ID: 995294419

View in Genome Browser
Species Human (GRCh38)
Location 5:110502672-110502694
Sequence GTGAGTGAGGGGAAAGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1181
Summary {0: 1, 1: 1, 2: 14, 3: 124, 4: 1041}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995294419_995294430 20 Left 995294419 5:110502672-110502694 CCTTCCACTTTCCCCTCACTCAC 0: 1
1: 1
2: 14
3: 124
4: 1041
Right 995294430 5:110502715-110502737 CACGTTTTTAGAACTGCACATGG 0: 1
1: 0
2: 0
3: 5
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995294419 Original CRISPR GTGAGTGAGGGGAAAGTGGA AGG (reversed) Intronic
900581411 1:3411707-3411729 GTGAGTGCGGGGAACGTGGGAGG - Exonic
900914587 1:5627122-5627144 GTGAGGGAAGGGAATGTGGGAGG + Intergenic
900942219 1:5807014-5807036 GTGGGTGGGGGAAAAGCGGAGGG + Intergenic
901203655 1:7481512-7481534 GAGAGTGAGGGAACAGTAGATGG - Intronic
901653067 1:10754190-10754212 GGGAGTGAGAGGCAGGTGGATGG - Intronic
901774665 1:11552074-11552096 GTGAATGAAGGGAAGATGGAAGG + Intergenic
902563361 1:17292892-17292914 GGGAGGGAGGGGAATGGGGAAGG + Intergenic
903347916 1:22699447-22699469 GGGGGTGCGGGGAAAGGGGAGGG + Intergenic
903929860 1:26855963-26855985 CTGAGGCAGGGGAAGGTGGAGGG - Exonic
904024211 1:27492007-27492029 ATGGGTGAGGGAAGAGTGGAGGG - Intergenic
904310800 1:29628326-29628348 GAGAGGGTGGGGAAAGTGGGAGG + Intergenic
904376630 1:30086036-30086058 GAGAGGGAGGGGAATGGGGAGGG - Intergenic
904464962 1:30702159-30702181 ATGAGTGATGGGAAAGTGGAGGG - Intergenic
904581433 1:31546987-31547009 GTGAGTCAGAGGGAAGTGTAAGG + Intergenic
904917531 1:33981082-33981104 GGGAGAGAGGAGAAAGTGCAGGG + Intronic
905135736 1:35798311-35798333 GGGAGTGGGGGGAAAGGGGAGGG - Intergenic
905330847 1:37195648-37195670 AAGAGAGAGGGGAAAGTGGGAGG - Intergenic
905773402 1:40652948-40652970 GTGAGTGAGGGGACAAAGTAGGG + Intronic
906035519 1:42748177-42748199 GTGAGTGCGGGGCAGGTGCAGGG - Intronic
906566736 1:46806267-46806289 GTGAGGGAGGAGAAAGACGAAGG - Intronic
907403661 1:54240876-54240898 GCGCTTGAGGGGAAAGTGGGGGG - Intronic
907470732 1:54671805-54671827 GTGAGTGTGGGGGAGATGGATGG + Intronic
907949551 1:59168974-59168996 GGGGGTGAGGGGAAAGGGGAGGG + Intergenic
907993912 1:59610224-59610246 GGGAGTTAGGGGCAAGGGGAGGG - Intronic
908083769 1:60608722-60608744 GTGAGTTAGGGAAAAGGGCAAGG - Intergenic
908127330 1:61044074-61044096 GACAGTGAGGGGACAGAGGAAGG + Intronic
908257314 1:62313699-62313721 GAGGGTGAGGGGCAAGGGGAGGG + Intronic
908612554 1:65878731-65878753 GGGAGTCGGGGGAAAGGGGAGGG + Intronic
909098796 1:71323748-71323770 GTGGGTGGGGGGCAAGGGGAGGG + Intergenic
909340256 1:74523915-74523937 GGGGGTGGGGGGAAAGGGGAGGG - Intronic
909453381 1:75823617-75823639 GTGGGTGGAGGGAAAGGGGAGGG - Intronic
909492645 1:76242596-76242618 CAGGGTGAGGGGAAAGGGGAGGG - Intronic
909808578 1:79903426-79903448 GAGAGTGAACGAAAAGTGGACGG - Intergenic
909958183 1:81802768-81802790 GCGAGTTCGGGGGAAGTGGACGG + Intronic
910863856 1:91769446-91769468 GAGAGTGGGGGCAAAGGGGAAGG - Intronic
911072171 1:93840963-93840985 GGGAGTGGGAGGAAAGTGGGGGG - Intronic
911613288 1:99980330-99980352 GAGAGTGTGGGGAAATGGGAGGG + Intronic
912129085 1:106579243-106579265 GAGACTGAGGGGAAAGGGTAGGG - Intergenic
912212739 1:107572389-107572411 GTGTGTGCGGGGGAGGTGGATGG + Exonic
912227825 1:107755388-107755410 GGGGGTGAGGGGAAGCTGGATGG + Intronic
