic
915752662 1:158226761-158226783 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
916420815 1:164636091-164636113 AGGGGGTGCCCACTGACTGGAGG - Intronic
916425447 1:164675726-164675748 AGGCAGTCCTCAGTGTCTGGGGG - Intronic
917300675 1:173570832-173570854 AGGGAGACCACAGCAACTGGGGG - Intronic
917306127 1:173627467-173627489 AGGGAGAGCACAGTGACTGTGGG + Intronic
917397037 1:174604346-174604368 AGGGAGAGGACAGTGATTGTGGG - Intronic
918070707 1:181131715-181131737 AGGGTGAGCTCAGCACCTGGCGG - Intergenic
918357892 1:183723505-183723527 AGGGAGAGTACAGTGACTGTGGG + Intronic
918553047 1:185766292-185766314 AATGAGAACTCAGAGACTGGGGG + Intronic
919012934 1:191988480-191988502 AGGGAGAACACAGCAACTGGGGG + Intergenic
919147336 1:193651935-193651957 AGGGAGAGCACAGTAACTGTGGG - Intergenic
919257592 1:195143401-195143423 GGGGAGAGCACAGGGACCGGAGG - Intergenic
919719504 1:200817625-200817647 ATGGAGAGATCAGTGAATAGTGG - Intronic
919793659 1:201308358-201308380 AGCAAGAGCTCAGTGAAAGGTGG - Intronic
920184331 1:204151130-204151152 AGGGGCAGCTCAGAGCCTGGAGG + Intronic
920596827 1:207280192-207280214 AGGGAGAGCACAGTTACTGTGGG - Intergenic
920852886 1:209640600-209640622 AGGGAATGCACAGTGAGTGGTGG - Intronic
921774669 1:219082784-219082806 AGAGACAGCTCAGTGATTGTGGG - Intergenic
922001319 1:221481314-221481336 AGGAAGTGCTCAGTAAATGGTGG - Intergenic
922388659 1:225114776-225114798 AGAGAGAGCACAGTGACTGTGGG - Intronic
923413304 1:233731049-233731071 TGGGATAGATCAGTGAATGGTGG - Intergenic
923660162 1:235950648-235950670 AAGGAGAGCTGAGTGGCAGGAGG + Intergenic
924101503 1:240607599-240607621 AGAGCGTGCTCAGTGTCTGGAGG - Intronic
924516319 1:244769011-244769033 AGGGAGAGCGCAGTGACTGGGGG - Intergenic
1066708133 10:38203221-38203243 AGGGAGAGCACAGCAACTGTGGG + Intergenic
1067324464 10:45253729-45253751 GAGGAGAGCACAGTGATTGGAGG + Intergenic
1067341806 10:45411880-45411902 AGGGAGACCTCACTTACTAGAGG - Intronic
1067450174 10:46377176-46377198 AGGGAGAGCCCAGTGCTGGGTGG + Intronic
1067587068 10:47482587-47482609 AGGGAGAGCCCAGTGCTGGGTGG - Intronic
1067634128 10:47990354-47990376 AGGGAGAGCCCAGTGCTGGGTGG - Intergenic
1067951140 10:50739492-50739514 AGGGAGATCTCAGGTTCTGGGGG - Intronic
1068124901 10:52827524-52827546 AGGGAGAGCAAAGTGACTGTGGG + Intergenic
1069050571 10:63788305-63788327 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1069743332 10:70699472-70699494 AGGGAGCTCTCTGTCACTGGAGG + Intronic
1069881055 10:71593657-71593679 TGGGAAACCCCAGTGACTGGTGG + Intronic
1070059556 10:72968675-72968697 AGGGAAAGTACAGTAACTGGGGG - Intergenic
1070510074 10:77152919-77152941 AGGAAGCCCTCAGTGAATGGAGG - Intronic
1070789168 10:79179566-79179588 AGAGAGAGCTGAGTGGCTGCAGG + Intronic
1071103074 10:82061645-82061667 AGAGTGAGCTCAGTGAATGCTGG + Intronic
1071913055 10:90257570-90257592 AGGGAGGGCTTAAGGACTGGGGG + Intergenic
1072492500 10:95921317-95921339 AGGGAGAGTTAAGTGATTGGGGG - Intronic
1073126202 10:101151443-101151465 AAGGGAAGCTCAGTGACAGGGGG + Intergenic
1073212792 10:101818384-101818406 AGGGAGAGCTCGGGGCTTGGAGG - Exonic
1073827212 10:107337478-107337500 AGGGAGATCACAGTGACTGGGGG - Intergenic
1074670051 10:115780154-115780176 AGGGAGAGCACAGTGATTGTGGG + Intronic
1075496261 10:122922166-122922188 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1075568823 10:123523897-123523919 AGGAAGAGCTCAGCAAATGGTGG + Intergenic
1076864127 10:133159119-133159141 AGAGAGAGCTCAGGGACAGCTGG + Intergenic
1077571555 11:3343092-3343114 AGGGAGAGTTCACTTTCTGGGGG + Intronic
1078752979 11:14182541-14182563 AGGGAGGTCTCTGTCACTGGAGG - Intronic
1079416299 11:20239182-20239204 AAGGAGAGCACAGTGACTGGGGG - Intergenic
1079532894 11:21476796-21476818 AGGGAGAGCACAATGATTGTGGG + Intronic
1080707252 11:34707941-34707963 AGGGCAAGCACAGTGACTAGGGG - Intergenic
1081245653 11:40763653-40763675 AGGGAAAGCACAGTGATTGTGGG + Intronic
1083538973 11:63498464-63498486 AGGGAGAGCATGGTGACTGAAGG - Intergenic
1083628666 11:64084871-64084893 AGGGAGAGCTGCGTGTGTGGGGG + Intronic
1083733377 11:64665717-64665739 AGGCCCAGCTCAGTGACAGGCGG + Intronic
1083736391 11:64683920-64683942 AGGGAGAGGTCTGTGGCTAGGGG - Intronic
1084188692 11:67489073-67489095 AGAGAGGGCTGAGCGACTGGAGG + Intronic
1084308034 11:68299260-68299282 AGGGACAGCTTGGGGACTGGAGG + Intergenic
1084948417 11:72651475-72651497 AGGGAGAGGCCAGGGTCTGGGGG + Intronic
1085052108 11:73385176-73385198 TGGGAGAGCTTAGGGACTGTAGG + Intronic
1085535404 11:77214354-77214376 AGGGAGGGATCCGTGACTTGAGG + Intronic
1085937734 11:81170144-81170166 AGGGAGAATTCAGAGAATGGAGG - Intergenic
1086032990 11:82383213-82383235 AGGGAGAGCACAGCAACTGAGGG + Intergenic
1088330638 11:108647591-108647613 AGGGAGAGCAAAGTGAGTGTGGG + Intergenic
1088594298 11:111428455-111428477 AGGAAGAGGTCCCTGACTGGAGG - Intronic
1088742590 11:112779200-112779222 AGGAAGAGCTCAGGGTCTGAAGG - Intergenic
1088944582 11:114496313-114496335 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1089812050 11:121140368-121140390 AGGGAGAGCTAACCCACTGGGGG - Intronic
1090355513 11:126137921-126137943 GGGGAGAACTCAGCCACTGGTGG - Intergenic
1090439474 11:126713877-126713899 AGGGGGAGCACAGTGCTTGGAGG + Intronic
1090476017 11:127021037-127021059 AGGGAGAAATCAGTGGCTGAAGG + Intergenic
1091647584 12:2285436-2285458 AGGGAGAGCCCAGGTAGTGGAGG + Intronic
1091997008 12:5001628-5001650 AGGGAGAACTCTGTGGCTGCAGG + Intergenic
1092477141 12:8828950-8828972 CGGGAGAGCACAGTGACTGTGGG - Intronic
1093531900 12:20175252-20175274 AGAGAGAGTCCAGTGACTGTGGG - Intergenic
1093746642 12:22749827-22749849 AGGCAGAGCTCAGGGACTAATGG + Intergenic
1093813233 12:23512357-23512379 GTTAAGAGCTCAGTGACTGGGGG + Intergenic
1093931626 12:24960329-24960351 AGGAAGAGCACAGTGACTGTGGG + Intergenic
1094419680 12:30257476-30257498 AGGGAGAGCACAGTAACTATAGG + Intergenic
1095101014 12:38183924-38183946 AGAGAGAGCACAGTGACTGGAGG + Intergenic
1095216454 12:39555854-39555876 AGGCAGGACTCAGTGGCTGGGGG + Intronic
1095820413 12:46472383-46472405 AGGGTGAGCTCAATGCTTGGTGG - Intergenic
1095860141 12:46907802-46907824 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
1095909813 12:47414742-47414764 AGGGACAGGTCAGGGACTAGTGG - Intergenic
1096139758 12:49233408-49233430 ACTGAGAGCTCAGTGTTTGGAGG - Intronic
1097466999 12:59938718-59938740 AGTGAGAGTTCAGTGGCGGGAGG - Intergenic
1097899388 12:64857899-64857921 TGGGAGAGTGCAGTGACTAGAGG - Intronic
1098405573 12:70122901-70122923 AGAGAGAGTGCAGTGACTAGAGG + Intergenic
1098982698 12:76974745-76974767 AGGGATAGAGCTGTGACTGGTGG + Intergenic
1099101011 12:78440094-78440116 AGGGAGAGCAAAGTGACTGTGGG - Intergenic
1099610208 12:84858035-84858057 AGGGAAAGCACAGTGACTAAGGG - Intergenic
1099651021 12:85428533-85428555 AGGGAGAGTTGAGTGAAGGGTGG + Intergenic
1099757785 12:86876891-86876913 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1099807831 12:87542812-87542834 AGGCAGAGCACAGCGACTGTAGG + Intergenic
1101038405 12:100728692-100728714 AGTGAGTGCTCAGTAACTGATGG + Intronic
1101696530 12:107132491-107132513 AGGCAGAGCTCACTGACTGTGGG + Intergenic
1101973676 12:109336235-109336257 AGGGAAAGGTCTATGACTGGAGG - Intergenic
1102257595 12:111425200-111425222 AGAGAGCACTCTGTGACTGGGGG + Intronic
1102258574 12:111429975-111429997 AGGCAGAGCTCAGGTCCTGGCGG + Intronic
1102356582 12:112241909-112241931 AGAGAGGGTTCAGTGGCTGGAGG - Intronic
1102464267 12:113119351-113119373 TTGGAGACCTCAGTGAGTGGTGG - Exonic
1103588869 12:121976373-121976395 AGGAAGAGCTCAGTGAATGGAGG + Intronic
1105533337 13:21240758-21240780 AGGAAGTGCTCAGTAAGTGGTGG + Intergenic
1106350213 13:28922631-28922653 AGGGAGAGCGCAATGACTGGGGG - Intronic
1106350894 13:28929814-28929836 AGCAAGAGCTGAGTGTCTGGAGG + Intronic
1107210756 13:37851829-37851851 AGGGAGAGCACAGCAACAGGTGG + Intronic
1107808346 13:44175547-44175569 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1109117045 13:58401602-58401624 AGGTAGAGCTCTGTGATTGGTGG + Intergenic
1109961760 13:69640024-69640046 AGGGAGAGCACAATGATTGCGGG - Intergenic
1110079046 13:71287473-71287495 AGAGAAAGCGCAGTGACTGTGGG - Intergenic
1110665874 13:78116770-78116792 AGGGAGAATGCAGTGACTGTGGG - Intergenic
1111639193 13:90946625-90946647 AGGGAGAGCATAGTGATTGTGGG + Intergenic
1112944499 13:104910748-104910770 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1113244428 13:108378253-108378275 AGGGATAGCACAGTGACTGTGGG - Intergenic
1113870198 13:113554481-113554503 AGGGGAAGCTCAGTGAGTAGCGG - Intronic
1114417208 14:22552836-22552858 AGGGAGAGCGCAGTGAGCTGTGG - Intergenic
1115133883 14:30086206-30086228 AGGGAGAGCACAGTGACTGGGGG + Intronic
1115879468 14:37899025-37899047 GGGAAGAGCTGAGTGACTGATGG + Intronic
1116354700 14:43914009-43914031 AGGGACAGCACAGTGATTGTGGG + Intergenic
1116413091 14:44648980-44649002 AGGGAGAGTTCAGTGATTATGGG + Intergenic
1116888951 14:50249001-50249023 AGGGAGGGTACAGTGGCTGGGGG + Intronic
1117161617 14:52995341-52995363 AGGGAGAGCACAGTGACTATGGG - Intergenic
1117208572 14:53470823-53470845 AGAGAGAGCACAGTGATTGTGGG - Intergenic
1117384369 14:55195809-55195831 AGGGAGAGCGCAGTGACTGATGG - Intergenic
1118034282 14:61849623-61849645 AGGGAGAGCATAGTGATTGTGGG - Intergenic
1118431284 14:65720949-65720971 AGGGGGAGCACAGTGATTGTGGG - Intronic
1119711485 14:76825728-76825750 ATGGTCAGGTCAGTGACTGGAGG - Intronic
1119991233 14:79199994-79200016 ATTGAGAGGTCATTGACTGGGGG + Intronic
1120439763 14:84521189-84521211 AGGGGCAGCTCAGGGACTGTGGG - Intergenic
1120697322 14:87659044-87659066 AGGGAGAGCACGGTCACTGGAGG + Intergenic
1121555092 14:94830422-94830444 AAGGAGAGCAGAGAGACTGGGGG - Intergenic
1122594359 14:102879004-102879026 AGGGGGTGCCCAGTGAGTGGAGG + Intronic
1122757739 14:103996083-103996105 AGGTGGAGTTCTGTGACTGGAGG + Intronic
1124651000 15:31473898-31473920 AGGAGGAGCTCAGAGTCTGGGGG - Intergenic
1126565678 15:50096329-50096351 AGGAAGTCCTCTGTGACTGGTGG + Intronic
1126858189 15:52859161-52859183 AGGGAGAGCTCAGTGAGGTGAGG + Intergenic
1127132527 15:55882364-55882386 TGGGAGAGCTCAGTGACAGTGGG + Intronic
1127545669 15:59992951-59992973 AAGGAGGGCTGAGTGAGTGGGGG + Intergenic
1127791794 15:62404966-62404988 TGGGAAAACTCAGTGACTCGAGG + Intronic
1128068889 15:64781397-64781419 AGGGAGAGCTCAGGGATTTGGGG - Intergenic
1128107801 15:65057275-65057297 AGGGAGGGATGAGTGGCTGGTGG + Intronic
1128708255 15:69852970-69852992 AGGAAGGGCTCAAGGACTGGAGG + Intergenic
1129122778 15:73411908-73411930 AGGGAGATCTGGGTGAATGGTGG + Intergenic
1129388175 15:75207164-75207186 AAGGAAAACTCAGTGTCTGGGGG - Exonic
1130395047 15:83494217-83494239 TGGCAGAGCTCAGCCACTGGAGG + Intronic
1130441259 15:83956217-83956239 AGGGAGAGCACAGCAACTGGGGG - Intronic
1130916841 15:88311876-88311898 AGGGAGATCTCAGAGACCTGGGG - Intergenic
1132128363 15:99251104-99251126 AGGAACAGGTCAGTAACTGGCGG + Intronic
1132311099 15:100858567-100858589 AGTGAGAGCTCAGTGACTGAAGG - Intergenic
1132598152 16:762502-762524 ACAGAGGGCTCAGTGGCTGGAGG + Intronic
1132723117 16:1326559-1326581 ACCGAGAGCTCAGTGACTGCAGG - Exonic
1133297557 16:4762355-4762377 TGGGTGAGCTGTGTGACTGGTGG - Intronic
1133997428 16:10759130-10759152 AGTCAGAGCTCAGTGAGTGCTGG - Intronic
1135388862 16:22071221-22071243 AGGGAGAGCCCCGTGAGAGGAGG + Intronic
1135711712 16:24722945-24722967 TGGGGCAGCTAAGTGACTGGTGG + Intergenic
1136119144 16:28118805-28118827 AGGAAGTGCTCAGTGACTGTTGG - Intronic
1136389299 16:29952303-29952325 AGAGAGAGCACATGGACTGGGGG - Intronic
1136676615 16:31914175-31914197 ACGGAGAGCACAGTGACTAGGGG - Intronic
1137550333 16:49433211-49433233 AGGGTGAGCTAAATGATTGGTGG + Intergenic
1138336768 16:56259569-56259591 AGGGAGAGCTCTGACACTGTCGG - Intronic