912283927 1:108348058-108348080 GGGGGTTGGGGGAAAGTGGAAGG - Intergenic
912309964 1:108610286-108610308 GTGGGTGAGAGGAGAGTGGTTGG + Intronic
912611273 1:111047453-111047475 GGGGGTGAGGGGCTAGTGGAGGG - Intergenic
913105936 1:115613958-115613980 GTGAGTGAGTGGGGAGTGGTAGG - Intergenic
913206696 1:116545518-116545540 ATGAGGGTGGGGGAAGTGGATGG + Intronic
913425773 1:118727403-118727425 GGGTGTGTGGGGAAAGGGGAGGG + Intergenic
913561709 1:120027617-120027639 GGGGGTGGGGGGAAAGGGGAGGG - Intronic
914282297 1:146187019-146187041 GGGGGTGGGGGGAAAGGGGAGGG - Intronic
914543322 1:148637733-148637755 GGGGGTGGGGGGAAAGGGGAGGG - Intronic
914623299 1:149433279-149433301 GGGGGTGGGGGGAAAGGGGAGGG + Intergenic
914776211 1:150737966-150737988 GTGAGAGAGGGGAGAGTAGTTGG + Intronic
915566308 1:156715256-156715278 CTGAGTGAGGGGAAAGCCAATGG - Intergenic
916027763 1:160849442-160849464 GTGGGTGAGGGGCAAGGGGAGGG - Intronic
916046679 1:161005282-161005304 GGGAGGGAGGGGAAGGAGGAAGG - Intronic
916863975 1:168836748-168836770 GAGAGGGAGGGGAAGGGGGAGGG - Intergenic
917768031 1:178244717-178244739 GGGGATGAGGGGAAAGGGGAAGG - Intronic
918124835 1:181574129-181574151 GTAAGTGTGGGGAGAGGGGAAGG + Intronic
918144069 1:181740514-181740536 GTGGGGGTGGGGATAGTGGAGGG + Intronic
918833977 1:189435520-189435542 GTGGGAGAGGGGGAAGGGGAAGG + Intergenic
919061614 1:192641353-192641375 GAGAGAGAGGGGAAAAGGGAGGG + Intronic
919214943 1:194541199-194541221 GGGAGTGGGGGGCAAGGGGAGGG - Intergenic
919598202 1:199590642-199590664 GGGAGTAAGGGGAGAGTGGTAGG + Intergenic
919733715 1:200931001-200931023 GTGAGGGAGAGGAAAGAGCAAGG - Intergenic
919758754 1:201083323-201083345 CTGAGGGAGGGGACAGAGGATGG + Intronic
919833210 1:201556485-201556507 GACAGTGGGGGGACAGTGGAGGG + Intergenic
919894234 1:201998816-201998838 ATGACTGAGGGAACAGTGGAGGG - Intronic
920536072 1:206737339-206737361 GTGAGGCTGGGGAAAGTGGCTGG + Intergenic
920558010 1:206918357-206918379 GCGAGTGAGGGGAGAGAGGGAGG - Intronic
920748009 1:208647202-208647224 GAGAGGGAGGGGGAAGGGGAAGG - Intergenic
920843509 1:209574798-209574820 GGGAGAGAAGGGAAAGAGGAAGG - Intergenic
921264397 1:213410459-213410481 TCCAGTGAGGGGAAAGTGGTAGG + Intergenic
923002144 1:230015718-230015740 GTGAGTGAGTGGTGAGTGAATGG - Intergenic
923012168 1:230096486-230096508 GGGAGAGAGGGGAAAGGGGAAGG - Intronic
923660971 1:235957068-235957090 CTTAGGGAGGGGACAGTGGAGGG - Intergenic
923664709 1:235989895-235989917 GTAAGTGAGGTGAGAGTGGTAGG + Intronic
923821446 1:237447832-237447854 GGGAGGGAGGGGAAAGAGGGAGG - Intronic
923890238 1:238206915-238206937 GGGGGTGGGGGGAAAGGGGATGG + Intergenic
924017232 1:239740610-239740632 GGGGGTGAGGGGCAAGGGGAGGG - Intronic
924078286 1:240363940-240363962 GTGCTTTAGGGGAAAGTGGGGGG + Intronic
924806110 1:247363186-247363208 GTGAGAGAGGGGAGAGGAGAAGG - Intergenic
924806117 1:247363214-247363236 GTGAGAGAGGGGAGAGGAGAAGG - Intergenic
924806140 1:247363300-247363322 GTGAGAGAGGGGAGAGGAGAAGG - Intergenic
1063288192 10:4712734-4712756 GTTTGTGAGGGCACAGTGGAGGG - Intergenic
1063304660 10:4886235-4886257 GTGAGTGAGTGGACAGTGCAGGG - Intergenic
1063427949 10:5964540-5964562 GTGAGTGATCAGAACGTGGAAGG + Intronic
1063589103 10:7378607-7378629 GTGAGTGTGGGTTGAGTGGATGG + Intronic
1063708371 10:8453183-8453205 CTAAGTGAGGTTAAAGTGGAAGG - Intergenic
1063836098 10:10014709-10014731 GTGAGTGAGTGGTGAGTGAATGG - Intergenic