1138436397 16:57003005-57003027 AGGGAGACCTCATACACTGGTGG - Intronic
1138654426 16:58482562-58482584 TGGGTGGTCTCAGTGACTGGGGG - Intronic
1138806933 16:60100906-60100928 AGAGCGAGCACAGTGACTGTGGG - Intergenic
1139005041 16:62559487-62559509 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1141398217 16:83723603-83723625 AGGGAGTGACCAGTGACAGGTGG - Intronic
1141429132 16:83961861-83961883 AGGGAGACCACAAGGACTGGGGG - Intronic
1141621199 16:85237420-85237442 GGGGACTGTTCAGTGACTGGAGG + Intergenic
1203141172 16_KI270728v1_random:1767797-1767819 AGGGAGAGCTGTGTTACTGGTGG + Intergenic
1142682328 17:1557426-1557448 AGACGGAGCCCAGTGACTGGAGG + Intronic
1143443724 17:6995529-6995551 CGGCAGAGCTCAGGTACTGGAGG + Intronic
1144702690 17:17349276-17349298 AGGGAGAGCCCCGGGCCTGGGGG + Intergenic
1145201016 17:20944751-20944773 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1146098965 17:29960133-29960155 AGGGAGAGCACAGTGACTGTGGG - Intronic
1146456565 17:33013938-33013960 AGGGAGTGCTGGGTGACTCGAGG + Exonic
1147877983 17:43635105-43635127 AGACAGAGCTCAGAGAGTGGGGG + Intergenic
1148155704 17:45424358-45424380 AGTGAGAGGTCAGTGGCTGTTGG - Intronic
1149143632 17:53463591-53463613 AGGCAGAGCTCCTTAACTGGTGG + Intergenic
1149188436 17:54029953-54029975 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1149332596 17:55601997-55602019 AGAGAGAGCTCAGTGGCTTGTGG - Intergenic
1149755039 17:59179534-59179556 ATGGAGAGCTCACCCACTGGGGG + Intronic
1149755330 17:59181395-59181417 ATGGAGAGCTCACCCACTGGGGG + Intronic
1150055002 17:62006561-62006583 AGGTAGAGCTTGTTGACTGGTGG - Intronic
1150321324 17:64216860-64216882 AGGGAGAGCTGGGTGTCAGGTGG + Intronic
1150541391 17:66103824-66103846 AGGAAGAGCACAGTGATTGTGGG + Intronic
1150576403 17:66434475-66434497 AGGGAGAGGTCAGAAACAGGAGG + Intronic
1150587447 17:66531661-66531683 AGGGAGACAGCAGTGACAGGAGG - Intronic
1151715331 17:75828120-75828142 GGGGAGAGGGCAGTGCCTGGTGG + Intronic
1152024037 17:77797137-77797159 AGGGGGAGCTCAGGGACGGCAGG + Intergenic
1152109801 17:78351706-78351728 TGGGAGGGCTCAGTGCCGGGGGG + Intergenic
1152118859 17:78405849-78405871 CGGAAGAGCTGAGTGAGTGGGGG + Intronic
1152393496 17:80017055-80017077 AGGGAGAGCTGAGTGGATGAGGG - Intronic
1152512780 17:80801809-80801831 AGGGGGAGGTGAGTGATTGGCGG + Intronic
1152524987 17:80883501-80883523 AGGGTGAGCTCTGGGGCTGGGGG - Intronic
1152963515 18:95532-95554 TGGGAGCGCTCAGGGACTGGGGG + Intergenic
1153356707 18:4144413-4144435 AGGGAGAACACAGTGATTGTGGG - Intronic
1153765370 18:8369556-8369578 AGGAAGAGCGCAGTGACTGTGGG + Intronic
1153976856 18:10276307-10276329 AGGCATAGCTGAATGACTGGTGG - Intergenic
1154085983 18:11305889-11305911 AGGGAGAGCACAGCAACTGGGGG - Intergenic
1155195958 18:23474769-23474791 ATAGAGAGCTCAGGGACTGATGG - Intronic
1155443292 18:25884416-25884438 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1155792757 18:29995471-29995493 AGGGAGCGCATAGTGACTGTGGG + Intergenic
1156977356 18:43238629-43238651 AGGGGCAACACAGTGACTGGAGG - Intergenic
1157169924 18:45393802-45393824 AGTGAGAACTCAGTGAGTGTTGG - Intronic
1158646308 18:59250726-59250748 ACTGAGAGTTCAGTGAATGGTGG - Intergenic
1159088518 18:63820865-63820887 AGGGAGGGTTTAGTGAATGGAGG + Intergenic
1159285042 18:66337554-66337576 GGGAAGAGCTCAGTGACTGTGGG - Intergenic
1159339797 18:67119809-67119831 ACGGAAAGCTCAGTGATTGGGGG - Intergenic
1159564856 18:70036979-70037001 AGGGAGAGAGCAGCGACTGGGGG + Intronic
1159616387 18:70584649-70584671 AAGGTGCACTCAGTGACTGGTGG - Intergenic
1160009083 18:75090013-75090035 AGGGAGAGCACAGTCAGAGGTGG + Intergenic
1161206235 19:3042455-3042477 AGGGGGAGGTCAGCGGCTGGGGG + Intronic
1161213319 19:3079757-3079779 AAGGAGACCTGTGTGACTGGAGG + Intergenic
1161462937 19:4409648-4409670 AGGGAGAGCTCAGGGACGAATGG - Exonic
1161467462 19:4439590-4439612 AGGGAGGGCCCAGTGACTTGAGG + Intronic
1161664254 19:5565333-5565355 GGAGAGGGATCAGTGACTGGGGG - Intergenic
1162525361 19:11203430-11203452 GGGGAGAGATCAGAGACGGGAGG + Intronic
1163400136 19:17087179-17087201 AGGGAGACCCCAGGGCCTGGAGG + Intronic
1165150317 19:33756511-33756533 AGGGAGGTCTCAGGGAATGGAGG - Intronic
1165186042 19:34022675-34022697 AGGGAGAGACAAGAGACTGGTGG - Intergenic
1165698483 19:37919324-37919346 AGTAAGAGCTCAGTGAATGCTGG - Intronic
1165829867 19:38725156-38725178 AGTGAGTGCTCAGTGAGTGGTGG - Intronic
1166935366 19:46329360-46329382 AGGGAGGGCTCAAGGGCTGGAGG - Exonic
925115313 2:1373744-1373766 AGGGAGAGCGGAGAGACTGTGGG - Intergenic
925420613 2:3707719-3707741 AGGGTGGTCTCAGGGACTGGTGG - Intronic
926518750 2:13883412-13883434 AGGGAGAGCACAGTGATTGCGGG + Intergenic
926948564 2:18216354-18216376 TGGGAGAGCTCAGTATTTGGAGG - Intronic
927108731 2:19849193-19849215 AGGGAAAGCTCAGGGAATGGAGG + Intergenic
927460952 2:23297790-23297812 AGTTAGAGCTGAGTCACTGGGGG + Intergenic
927570405 2:24154005-24154027 AGGGTGAGCCCAGTGAGTAGGGG - Intronic
927764568 2:25793552-25793574 AGGGAGAGATCAGACACTGAAGG + Intronic
928483956 2:31710992-31711014 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
928538464 2:32262235-32262257 AGGAAGGACTCAGTGAATGGCGG + Intronic
928847610 2:35696689-35696711 AGGGAGAGCAAAGTGACTGGGGG - Intergenic
929484752 2:42343222-42343244 TGGGAGCTCTCTGTGACTGGCGG - Intronic
929963016 2:46510841-46510863 TTGGACAGCTCAGTGCCTGGGGG - Intronic
930137829 2:47920285-47920307 AGTGTGAGCTCAGTGAACGGAGG + Intergenic
930288943 2:49468769-49468791 AGGGAGAGCACAGTGATTGTGGG - Intergenic
930439784 2:51391220-51391242 AGGGAGAGTACAGTGACTGGGGG - Intergenic
930539685 2:52690153-52690175 AGGGGGAGATAAGTGTCTGGAGG + Intergenic
930895546 2:56441412-56441434 AGGTAGAGCACAGTGATTGTGGG - Intergenic
930981271 2:57528779-57528801 AGGGAGAGTTAAGTGATTGTGGG - Intergenic
931427689 2:62185878-62185900 AGGTAGAGCCCTGTGTCTGGGGG + Intergenic
932389408 2:71372450-71372472 AGGGACAGCGCAGTAACTAGGGG - Intronic
932517456 2:72367732-72367754 AGGGAGAGTGCAGCAACTGGGGG + Intronic
933351545 2:81158734-81158756 ATGGAGAGAGCAGTGACTGCGGG + Intergenic
933688560 2:85161854-85161876 AGGCAGAGCTCAGAGGCTTGTGG + Intronic
933760330 2:85668058-85668080 AAGCAGTGCTCAGTGAGTGGTGG + Intronic
935347417 2:102121384-102121406 AGGCAGTGCTCAGTGACACGTGG - Intronic
935437954 2:103056898-103056920 AGGGAGAGTGCCGTGACTAGGGG - Intergenic
935750840 2:106232568-106232590 AGGGAGAGCACAGCAACTGGAGG + Intergenic
936641539 2:114317355-114317377 AAGGAGAGCTCAGCGACTGGGGG - Intergenic
937613670 2:123893905-123893927 AGGGAGAGTGCAGATACTGGGGG - Intergenic
939486904 2:142825932-142825954 ATGGAGAGCTCACTGAATTGTGG + Intergenic
940298957 2:152159620-152159642 ATGGAGAGCTCACCCACTGGGGG + Intronic
940795252 2:158070867-158070889 AGGGAGAGCACAGTGACTGTAGG + Intronic
940987746 2:160065121-160065143 AGGGAGGGCTCAGTGCCTGCTGG + Intergenic
941047642 2:160694739-160694761 AGGGAGAGTGCAGTGACTGGTGG - Intergenic
941274811 2:163478027-163478049 AGGGACATTTCAATGACTGGCGG - Intergenic
941742138 2:169046599-169046621 AGGGAGAGCACAGTGACTGTGGG + Intergenic
941746094 2:169088292-169088314 AGGGAGAGCACAGTGATTGTGGG - Intronic
942371873 2:175294152-175294174 TGGGAGAGCTGTGTGCCTGGAGG - Intergenic
942516414 2:176758041-176758063 AGGGGAAGCTGACTGACTGGTGG - Intergenic
942678290 2:178451038-178451060 AGGGACGGCTCAGCGGCTGGAGG + Exonic
942881796 2:180870665-180870687 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
943099656 2:183472223-183472245 AGGGAGAGTGCAGTGACTATGGG - Intergenic
943117607 2:183692442-183692464 AGGGAGAGCACAGTGAATGGGGG - Intergenic
943177104 2:184490663-184490685 AGGGAGAGCAGAGAGATTGGGGG + Intergenic
943237335 2:185338843-185338865 AGAGAGAGCACAGTGACTGTGGG - Intergenic
943785525 2:191874027-191874049 AGGTAGAGCTCACTCACTGTTGG - Intergenic
943867047 2:192938491-192938513 AGGGAGAGTGCAGTGACTGAGGG - Intergenic
943913010 2:193592441-193592463 AGGGAGAGGACCGTGACTGGGGG + Intergenic
943933490 2:193885306-193885328 AGGGAGAATAAAGTGACTGGTGG + Intergenic
944096050 2:195968931-195968953 AGGGACAGCGTAGTGACTGGGGG - Intronic
944543032 2:200771960-200771982 AGGGAGAGATCAGACACAGGGGG + Intergenic
944616548 2:201465909-201465931 AGGGAGAGTGCAGTGATTGTGGG - Intronic
944760240 2:202807310-202807332 AGGGAGAGTGCAGTGATTGTGGG + Intronic
944974299 2:205030423-205030445 ATGGTGAACTAAGTGACTGGTGG - Intronic
947505344 2:230704243-230704265 AGGGAGAGCACAGTGATTGCAGG - Intergenic
948774555 2:240277081-240277103 AGGGAGAGAGCAGTGACTGTGGG + Intergenic
948794714 2:240396417-240396439 AGGGAAAGCTCAGTAAATGGTGG + Intergenic
948892671 2:240915016-240915038 AGGGAGGGCGCAGGGACTGTAGG - Intergenic
949069682 2:242016801-242016823 AGGGATGGCTCACTGACTGACGG + Intergenic
1168748203 20:263170-263192 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1168813464 20:721188-721210 GTGGAGAGGTCAGTGACTTGCGG + Intergenic
1169074098 20:2750956-2750978 AGGTAGGGCTCTGAGACTGGTGG + Intronic
1169390024 20:5182853-5182875 TGGGAGAGCTCACTCACTAGTGG + Intronic
1169988613 20:11474248-11474270 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1170668266 20:18405886-18405908 AGGGAGAGCACAGTGACTGGGGG + Intronic
1170917043 20:20636992-20637014 AGGCTTTGCTCAGTGACTGGAGG - Intronic
1171819704 20:29823564-29823586 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1171898116 20:30829615-30829637 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1172647952 20:36483322-36483344 AGGCAGAGCTCAGCTACGGGAGG + Intronic
1173709696 20:45143786-45143808 AGGGAGAGCTCAGTGCTTGTGGG - Intergenic
1175481497 20:59314434-59314456 CGGGAAAGCTCACAGACTGGAGG + Intronic
1175936873 20:62518039-62518061 AAGGAGACCTCACTGGCTGGGGG - Intergenic
1177264935 21:18770308-18770330 AGGGAGAGATCAGTGTCGAGTGG + Intergenic
1177969959 21:27777480-27777502 AGCGAGAGCACAGTGCCTGGGGG + Intergenic
1178162437 21:29935056-29935078 AGGAAGACCTCTGTGGCTGGAGG - Intronic
1179585362 21:42370903-42370925 AGGGAGTGATCCCTGACTGGAGG - Intergenic
1179792038 21:43761409-43761431 AGGGCAAGCCCAGTGTCTGGCGG + Exonic
1179993638 21:44962312-44962334 TGGGAGAGGTAATTGACTGGGGG - Intronic
1180323704 22:11348255-11348277 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1181529314 22:23507636-23507658 AGGAAGGGCTCTGAGACTGGGGG + Intergenic
1183034094 22:35127648-35127670 AGTGAGAGCTTAGTGCCTGTGGG - Intergenic
1183456026 22:37923850-37923872 GGGGAGAGCTCAGGGGCTTGGGG + Intronic
1183579236 22:38713670-38713692 AGGGAGATCTCAGAGCTTGGGGG - Intronic
1185351863 22:50343651-50343673 AGGGGGAACTGACTGACTGGGGG - Intronic
949510134 3:4760135-4760157 TAGGAGAGGTCAGTGACTTGTGG - Intronic
949810710 3:8003475-8003497 AGAGAGAACTCATTGAATGGTGG - Intergenic
950050922 3:9988839-9988861 AGAGAGAGAAGAGTGACTGGAGG - Intronic
950058011 3:10043956-10043978 AGAGAGAGAAGAGTGACTGGAGG - Intronic
950151746 3:10692849-10692871 AGTGAGTGCACAGTGTCTGGCGG - Intronic
950299187 3:11860602-11860624 AGAGAGAGAAGAGTGACTGGAGG - Intergenic
951029399 3:17864124-17864146 AGGGAGAGCACAGTGACTGTGGG - Intronic
951129822 3:19029372-19029394 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
951172253 3:19555548-19555570 AGGGAATGCTCGGTGACTGGGGG - Intergenic
951255053 3:20439051-20439073 AAGGAGAGGACAATGACTGGGGG + Intergenic
951263291 3:20537459-20537481 GGGAAGAGTTCAATGACTGGGGG - Intergenic
951437096 3:22677188-22677210 AGGGATAGCACAGTGATTGTGGG - Intergenic
952192351 3:31037222-31037244 AGTGAGAGCTCAGAGAGGGGAGG + Intergenic
953822657 3:46221892-46221914 AGGCAGAGCTAAGTGAGGGGTGG - Intronic
954432003 3:50475823-50475845 AGGGAGAGGTCTGTGTCTGAGGG - Intronic
954491478 3:50910709-50910731 AGGGAGAACAAAGTGACTGTGGG - Intronic