1063957959 10:11283496-11283518 GTGAGTGGGTGGATAATGGATGG + Intronic
1063987052 10:11515752-11515774 ATGAGTGAGGACAAAGTTGATGG + Intronic
1064462954 10:15552675-15552697 GGGGGTGAGGGGATAGGGGAGGG - Intronic
1064587358 10:16852127-16852149 GTGAGGGAGGGAAAGATGGAGGG - Intronic
1064587430 10:16852399-16852421 GTGAGGGAGGGAAAGATGGAGGG - Intronic
1064600753 10:16990057-16990079 GTGAGTGAAGGAAAGGAGGAGGG - Intronic
1064799432 10:19052215-19052237 TTGAATGGGGGGAAAGGGGAAGG - Intronic
1064920494 10:20512058-20512080 GTGAGTGAGTGGTGAGTGAATGG - Intergenic
1065421778 10:25552734-25552756 GTGAGTCAGGGGAATATGAATGG - Intronic
1065530090 10:26660578-26660600 GTAAGGTAGGGGAAAGTGCAAGG + Intergenic
1065696828 10:28388114-28388136 GGAAGGGAGGGGAAGGTGGAAGG + Intergenic
1066271698 10:33830302-33830324 GGGGGTCAGGGGAAAGGGGAAGG + Intergenic
1066594833 10:37038893-37038915 GTGGGGTAGGGGAAAGGGGAAGG - Intergenic
1067390338 10:45857556-45857578 GTTAGTGAGGGGATGGTGTAGGG + Intergenic
1067501135 10:46806310-46806332 GTTAGTGAGGGGATGGTGTAGGG - Intergenic
1067593445 10:47533605-47533627 GTTAGTGAGGGGATGGTGTAGGG + Intronic
1067640554 10:48041709-48041731 GTTAGTGAGGGGATGGTGTAGGG + Intergenic
1067807889 10:49405837-49405859 GGGAGGGAAGGGAAAGAGGAAGG - Intergenic
1068173010 10:53421046-53421068 GTGGGTGAGGGGCAAGGGGAGGG - Intergenic
1068847220 10:61691634-61691656 GGGAGTGGGGGGCAAGGGGAGGG - Intronic
1068950539 10:62772533-62772555 GTGCTTCGGGGGAAAGTGGAGGG + Intergenic
1069058724 10:63871677-63871699 AAGAGTGAGAGGAAAGAGGATGG + Intergenic
1069093126 10:64226426-64226448 GGGAGTGGGGGGAAAGGGAAGGG - Intergenic
1069120262 10:64561297-64561319 GTGGGTGAGAGGAAAGGTGAGGG - Intergenic
1069224748 10:65929017-65929039 GTGGGTGAGGGGAGGGGGGAGGG - Intronic
1070016448 10:72537271-72537293 TGGAGTGTGGGGAATGTGGATGG + Intronic
1070675088 10:78406736-78406758 GTGAGGCCGGGGAAACTGGATGG + Intergenic
1070816224 10:79325195-79325217 GTGAGTGAGTGGAAAGGTGGAGG + Intergenic
1070891359 10:79944166-79944188 GTGAGTGAATGGAAGCTGGAAGG - Intronic
1070984037 10:80672859-80672881 GTGAGTGAGGGGGATGTGGATGG + Intergenic
1070991661 10:80738855-80738877 GGGAGAGAGGGGAAAGGGGGAGG - Intergenic
1070992860 10:80747747-80747769 GGGAGAGAGGGGAAAGGGGAAGG - Intergenic
1071190715 10:83096320-83096342 GTGGGTGGGAGGAAAGGGGAGGG - Intergenic
1071499447 10:86193105-86193127 GGGAATGAGGAGAGAGTGGAGGG - Intronic
1071541111 10:86485058-86485080 GTGAGTGGGGGGAGATGGGAGGG - Intronic
1071568037 10:86681559-86681581 GCGAGTGAGGAGAAGGCGGAGGG - Exonic
1071591942 10:86883122-86883144 GTGGGTGAGGGAGAAGTGCATGG - Intronic
1071946653 10:90653485-90653507 GTGTGTGAGGGGAAGCTGCAAGG - Intergenic
1072211947 10:93254246-93254268 GGGAGGGAGGGGAGAATGGAGGG + Intergenic
1072256030 10:93621135-93621157 GTGTGTGTGGGGAGAGTGGCGGG - Intronic
1072497457 10:95976248-95976270 ATGGGTGAGCAGAAAGTGGAGGG - Intronic
1072611362 10:97019460-97019482 GGGCATGAGGGGAAAGAGGAAGG - Intronic
1072802781 10:98404992-98405014 GTGAGGGAGGGGAGGGAGGATGG + Intronic
1072946475 10:99815087-99815109 GGGAGTGAGGGGCGAGGGGAGGG - Intronic
1073104955 10:101027257-101027279 GTGAGGGAGGGGAGGGTGGAGGG - Intronic
1073442100 10:103558249-103558271 GTGAGTGAGGGGAGGGTGACAGG + Intronic
1073943907 10:108729753-108729775 GGGAGGGAGGTGGAAGTGGAGGG + Intergenic
1073966867 10:109000486-109000508 AGGAGTGGGGGGAAAGGGGAGGG - Intergenic