955130163 3:56158005-56158027 AGGGAGAGGGCAGGGACTGCTGG + Intronic
956861421 3:73327667-73327689 AGGGTGAGCTCTCTGACTTGAGG - Intergenic
957087239 3:75692392-75692414 ACGGAGAGCACAAGGACTGGAGG + Intergenic
957485589 3:80858413-80858435 AGGGAGAGCACAGTGATTGAGGG + Intergenic
957538098 3:81532020-81532042 AGGGAAAACACAGTGACTGTGGG - Intronic
957965724 3:87320984-87321006 AGGGAGAGTACAGTGATTGTGGG + Intergenic
958670522 3:97197976-97197998 AGGGAGAGCACGGTGATTGTAGG - Intronic
959126059 3:102291325-102291347 AAGGAGAGCACAGTGATTGTGGG - Intronic
959191072 3:103112399-103112421 AGGGAGACTGCAGTGACTGGGGG + Intergenic
959868576 3:111300352-111300374 AAGGAGAGCACAGTGATTGTGGG - Intronic
960298188 3:115968999-115969021 AAGGTGAGCTCAGTGATTGTAGG - Intronic
960404029 3:117238062-117238084 AGGGACAGCACAGTGATTGTGGG + Intergenic
960677098 3:120205669-120205691 GTGGAGAGCTCACTGCCTGGTGG - Intronic
961964544 3:130888635-130888657 AGGGAGAGTGCAGTGGCTAGTGG - Intronic
962273490 3:133995356-133995378 GTGGGGAGCTCAGTGACAGGGGG - Intronic
962370590 3:134817883-134817905 GGGGAAAGCGCAATGACTGGCGG + Intronic
962714805 3:138116662-138116684 AAGGAGAGCTCTGCGCCTGGTGG + Intergenic
962812531 3:138971996-138972018 TGGCAGAGGTCAGTGACTGGAGG - Intergenic
962997976 3:140650720-140650742 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
963154023 3:142077043-142077065 AGGGAGAGCTCAGTGACTGTGGG + Intronic
963412453 3:144947920-144947942 AGGGAGGGCTCTGTGAATGCGGG - Intergenic
963528851 3:146447985-146448007 AGGGAGAACACAGTGATTGTGGG - Intronic
963820502 3:149887170-149887192 AGCGAGAGCACAGTGACTAGAGG + Intronic
964259037 3:154812391-154812413 AGGGAGAGCACAGTGATTGTGGG - Intergenic
964290063 3:155168510-155168532 ATGGAGACCTCGTTGACTGGTGG + Exonic
965027096 3:163316168-163316190 AGTGAGAGCAAAGTGATTGGAGG - Intergenic
965256984 3:166425751-166425773 AAGGAGAGCACAGTGACAGTGGG + Intergenic
965415299 3:168385161-168385183 AGGGAGAGCGCACTGAATGGGGG - Intergenic
965535362 3:169818169-169818191 AGGGAGAGGAAAGTGACTGTGGG - Intergenic
967125977 3:186425079-186425101 AGGCAGAGCTCAGTCTTTGGTGG + Intergenic
967697061 3:192544177-192544199 AGGGAGAGCACAGTGATTGTGGG - Intronic
968788726 4:2644221-2644243 AGGGAGAGCAAAGTGGGTGGGGG - Intronic
970028253 4:11647552-11647574 TGGAAGAGCTTAGGGACTGGTGG - Intergenic
970442356 4:16092789-16092811 AGAGAGAGCACAGTGGCTGGGGG + Intergenic
971946650 4:33287270-33287292 AGGGAGGGCTCAGTGTGAGGTGG - Intergenic
971946658 4:33287311-33287333 AGGGAGGGCTCAGTGTGAGGTGG - Intergenic
972253678 4:37331879-37331901 AGGGAGAGTACAGTGATTGTGGG + Intronic
972271200 4:37512035-37512057 AGGGAGAGCACAGTGATTGTGGG - Intronic
972278568 4:37582066-37582088 AGGGAGAGTACAGTGATTTGGGG - Intronic
972928330 4:44040054-44040076 AGGAAGAGCATAGTGACTGGGGG + Intergenic
973227407 4:47802003-47802025 AGGGAGAGCACAGCAACTGGGGG + Intronic
973287945 4:48440428-48440450 AGGGAGAGCACAGTGACTGTGGG - Intergenic
973763206 4:54139672-54139694 AGGGAGAGCACAGCAACCGGGGG + Intronic
975295139 4:72726123-72726145 AGGGAGAGCACAGTGATTGTGGG + Intergenic
975629561 4:76386777-76386799 AGGGAGAGCACAGCAACTGGGGG + Intronic
975823828 4:78299217-78299239 AAGGAGAGCTCAGTTTGTGGGGG + Intronic
977325803 4:95573082-95573104 AAGGAAAGTGCAGTGACTGGAGG - Intergenic
978478245 4:109157137-109157159 AGGAAGAGCACAGTGACTGAAGG + Intronic
978654252 4:111048211-111048233 AGGGAGAGCACAGTGATTGTGGG + Intergenic
978934726 4:114360283-114360305 AGGGAGAGCACAGAGACTGCCGG - Intergenic
979213391 4:118133372-118133394 AGGGAGAGCACAGTGACAGGGGG - Intronic
979945725 4:126829535-126829557 AGGGAAAGCACAGTGATTGCGGG + Intergenic
980091556 4:128448124-128448146 AGGAAAGGCTCAGTGAATGGTGG + Intergenic
980442487 4:132867115-132867137 AGGGAGAACACAGCAACTGGAGG + Intergenic
980750010 4:137076593-137076615 CCGGAAAGCTCAGTGGCTGGTGG + Intergenic
980895550 4:138856301-138856323 AGGGAGTGCTCTGTGTATGGTGG - Intergenic
980956505 4:139434025-139434047 AGGGAGATCGCAGTGATTGTGGG - Intergenic
981140122 4:141258677-141258699 AGGGAGAACACAGTGATTGTGGG + Intergenic
981871197 4:149487737-149487759 AAGGAGAGTGCAGTGACTAGGGG - Intergenic
982170762 4:152659666-152659688 AGGCAGAGATCAGTAAGTGGTGG - Intronic
982683486 4:158459943-158459965 AAGGAGAGTGCAGTGGCTGGGGG - Intronic
982817657 4:159906741-159906763 AGTGAGAGCACAGTGACTGTAGG + Intergenic
982899626 4:160981601-160981623 AGGCAGAGCACAGAGACTGGGGG - Intergenic
983338182 4:166422024-166422046 AGGGAGAGCACAGTGACTGTGGG - Intergenic
983417627 4:167479369-167479391 AGGGAGAGCAAAGTGACTGTGGG + Intergenic
983657851 4:170101030-170101052 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
985529394 5:424919-424941 AGGGGGACCACAGTGCCTGGAGG - Intronic
986085203 5:4437945-4437967 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
986631304 5:9776246-9776268 AGGGAGAGTGCAGTGACTACAGG - Intergenic
986677052 5:10195156-10195178 AAGCACAGCTCAGTGATTGGTGG + Intergenic
987616003 5:20275877-20275899 AGGGAGAGTGCAGTGATTTGGGG + Intronic
987640109 5:20601673-20601695 AGGGTGAGCCCTGTGACTGCCGG + Intergenic
987645777 5:20671244-20671266 AGGGAGAGTGAAGTGACTGTGGG + Intergenic
989987450 5:50717858-50717880 AGGGAGAGAGAAGTGACTGATGG + Intronic
990827817 5:59922044-59922066 AGGGAGAGTGCAGCGACTGGGGG + Intronic
991209249 5:64085212-64085234 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
992255280 5:74914878-74914900 AGACAGAGGTCAGTCACTGGAGG + Intergenic
992934418 5:81687191-81687213 AGGGAGAGCACAGTGACTGTGGG + Intronic
993279264 5:85904750-85904772 AGGGAAAGTGCAGTGACTGAGGG + Intergenic
993287454 5:86017133-86017155 ATGGAGAGTACAGTGACTGGAGG - Intergenic
993932315 5:93954957-93954979 AGGGAGAGCACAGTGACTGTGGG - Intronic
994330501 5:98499902-98499924 AGTGAGAGCAAAGTGACTGGTGG - Intergenic
995195502 5:109362644-109362666 AGGAAGAGGTCACTGACTGGAGG + Intronic
995265185 5:110151839-110151861 AGGCAGAGCACAGTGACTGGGGG + Intergenic
995290372 5:110444374-110444396 AGGGAGAGCTCAGTGACTGGGGG - Intronic
995310695 5:110707348-110707370 AGGGAGAGTGCAGTAACTGCAGG + Intronic
996459424 5:123724728-123724750 AGGGAGAGTGCAGCGACCGGGGG + Intergenic
996653715 5:125913992-125914014 AGGAAGAGCTCAGTGATTGTGGG - Intergenic
997437824 5:133887703-133887725 AGGGACAGTCCAGTGACTGTGGG + Intergenic
998529519 5:142871847-142871869 AGGGAGAGATCGGAGACTGTTGG + Intronic
998633920 5:143931481-143931503 AGGGAGAGCACAGAGACTGGAGG + Intergenic
998785391 5:145703346-145703368 AGGGAGAGCTAAGAGACAGAAGG - Intronic
999207763 5:149862370-149862392 AGTGAGACCTCTGTCACTGGTGG + Intronic
999559448 5:152785117-152785139 AGGGAGAGTGCACTGACTGTGGG + Intergenic
1000347613 5:160327991-160328013 ATTGAGAGCTGAGTGACAGGAGG + Intronic
1002064419 5:176644959-176644981 GGGGGGAGCTGAGTGGCTGGGGG + Intronic
1002094855 5:176824740-176824762 AGGGAGTGCACAGGCACTGGGGG - Intronic
1003007007 6:2391721-2391743 AGTGAGTGCTCAGTGACTGTGGG + Intergenic
1003357342 6:5386119-5386141 AGGGAGAGCTCTATTCCTGGGGG + Intronic
1004332820 6:14737115-14737137 AGGGAGATCCCGGTCACTGGGGG + Intergenic
1004385577 6:15170000-15170022 AGGGAGTGCTCGTTGACTGAAGG - Intergenic
1004670804 6:17794772-17794794 AGTAAGTGCTCAGTGAATGGTGG - Intronic
1006418847 6:33920993-33921015 ATGAAGAGCTCAGTGAAAGGAGG + Intergenic
1006582747 6:35086216-35086238 AGGGATGGCGCAGTTACTGGGGG - Intronic
1007375287 6:41452158-41452180 AGGGGCTGCTCAGTGAATGGTGG - Intergenic
1007816538 6:44529159-44529181 AGGGAAGGCTCAGTTACTGATGG - Intergenic
1008101147 6:47392495-47392517 AGGGAGACAACAGTGACTGTGGG - Intergenic
1008707661 6:54182318-54182340 AGGAAGAGCACAGCAACTGGGGG - Intronic
1008940396 6:57040183-57040205 AGGGAAAGCACAGCAACTGGAGG + Intergenic
1009728137 6:67560547-67560569 AGGGAGAGCAAAGTGATTGTGGG - Intergenic
1009781674 6:68279682-68279704 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1009823750 6:68839901-68839923 AGGGAGAGCACAGTGATTGTGGG + Intronic
1009978786 6:70701664-70701686 AGGGAGAACGCAGTGATTGTGGG - Intronic
1010062272 6:71636478-71636500 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1010259286 6:73796564-73796586 AGGGGGAGCTCTGTGACAGTGGG + Intronic
1012059769 6:94463420-94463442 AAGGAAAGCTCAGTGATTGTGGG - Intergenic
1012073796 6:94657774-94657796 AGGGAGAAAGCAGTGACTGATGG - Intergenic
1015460595 6:133487086-133487108 AGGGAGAGCTCAGTGAGTGTAGG + Intronic
1015578934 6:134702470-134702492 AGAGAGAGTGCAGTGACTGTGGG - Intergenic
1016054843 6:139567520-139567542 AGGAAGAGCACAGTGATTGTGGG - Intergenic
1016457463 6:144245762-144245784 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1017751245 6:157492208-157492230 AGGGAGACTACAGTGGCTGGGGG - Intronic
1017924847 6:158901826-158901848 AGGGAGAGCACAGCAACTAGGGG - Intronic
1018349701 6:162943666-162943688 ACGGCGAGCTCAGGCACTGGAGG - Intronic
1018529238 6:164745186-164745208 CGGGAGTGCTCAGTGGGTGGGGG - Intergenic
1019206958 6:170369792-170369814 CAGGAGAGCTCAGTTACTTGGGG + Intronic
1019354225 7:570532-570554 AGGGAGGGCTCGGGGACTGCTGG - Intronic
1019813584 7:3183033-3183055 ACAAAGAGCTCAGTGAATGGAGG + Intergenic
1020045337 7:5036369-5036391 ATGGAGAGCTCACCCACTGGGGG + Intronic
1020624195 7:10557901-10557923 AGGGAAAGCACAGCAACTGGGGG + Intergenic
1021214740 7:17901609-17901631 AGGGAGAGCACAGTGATTATGGG - Intronic
1021697388 7:23287885-23287907 AGAGAGAGCCCCGAGACTGGAGG - Intergenic
1021842547 7:24732628-24732650 AGGGAGAGCACAGCAACTGTGGG + Intronic
1021922978 7:25505713-25505735 AGGGACAGCACAATGACTGTAGG + Intergenic
1022542094 7:31146833-31146855 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1022653323 7:32296972-32296994 ACGGAGAACTCAGGGACTGGAGG + Intronic
1022749992 7:33214290-33214312 AGGGACAGCACAGTGACTTGAGG - Intronic
1023352294 7:39332844-39332866 ATGGAGAGCTCAGTGTTTTGGGG + Intronic
1024369222 7:48560323-48560345 AGGAAGAGCACAGTGACTGGGGG - Intronic
1024609798 7:51054682-51054704 AGGGAGAGCTGAGATGCTGGGGG - Intronic
1024628447 7:51228329-51228351 AGGTAGCACTCAATGACTGGTGG + Intronic
1024705956 7:51959785-51959807 AGGAAGAATGCAGTGACTGGGGG - Intergenic
1024956469 7:54926456-54926478 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1025005229 7:55348824-55348846 AGACAGAGCTCAGTGACTCCAGG + Intergenic
1026586762 7:71661783-71661805 AGGGAGAGCTGAGGGACTTTGGG + Intronic
1026725971 7:72870198-72870220 ATGGAGAGCTCACCCACTGGGGG + Intergenic
1027523955 7:79244451-79244473 AGGGAGAGTGCAGTGATTGTGGG + Intronic
1027826101 7:83118544-83118566 AGGGAGAGCAAAGTGATTGTAGG + Intronic
1028868178 7:95737092-95737114 AAGGAGAACCCAGTGACTGTGGG - Intergenic
1029042610 7:97593395-97593417 AGGGAGAGTGCAGTGGCTGTGGG - Intergenic
1029419126 7:100463302-100463324 AGGGAGGGGTGAGTCACTGGGGG + Intronic
1029719617 7:102354588-102354610 GTGGAGAGCTCAGCTACTGGGGG + Intergenic
1029752999 7:102554670-102554692 GTGGAGAGCTCAGCCACTGGGGG - Intronic
1029770949 7:102653762-102653784 GTGGAGAGCTCAGCCACTGGGGG - Intronic
1030107246 7:105997468-105997490 AAGGAGAGCTCAGTGCCTTTGGG + Intronic
1030662620 7:112238247-112238269 AGGGAGAGCGCAGTAATTGTGGG + Intronic
1031215328 7:118883095-118883117 AGGGAGAGCACAGTGATCGGGGG + Intergenic
1031243857 7:119281647-119281669 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1031721809 7:125186645-125186667 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1031746638 7:125506473-125506495 AGGGAGAACACAGCAACTGGAGG - Intergenic
1031862198 7:126993674-126993696 AGGGAGAGCACAGTGACTGGGGG + Intronic
1031991055 7:128199483-128199505 AGGGAGATCTCAGTTACTGCTGG + Intergenic
1032939028 7:136767577-136767599 AGAGAGAGCACAGCAACTGGGGG + Intergenic