1074189194 10:111121478-111121500 GTAAGGGAGGGGAATGTAGAGGG + Intergenic
1074447891 10:113535245-113535267 GTGAGTGAGGGACAAGGGGAGGG - Intergenic
1074627721 10:115211753-115211775 GTGGGTGAGGGGAGGGGGGAGGG - Intronic
1074660797 10:115655015-115655037 GTGAAAGAGGGAAAAGAGGAGGG + Intronic
1074710418 10:116172685-116172707 ATGTGTAAGTGGAAAGTGGAGGG + Intronic
1074888618 10:117715808-117715830 GGGGGTGAGGGGCAAGGGGAGGG + Intergenic
1075163540 10:120045438-120045460 GTGAGTGAGTGGTGAGTGAATGG + Intergenic
1075251128 10:120874956-120874978 GGGATTGAGGGGCAAGGGGAGGG - Intronic
1075355895 10:121775315-121775337 GAGAGTGGGGGGCAAGGGGAGGG + Intronic
1075954925 10:126515313-126515335 GTGAGTGAGTGGTGAGTGAATGG - Intronic
1076027526 10:127128531-127128553 GGGAGTGGGGGGCAAATGGAGGG - Intronic
1076451235 10:130558265-130558287 GTGAGTTGGGGGACAGGGGAGGG + Intergenic
1076809492 10:132879165-132879187 GGGAGTGCTGGGAATGTGGAGGG + Intronic
1077177732 11:1198211-1198233 GAGGGTGAGGGGAGAGTGGGCGG + Intronic
1077291243 11:1795320-1795342 GTGAGAGAGGGGAGCGTGCAGGG - Intergenic
1077357649 11:2126143-2126165 GTGAGTGAGAGTTAAGTGGGTGG + Intergenic
1077357811 11:2126851-2126873 GTGAGTGAGTGGTAAGTGGGTGG + Intergenic
1077392799 11:2307787-2307809 GAGAGAGAGGGGACAGTGGTTGG + Intronic
1077533146 11:3106663-3106685 GTGAGTGACGGGAGGGAGGATGG - Intronic
1077721391 11:4632954-4632976 GTGGGCGAGGGGCAAGGGGAGGG + Intergenic
1078146240 11:8723478-8723500 TTGAGAGAAGGGAAAGAGGAGGG + Intronic
1078323166 11:10355217-10355239 GTGAATGAGGGGGATGTGGTTGG - Intronic
1078335488 11:10459787-10459809 GTGGGTGAGGGGACAGAGGCAGG + Intronic
1078401246 11:11029268-11029290 GTGACTCAGAGGAAAGTGGAGGG + Intergenic
1078803881 11:14676547-14676569 GTGAGTGAGAGGTGAGTGAATGG + Intronic
1079670446 11:23163252-23163274 GGGGTTGAGGGGCAAGTGGAAGG + Intergenic
1079798206 11:24834236-24834258 GGGGGTGAGGGGCAAGGGGAGGG - Intronic
1080144825 11:28968693-28968715 AAGAGTGAGGGGAAACAGGAAGG + Intergenic
1080407126 11:31989058-31989080 GAAAGTGAAGGGGAAGTGGAGGG + Intronic
1080587836 11:33697479-33697501 AGGAGTGAGGGGAGAGTGGTAGG - Intergenic
1080767036 11:35306677-35306699 GTGAGTGGGGGGAAAGGGGAAGG - Intronic
1080824281 11:35834865-35834887 GTGAGCAGGGGGAAGGTGGAGGG - Intergenic
1081020224 11:37937222-37937244 GTGGGTGAGGGGCTAGGGGAGGG - Intergenic
1081035138 11:38134591-38134613 GGGATTGTGGGGAAAGGGGAGGG + Intergenic
1081385147 11:42463327-42463349 GGGAGGGAGGGGAAGGTGGAAGG + Intergenic
1081497700 11:43632005-43632027 GTGAGGGAGGGGGAGGAGGAGGG + Intronic
1081623763 11:44634722-44634744 GGGAGGGAGGGGAAGGAGGAGGG - Intergenic
1081675457 11:44966167-44966189 GAGAGTGAGGGCAGAGTGGCTGG - Intergenic
1081745935 11:45472422-45472444 CTGGGAGAGGGGAAAATGGAGGG + Intergenic
1081778740 11:45695157-45695179 GGGAGAGAGGGGAAAGGGGAAGG + Intergenic
1081915996 11:46730532-46730554 GTGGGTGAGGGGAGAGAGGGGGG + Intronic
1082285659 11:50315472-50315494 GTGAATGAGCTGAATGTGGAAGG + Intergenic
1083048986 11:59760183-59760205 GTGAGTGTGGGGGAAGTCGGGGG + Intronic
1083328191 11:61884309-61884331 GCGGGTGAGGGGCAAGGGGAGGG + Intronic
1083761106 11:64818220-64818242 GTGAGTGTGAGGACAGGGGATGG + Intergenic
1084317400 11:68353573-68353595 CTGAGAGTGGGGACAGTGGAGGG + Intronic
1084389514 11:68865893-68865915 AGGAGGGAGGGGAAAGGGGAGGG - Intergenic
1084502029 11:69540553-69540575 GGAAGTAAGGAGAAAGTGGAGGG - Intergenic
1085219154 11:74859009-74859031 CTCAGGGTGGGGAAAGTGGAAGG - Intronic
1085463105 11:76706989-76707011 GTCAGTGAGGGGAAAATGTGAGG - Intergenic
1085498527 11:76995177-76995199 GTGAAGGAGGGGCAAGTGGAAGG - Intronic
1085540719 11:77266985-77267007 GTGAGTGAGTGGTAAGTGAATGG - Intronic
1085555413 11:77415696-77415718 GTGAGTGAGAGGTAAGTGAATGG + Intronic
1085619956 11:78030605-78030627 GTGAGTGAGGGGAGGGCAGAAGG - Intronic
1085871402 11:80354416-80354438 GTGAGTGAGTGGTGAGTGAATGG + Intergenic
1085875275 11:80399663-80399685 CTGACTGAGGGAAATGTGGAGGG + Intergenic
1086074858 11:82839738-82839760 GTGAGAAAGGGCAAAGGGGAAGG - Intronic
1086564258 11:88207163-88207185 GTTATTGAGGACAAAGTGGAAGG - Intergenic
1086734078 11:90283872-90283894 GTGGGTGAGGGGATGGAGGAAGG + Intergenic
1087027437 11:93663354-93663376 GTGTGTGAGGGAAAATGGGAGGG - Intronic
1087471457 11:98580840-98580862 GGGAGGGAGGGGAAAGAGGGAGG + Intergenic
1087588959 11:100160062-100160084 GTGGGTGAGGGGCTAGGGGAGGG - Intronic
1088171273 11:106999937-106999959 GCGGGTGAGGGAAAAATGGAAGG - Intronic
1088698521 11:112391012-112391034 GAGAGAGAGAGGGAAGTGGAAGG - Intergenic
1089161325 11:116439740-116439762 GTGGGTGAGGCCAAGGTGGATGG + Intergenic
1089259206 11:117211484-117211506 AAGAGAGTGGGGAAAGTGGAAGG - Intronic
1089291431 11:117439796-117439818 GTGTGTGTCGGGACAGTGGAGGG - Intronic
1089500862 11:118930380-118930402 GTGTGGGTGGGGAAAGAGGAGGG + Intronic
1089606220 11:119643107-119643129 GGGAGTGAGGGCAATTTGGAGGG - Intronic
1090061349 11:123466685-123466707 GTGCGTGTGTGGAGAGTGGAGGG + Intergenic
1090062707 11:123477647-123477669 GAGAGAGAAGGGAAAGGGGAAGG - Intergenic
1090114079 11:123947665-123947687 GTAAGGGAGGGGAAGGTTGAAGG + Intergenic
1090464522 11:126922490-126922512 GTAAGGGCAGGGAAAGTGGAAGG - Intronic
1090703206 11:129314749-129314771 GTGGGGGAGGGGGAAGGGGAAGG - Intergenic
1091192619 11:133707487-133707509 GGGAGGGAAGGGAAAGTGGAGGG + Intergenic
1091229182 11:133976871-133976893 GTAAGTTATGTGAAAGTGGAAGG + Intergenic
1091433242 12:453817-453839 GTGACTGAGTGTTAAGTGGAAGG + Intergenic
1091546026 12:1501854-1501876 GTCAGTGAGGGGACAGGAGAAGG - Intergenic
1092237417 12:6818936-6818958 TTGAGAGAGGGGAAAGGGGGAGG + Intronic
1092255945 12:6927067-6927089 GTCAGTGAGGAGAGAGAGGAGGG - Intronic
1092322095 12:7487082-7487104 GAGAGAGAGGGGAAGGTGGATGG + Intronic
1092322808 12:7496327-7496349 ATGGGTGGGGGGAAAGGGGAGGG + Intronic
1092808438 12:12249491-12249513 TTGAATGAGGGGGAAGAGGAAGG - Intronic
1092961454 12:13600212-13600234 GAGTATGAGGGGAAAGAGGAAGG - Intronic
1093116199 12:15214430-15214452 TTAAGTGTGGGGAAAGTAGAGGG + Intronic
1093504162 12:19845458-19845480 GTGGGTGGGGGGCAAGGGGAGGG - Intergenic
1094167740 12:27459834-27459856 GTGAGTTAGGTGGAAGTGTATGG - Intergenic
1095054046 12:37579566-37579588 GGGAGTTGGGGGAAAATGGAGGG + Intergenic
1095282705 12:40374605-40374627 GTCAGTGAGTAGAAGGTGGACGG - Intergenic
1095376418 12:41534437-41534459 AGGAGTGAGGGGAAGGGGGAAGG - Intronic
1095426086 12:42076005-42076027 GTGAGAGAGGGCAAGGTTGAGGG + Intergenic
1095433963 12:42167139-42167161 GGGAGTGGGGGGAAAGGGGAGGG + Intronic
1095476473 12:42590929-42590951 GTGTGTGGGGGGAGTGTGGAGGG + Intergenic
1095635223 12:44424951-44424973 GTGAGGGTGGGGAAATTGGGAGG - Intergenic
1095852449 12:46825832-46825854 GTGGGTGAGACGAACGTGGAAGG - Intronic