1033542474 7:142369605-142369627 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1033641086 7:143263710-143263732 AGGGAGAGCTCCGGGGCTGAAGG + Intronic
1033877773 7:145843225-145843247 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1034126286 7:148674826-148674848 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1034847914 7:154464261-154464283 AGGGAGAATGCAGTGACTGTGGG - Intronic
1035300739 7:157895915-157895937 AGGGTGAGCACAGAGACTGCAGG + Intronic
1035705362 8:1670564-1670586 AGGGAGTGCTCAGTAAATGTTGG + Intronic
1035893533 8:3372301-3372323 AAGGACACCTCTGTGACTGGGGG + Intronic
1036637481 8:10561686-10561708 TGGCTGAGCTCTGTGACTGGGGG + Intergenic
1037981602 8:23258323-23258345 TGAGAGACCTCAGTGCCTGGAGG - Exonic
1038075327 8:24066779-24066801 AGGGGCAGCTCAGTGAATGACGG - Intergenic
1039211605 8:35222202-35222224 AGGGAGAGCACAGTGAATAAAGG - Intergenic
1039297673 8:36174480-36174502 AGGGAGAGCTCCGGGTCTGGAGG - Intergenic
1039865575 8:41498574-41498596 AGTGAGACCTAAGGGACTGGTGG - Intronic
1040795375 8:51284881-51284903 AGGGAGAGGTCAGGGTATGGAGG - Intergenic
1041187657 8:55317662-55317684 ATGGAGGGCTCAGTATCTGGAGG + Intronic
1041580013 8:59447673-59447695 AGGGAGAGCACAGCAACTGGGGG - Intergenic
1041600441 8:59711387-59711409 AGGGAGAGCTCAAGATCTGGTGG - Intergenic
1041744881 8:61197878-61197900 AGGGAGAGAACAGTGACTATAGG - Intronic
1042162520 8:65911820-65911842 AGGGAGTGCACAATGACTAGAGG + Intergenic
1042947571 8:74170484-74170506 AGGGATAGCGCAGTCTCTGGAGG + Intergenic
1043079972 8:75754838-75754860 AGGGAGAGTGCAGTGACTATGGG + Intergenic
1043381054 8:79702597-79702619 AGGAATAACTCTGTGACTGGAGG + Intergenic
1043432033 8:80204581-80204603 AGGAAGAGCTCAAAGACTGAAGG + Intronic
1044497327 8:92902383-92902405 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1044635550 8:94320205-94320227 AGGGAGAGCACAGTGATTGCAGG - Intergenic
1044836173 8:96297712-96297734 AGGTGGAGCACAGTTACTGGAGG - Intronic
1045554858 8:103206323-103206345 AGGGAGAGCTCAGGGAACTGAGG - Intronic
1045592599 8:103614341-103614363 AGGGAGAGCATAGTGACTGGGGG - Intronic
1046691889 8:117295106-117295128 AGTGAGGGCTCAGTGAGTGTTGG + Intergenic
1046811542 8:118538558-118538580 AGGGAGAGCACAGTGATTGTGGG - Intronic
1048118673 8:131554819-131554841 AGGGAGAGCACAGTGACTGTGGG + Intergenic
1048507613 8:135035140-135035162 GGGGAGAACTCAGTGGGTGGGGG + Intergenic
1048840122 8:138558152-138558174 GGGGAGAGCCAGGTGACTGGGGG + Intergenic
1049025754 8:139987814-139987836 AGGTGGAGCTCAGTGACTCCGGG - Intronic
1049273480 8:141708218-141708240 AGGCAGAGCTCCTTAACTGGAGG + Intergenic
1049444829 8:142625073-142625095 GGGCCGAGCTCAGTGTCTGGGGG - Intergenic
1049454156 8:142678541-142678563 GGGGAGAGCACAGTGACCAGAGG + Intronic
1049473977 8:142788403-142788425 AGGCAGAGCTCAGGGCTTGGTGG + Intergenic
1049580115 8:143407267-143407289 AAGGAGAGCTCAGTGGCTGGTGG + Intergenic
1049727021 8:144151771-144151793 AGGGGGAGCACAGAGACGGGAGG - Intronic
1049796228 8:144498436-144498458 AGGAAGAGCTCCCTGCCTGGAGG - Intronic
1049843582 8:144789118-144789140 GGGGAGTGGTCACTGACTGGAGG - Intergenic
1050248062 9:3713005-3713027 TGGAAGAGTGCAGTGACTGGGGG + Intergenic
1050620799 9:7450062-7450084 AAGGTCAGCCCAGTGACTGGCGG + Intergenic
1051047085 9:12888238-12888260 AGGGAGAGCATAATTACTGGGGG + Intergenic
1051306618 9:15717181-15717203 AGGGAGAGCACAGTGATTGTGGG + Intronic
1051345609 9:16148094-16148116 AGGGAGAGTGCAGTGGGTGGGGG + Intergenic
1051464941 9:17367190-17367212 AGGGAGAATGCAGTGACTGTTGG + Intronic
1052093881 9:24361733-24361755 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1052281790 9:26741621-26741643 AGGCAAAGCTCTGTGGCTGGAGG - Intergenic
1052450602 9:28625284-28625306 AGGGAGAACACAGTGACTTAGGG - Intronic
1053750690 9:41251412-41251434 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054256202 9:62815755-62815777 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054335103 9:63799859-63799881 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1054982462 9:71222757-71222779 AGGCAGAGCACAGTGATTGTGGG + Intronic
1055269247 9:74537928-74537950 AGTGAGAGCTGAGTGAATGAAGG - Intronic
1056230693 9:84539728-84539750 AGGGAGAACACAGTGATTGTGGG - Intergenic
1056775728 9:89511192-89511214 AGAGAGAGCTAAGTGCCTGGAGG - Intergenic
1058285363 9:103170065-103170087 AGGGAGAGGGCAGTGACTGTGGG - Intergenic
1058616238 9:106831014-106831036 AGGGAGAACTCAGTGATTCAGGG - Intergenic
1058820773 9:108727679-108727701 AGGGAAAGCACAGTGATTGCTGG + Intergenic
1059555600 9:115277131-115277153 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1059886566 9:118751080-118751102 AGGGACAGCACAGTGATTGTGGG + Intergenic
1060328587 9:122643303-122643325 AGGGAGAGCACAGCAACTGAGGG + Intergenic
1060885988 9:127152737-127152759 AGGGAAAGCTCTGTGAGGGGCGG + Intronic
1060891642 9:127192994-127193016 AGTCAGAGCTGAGTGACTGGAGG + Intronic
1061233410 9:129328124-129328146 AGGGACAACTCAGTGGCTGTGGG + Intergenic
1061254845 9:129448916-129448938 AGGGAGGGCTCTGAGGCTGGGGG - Intergenic
1061481621 9:130900284-130900306 AGGGCCAGCACAGCGACTGGTGG - Intergenic
1061592226 9:131605056-131605078 AGTCAGAGCTCTGAGACTGGTGG + Intronic
1061638142 9:131928557-131928579 AGGGAGAGCACAGCGACTGGGGG + Intronic
1061783528 9:133009443-133009465 AAGGTGATCTCAGTGTCTGGGGG + Intergenic
1061874216 9:133535858-133535880 GGGGAGAGCTGAGGGCCTGGAGG + Intronic
1061911772 9:133728828-133728850 AGGGAGAGATGAGTGGCTAGAGG + Intronic
1062014057 9:134282481-134282503 GGGGAGAGCCCAGAGTCTGGGGG - Intergenic
1062354315 9:136154512-136154534 TGGGAGAGCGGAGAGACTGGAGG - Intergenic
1062388491 9:136324704-136324726 AGGGAGGGCTAAGTGACCGAGGG + Intergenic
1062537189 9:137026264-137026286 GGGCAGAGCTCAGGGTCTGGAGG - Intronic
1062633567 9:137478337-137478359 AGAGACAGCTCAGCTACTGGGGG + Intronic
1062734578 9:138128194-138128216 TGGGAGCGCTCAGGGACTGGGGG - Intergenic