1096115824 12:49054505-49054527 GTGAGTGAGGAGAATGGGGCAGG - Intronic
1096127107 12:49128067-49128089 GTGGGTGAGGGGATGGAGGAAGG - Exonic
1096145080 12:49273102-49273124 GTGGGTGAGGGGATGGAGGAAGG + Exonic
1096547077 12:52347388-52347410 GTGAGAGAGGAGACAGGGGAGGG + Intergenic
1096792027 12:54051469-54051491 GTGAGTGAGGGGGCGGAGGAAGG - Intronic
1097249698 12:57625742-57625764 GTGAGGCAGGGGTAAGTGGCTGG + Exonic
1097527173 12:60751465-60751487 GGGAGTGGGGGGAAAGGTGAGGG + Intergenic
1097622472 12:61957403-61957425 CAGAGTGAGGGGTCAGTGGATGG + Intronic
1098224936 12:68311627-68311649 AGGAGTGAGGGGAAAGTTGTTGG - Intronic
1098608850 12:72429194-72429216 GTGGGTCAGGGGAAAGGAGAGGG + Intronic
1098644837 12:72885669-72885691 GGGGGTGGGGGGAAAGGGGAGGG + Intergenic
1099052176 12:77793463-77793485 GGGTGTGGGGGGCAAGTGGAGGG - Intergenic
1099212416 12:79808248-79808270 CAGAGTAAGGGGAAAGTGGGAGG - Intronic
1099809472 12:87562206-87562228 GGGAGTGGGGGGCAAGGGGAGGG + Intergenic
1099954947 12:89344683-89344705 GTGGGTCAGGGGAAAGGGGAAGG - Intergenic
1100175732 12:92028970-92028992 GTGTGAGAGGGAAAAGTGGTGGG - Intronic
1100826975 12:98483724-98483746 GGGAGGGAGGGGGAAGGGGAGGG + Intergenic
1101315524 12:103625501-103625523 GTGGGTGGGGGGAAGGAGGAGGG - Intronic
1101527647 12:105546233-105546255 GTGGGTGAGGGGAATGAGGAAGG + Intergenic
1101673079 12:106894957-106894979 GTGAGTGAGTGGCAAGTGAATGG - Intergenic
1101941748 12:109104443-109104465 GTGAGTGAAGGGAAAGAGGGAGG - Intronic
1102061884 12:109938780-109938802 GTGAAGGAGGGGAAAAGGGAGGG + Intronic
1102501184 12:113353641-113353663 GGGAGGGAGGGAAGAGTGGAGGG - Intronic
1102763287 12:115408290-115408312 GTTTCTGAGGGGAAGGTGGAAGG + Intergenic
1102879875 12:116476143-116476165 GTGTGTAAGGTAAAAGTGGATGG + Intergenic
1102991681 12:117320712-117320734 GTGAGTGGAGGGAGAGTGGTGGG - Intronic
1103150329 12:118632753-118632775 GTGAGAGATTGGAGAGTGGAAGG - Intergenic
1103869502 12:124081220-124081242 GTGAGCCAGGGGACAGTGGTGGG + Intronic
1104147641 12:126050833-126050855 GTGAGTGAAGGGTGAGTGGGAGG - Intergenic
1104178777 12:126357854-126357876 GGGAGGGAGGGGATAGGGGAGGG + Intergenic
1104255834 12:127137409-127137431 GGGAGTGAGGGGTGAGGGGAGGG - Intergenic
1104506705 12:129338989-129339011 GGGAGGGAGGGAAAAATGGAAGG + Intronic
1104540134 12:129656300-129656322 GAGAGGGAGGGAAAAGAGGAGGG + Intronic
1105551676 13:21402732-21402754 ATCAGTGATGGGAAAGTGCAAGG - Intronic
1105897312 13:24727164-24727186 GTGAGGGAGAGGACAGTGGGTGG + Intergenic
1106142131 13:27020309-27020331 CTGAGTGAGGCCAGAGTGGAGGG + Intergenic
1106264447 13:28097729-28097751 ATGATTCAGGAGAAAGTGGAGGG - Intronic
1106727323 13:32499194-32499216 GTCAGTGAGTGAAAAGTAGAGGG - Intronic
1107063285 13:36184911-36184933 GGGGTTGAGGGGAAAGGGGAGGG - Intronic
1107088421 13:36450165-36450187 GTGCTTGAGGGGGAAGTAGAGGG - Intergenic
1107409741 13:40147520-40147542 GCGGGTGAGGGGAAAGGGGAGGG + Intergenic
1107437534 13:40393411-40393433 GGGGGTGAGGGGCAAGGGGAGGG + Intergenic
1107592744 13:41925613-41925635 GGGGCTGAGGTGAAAGTGGATGG + Intronic
1107970296 13:45635311-45635333 GGGAGTGAGGTAAAAGGGGAGGG - Intergenic
1108276980 13:48820942-48820964 GTGAGTGAGGGGAAGTGGGCTGG + Intergenic
1108320971 13:49290163-49290185 CTGAGTGGGGTGAAAGGGGATGG + Intronic
1108359077 13:49652723-49652745 GTGGGTGTGGGGTAAGCGGAAGG + Intergenic
1109438636 13:62340002-62340024 GTAAGTTTGAGGAAAGTGGAAGG - Intergenic
1110067133 13:71122465-71122487 GGGATGGAGGGGAAAGTGAAGGG + Intergenic
1110736909 13:78947955-78947977 GTGGGTGGGGGGCAAGGGGAGGG - Intergenic
1111128223 13:83940115-83940137 GGGGGTGAGGGGCAAGGGGAAGG + Intergenic
1111506610 13:89197637-89197659 GTGGGTGGGGGGATAGGGGAGGG + Intergenic
1111753686 13:92365407-92365429 ATGAGTGAGTGGTGAGTGGATGG + Intronic
1111908277 13:94281339-94281361 GGGAGTGAGAGGGAAGGGGAGGG - Intronic
1111998520 13:95189036-95189058 GTGGGTGGGGGGCAAGGGGAGGG - Intronic
1111999720 13:95198958-95198980 GAGGGTGAGGGGCAAGGGGAAGG + Intronic
1112182824 13:97102062-97102084 GGAAGGGAGGGGAAATTGGAGGG - Intergenic
1112362119 13:98727797-98727819 GTGAGTGAGGGGGAAGGGGATGG - Intronic
1112373509 13:98816712-98816734 GTTAGTCAGGTGAAAGTGAAAGG + Intronic
1112910449 13:104476463-104476485 GTGAGTGATGGCAATGGGGAAGG + Intergenic
1113444664 13:110356187-110356209 GTGAGTCAGTGGGAAATGGAGGG - Intronic
1113808961 13:113126111-113126133 GTGAATGAGGGCAGAGTTGAAGG + Intronic
1113934096 13:113984335-113984357 GTGAGTGATGGGTAGGTGGACGG - Intronic
1114148297 14:20005064-20005086 GGGGGTGAGGGGAAAGGGGAAGG - Intergenic
1114242035 14:20877010-20877032 GTGGGTGAGGGGGAAGTTAATGG - Intergenic
1114288494 14:21268890-21268912 GTGGGGGAGGGGAAGGGGGAAGG - Intronic
1114450093 14:22819683-22819705 CTGAGTCAGGGGAGAGGGGAAGG + Intronic
1114525823 14:23366319-23366341 AGGAGGGAGGGGAAAGGGGAGGG + Intergenic
1115104712 14:29746335-29746357 GTGACTGAGGGGATAGTGGCAGG - Intronic
1115496864 14:34013509-34013531 CTCAGTGTGGGGAAAGAGGACGG - Intronic
1116122588 14:40739272-40739294 GAGAGAGAAGGGAAAGTGAAAGG + Intergenic
1116950697 14:50875964-50875986 GTGAGTGAGGGGAGCTTAGAAGG + Intronic
1117269465 14:54127249-54127271 GTGAATGAAGGGAAAGTGAGAGG + Intergenic
1117608947 14:57462960-57462982 GTGACAGAGGGGAAATTGGAGGG + Intergenic
1117663124 14:58029091-58029113 GGGAGTGAGGGGAATGGAGAGGG - Intronic
1117764493 14:59066823-59066845 GTGAGAGATGGGAAAATGGGTGG + Intergenic
1118012706 14:61626278-61626300 ATGAGTGAGAGGAGAGAGGATGG - Intronic
1118102756 14:62624936-62624958 GTGTGTGAAAGGAAAGAGGAGGG - Intergenic
1118602829 14:67482478-67482500 GTGAGTGGAGTGAAAGCGGAAGG - Intronic
1119356489 14:74011335-74011357 TTGAGTGAGAAGAAAGTGTAGGG - Intronic
1119383860 14:74245311-74245333 CCGAGAGAGGGGAGAGTGGAGGG - Intronic
1119599468 14:75965535-75965557 GTGAGTGGGGGGGAAGTTAATGG - Intronic
1119660788 14:76450306-76450328 GTGAGCAAAGGCAAAGTGGAAGG + Intronic
1119806635 14:77486465-77486487 GTGGATGAGTGGAAGGTGGAAGG + Intronic
1120447739 14:84622453-84622475 GTCAGGGAGGTGAAAATGGATGG - Intergenic
1121608507 14:95259342-95259364 GTGAGTGGGGAGCCAGTGGACGG - Intronic
1121855324 14:97264204-97264226 GTGAGTGAGTGGTGAGTGAATGG - Intergenic
1122056402 14:99101092-99101114 GGGGGTGAGGGGAAATGGGAGGG - Intergenic
1122090401 14:99334667-99334689 GTGATTTAGGGGAAAGCGGCAGG + Intergenic
1122672047 14:103379848-103379870 CTTGGTGAGGGGAAAGAGGAGGG - Intergenic
1122931224 14:104933766-104933788 CTGAGTGAGGGGAGGGTGGGAGG + Exonic
1122931307 14:104933971-104933993 CTGAGTGAGGGGAGGGTGGGAGG + Exonic
1124203062 15:27694901-27694923 GGGAGAGAGGGGAGAGGGGAAGG - Intergenic
1124210899 15:27764214-27764236 GAGAGAGAGGGGAAAATAGAGGG + Intronic
1125057309 15:35376588-35376610 GTGAGTGAGTGGTGAGTGAATGG - Intronic