1203371376 Un_KI270442v1:308829-308851 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1185463366 X:342433-342455 AGGGAGACCTCAGCAACGGGAGG + Intronic
1185463374 X:342460-342482 AGGGAGACCTCAGCAACGGGAGG + Intronic
1185463465 X:342784-342806 AGGGAGACCTCAGCAACGGGAGG + Intronic
1185463473 X:342811-342833 AGGGAGACCTCAGCAACGGGAGG + Intronic
1185463481 X:342838-342860 AGGGAGACCTCAGCAACGGGAGG + Intronic
1185463489 X:342865-342887 AGGGAGACCTCAGCAACGGGAGG + Intronic
1185463497 X:342892-342914 AGGGAGACCTCAGCAACGGGAGG + Intronic
1185463793 X:343919-343941 AGGGAGACCTCAGCAACGGGAGG + Intronic
1185463801 X:343946-343968 AGGGAGACCTCAGCAACGGGAGG + Intronic
1185463809 X:343973-343995 AGGGAGACCTCAGCAACGGGAGG + Intronic
1185463856 X:344135-344157 AGGGAGACCTCAGCAACGGGAGG + Intronic
1185552871 X:997957-997979 AGGGAGAGCTGTGTTACTGGCGG - Intergenic
1186602034 X:11048606-11048628 AGGGAGAGCACAGTGTCTGGGGG - Intergenic
1186725081 X:12349002-12349024 AGGGAGAGCTCCATAAATGGGGG + Intronic
1187280769 X:17857228-17857250 AGGGAGACCTCAGAGAATGAGGG - Intronic
1187579422 X:20592506-20592528 AGGAAGAGCACAGTGACTGGAGG - Intergenic
1187636677 X:21237417-21237439 AGGGAGAACATAGTGACTGTGGG + Intergenic
1188112792 X:26212034-26212056 GGAGAGAACGCAGTGACTGGAGG - Intergenic
1188162001 X:26815412-26815434 AGGGAGAGTGCAGTGATTGTAGG - Intergenic
1188864549 X:35299450-35299472 ACGGAGAGCACAGTGATTGTAGG + Intergenic
1188897346 X:35685821-35685843 AGGGAGATAGCAGTGACTGGGGG + Intergenic
1188972404 X:36633562-36633584 AGGGAGAGCACAGTGATTATGGG - Intergenic
1188974775 X:36659978-36660000 AAGGAGAGCACAGAGACTGGGGG + Intergenic
1189405609 X:40720355-40720377 AGGGAGAGAATAGTGACTGGGGG + Intronic
1189628051 X:42920737-42920759 AGGGAGAGCACAGTGATCGTGGG + Intergenic
1190122597 X:47674549-47674571 AGGGAGAACACAGTGAATGTGGG - Intergenic
1190374467 X:49775451-49775473 AGGGAGAGTGCAGCAACTGGGGG - Intergenic
1190537135 X:51440588-51440610 AGGGACAGCACAGCAACTGGGGG + Intergenic
1191197061 X:57736027-57736049 TGGGAGAGTTTAGTGACTGGGGG + Intergenic
1191224806 X:58031698-58031720 AGAGAGTGCACAGTGACTAGAGG - Intergenic
1192048444 X:67700824-67700846 AGGGAGATCTGAGTCATTGGTGG + Intronic
1192134944 X:68588515-68588537 AGGAAGAACACAGTGACTAGGGG + Intergenic
1192374756 X:70548603-70548625 AGGGAGAGCACAGTGATTGTGGG + Intronic
1192793302 X:74405735-74405757 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1193650158 X:84122235-84122257 AGGGAAAGCTCAGCAACTGGGGG + Intronic
1194196733 X:90903554-90903576 AGAGAGAGCACAGTGACTGGCGG - Intergenic
1194327792 X:92541352-92541374 AGGGAGAGCACAGTGACCTAGGG - Intronic
1194388930 X:93292459-93292481 AGGGAGAATGCAGTGACTGGGGG + Intergenic
1194842077 X:98754821-98754843 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1195290155 X:103424428-103424450 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1195489469 X:105450215-105450237 AGGGCGAGTGCAGTGACTTGGGG - Intronic
1195595331 X:106682705-106682727 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1195601225 X:106751277-106751299 AAGGAGAGCACAGTGATTGTGGG + Intronic
1196182245 X:112704660-112704682 AGGGAGAGCACAGGAACTGAAGG - Intergenic
1196217702 X:113072668-113072690 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1196357470 X:114810559-114810581 AGGGAGAATGCAGTGACTGTGGG - Intronic
1196368742 X:114951974-114951996 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1196384963 X:115139690-115139712 AGGGAGAGCACAGGGACTGGGGG + Intronic
1196485704 X:116204163-116204185 AGGGAGAGTGCAGCAACTGGGGG - Intergenic
1196512190 X:116524591-116524613 AGGGAGAGCACAATGATTGGAGG - Intergenic
1196532642 X:116806793-116806815 AGAGACAGCACAGTGACTGGGGG - Intergenic
1196619479 X:117806333-117806355 CAGGAGAGCACAGTGACTGTGGG + Intergenic
1196762706 X:119213898-119213920 AGGGAGAGGTCAGGGACAGTTGG + Intergenic
1197072826 X:122321355-122321377 AAGGAGAGCACAGCAACTGGGGG + Intergenic
1197078296 X:122379061-122379083 AGGGAGAGCACAGTGACTGAAGG - Intergenic
1197099676 X:122637407-122637429 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1197177965 X:123504780-123504802 AGGGAGAGCACAGTGATTTGGGG + Intergenic
1197375882 X:125681738-125681760 AGTGAGAGTGCAATGACTGGAGG + Intergenic
1197457903 X:126700979-126701001 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1197623650 X:128779835-128779857 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1197670702 X:129273798-129273820 AGGGAAAGCACAGTGATTGTGGG - Intergenic
1197887222 X:131231126-131231148 TGGGAGAGCGGAGTGATTGGAGG + Intergenic
1198283172 X:135162882-135162904 AGGGAGTTCTCAGTGAATGGAGG + Intronic
1198761561 X:140038345-140038367 AGGGAGAGGAAAGTGACTGTGGG + Intergenic
1198761890 X:140040932-140040954 AAGGAGAGCTCAGTGACTAGGGG - Intergenic
1198770683 X:140126903-140126925 AGGGAGAGTGTAGTGACTAGGGG - Intergenic
1199277519 X:145963920-145963942 AGGGACAGCGTAGTGACTGAGGG + Intergenic
1199325091 X:146489933-146489955 AGGGAGAGTACAGTGACTGAGGG + Intergenic
1199431839 X:147770667-147770689 AGAGAGAGTTCAGTGGCTGTGGG + Intergenic
1199457509 X:148045030-148045052 AGGGAGAGCACAGTGGTTGTGGG - Intergenic
1199464453 X:148120315-148120337 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1199795396 X:151191064-151191086 AGGGAGAGCAAAGTGATTGCGGG + Intergenic
1200177207 X:154125533-154125555 AGGGAGGGCACGGTGACTGTGGG + Intergenic
1200370089 X:155715867-155715889 AGGGCAAGCACAGCGACTGGGGG - Intergenic
1200542579 Y:4477755-4477777 AGAGAGAGCACAGTGACTGGCGG - Intergenic
1200636506 Y:5660570-5660592 AGGGAGAGCACAGTGACCTAGGG - Intronic
1201066970 Y:10106251-10106273 AGGGAGGGCACAGTGACTGGAGG + Intergenic
1201760901 Y:17537086-17537108 AGGAAGAGCACAATGACTGAAGG - Intergenic
1201840651 Y:18368904-18368926 AGGAAGAGCACAATGACTGAAGG + Intergenic