1125397711 15:39268367-39268389 CTGGGTGAGGGGAAGGGGGAGGG + Intergenic
1126701874 15:51375305-51375327 TCAAGTGAGGGGAAAATGGAGGG - Intronic
1127075314 15:55319414-55319436 GTGAGTGAGGGGACACTGTCTGG + Intronic
1127374296 15:58368904-58368926 GGGAGTCAGGGGCAAGGGGAGGG + Intronic
1127586920 15:60387318-60387340 GTGAGTGTGGGGGAAGTGGAAGG - Intronic
1127967930 15:63937613-63937635 GTGAGTGAGAGGAAAAGGGCTGG - Intronic
1128636471 15:69305639-69305661 GCGTGAGAGGGGAAAGTGGGTGG - Intronic
1128712144 15:69879964-69879986 GCGGGTGAGGGGATAGGGGAGGG - Intergenic
1129044983 15:72725989-72726011 GAGAGGGAGGGGAAAGGGGAAGG - Intronic
1129348749 15:74941311-74941333 GTGACTGTAGGCAAAGTGGAGGG - Intergenic
1129976154 15:79823521-79823543 TTCAGAGAGAGGAAAGTGGAAGG - Intergenic
1130850543 15:87789409-87789431 GTGAGTGGGGGGAGGGGGGAGGG + Intergenic
1131013744 15:89040798-89040820 GTGAGAGAGAGGATACTGGATGG + Intergenic
1131053605 15:89363015-89363037 TTGGGTGAGCGGAAAGGGGAAGG + Intergenic
1131251949 15:90836796-90836818 CAGAGTGAGGGCACAGTGGACGG - Intergenic
1131406141 15:92166542-92166564 GTGAGTGAGGGGAAGCTGGAGGG - Intronic
1131410037 15:92199989-92200011 GAGAATGAGGGGAAAGGGGAGGG + Intergenic
1131439286 15:92446872-92446894 GTGAGCAAGGAGAAAGGGGAAGG + Intronic
1131453717 15:92566822-92566844 TGGGGTGAGGGGAAAGGGGAGGG - Intergenic
1131755070 15:95550711-95550733 GAGAGTAAGGGGAAAGGAGAGGG - Intergenic
1131770778 15:95735125-95735147 GTGACTTTGGGGAAAGTGAATGG + Intergenic
1132240391 15:100253349-100253371 GTGAGGGAGGGGAAGGTAGAGGG + Intronic
1132309798 15:100849202-100849224 GAGAGTGAGAGCTAAGTGGATGG - Intergenic
1132478865 16:155926-155948 GGGATGGAGGGGAAGGTGGAAGG + Intronic
1132491538 16:234579-234601 GAGAAGGAGGGGAAAGAGGACGG + Exonic
1132716511 16:1292700-1292722 GAGAGGGAGGGGGAAGTGGGGGG - Intergenic
1133333141 16:4988588-4988610 AGGAGGGAGGGGAAAGAGGAGGG - Intronic
1133523637 16:6582770-6582792 GGGAGGGAAGGGAAAGAGGAAGG - Intronic
1133819538 16:9224284-9224306 AAGAGAGAGGGGAAAGGGGAAGG - Intergenic
1133844837 16:9444082-9444104 GTGTGTGAAGGGAATGAGGAAGG - Intergenic
1134373578 16:13649080-13649102 GGGGGTGAGGGGAAAGGGGAGGG - Intergenic
1134513492 16:14867938-14867960 GCGAGTGAGGGGACAGTGGGAGG - Intronic
1134701129 16:16266433-16266455 GCGAGTGAGGGGACAGTGGGAGG - Intronic
1134745858 16:16587726-16587748 GAGAGAGAGGGGAAGGAGGATGG + Intergenic
1134800538 16:17080478-17080500 GGGGGTGGGGGGAAAGGGGAGGG - Intergenic
1134847387 16:17451413-17451435 GTGAGTCAGGGAGAAGGGGAGGG - Intronic
1134970699 16:18528213-18528235 GCGAGTGAGGGGACAGTGGGAGG + Intronic
1134999621 16:18766016-18766038 GAGAGAGAGGGGAAGGAGGATGG - Intergenic
1135325544 16:21523187-21523209 GAGAGTGAGGGCTGAGTGGATGG + Intergenic
1135639196 16:24105523-24105545 GGGGGTGAGGGGCAAGGGGAGGG - Intronic
1135726537 16:24858440-24858462 ATGAGTGAGTGGATGGTGGATGG + Intronic
1135737206 16:24941662-24941684 GTGAGTGGGGGGAAACAGAAAGG - Intronic
1135870306 16:26143611-26143633 GGGGGTGGGGGGAAAGGGGAGGG + Intergenic
1136402442 16:30025885-30025907 GTGACAGAGGGGAAAGAGGAAGG - Intronic
1136687689 16:32004668-32004690 GTAAATGAGGGGCCAGTGGATGG + Intergenic
1136771524 16:32845743-32845765 GTGCGTGATGGGAACTTGGATGG - Intergenic
1137223595 16:46481082-46481104 GAGAGAGAGGAGAAAGTGAAGGG + Intergenic
1137456677 16:48623114-48623136 GTGGGTGGGGGGCAAGCGGAGGG - Intergenic
1137508784 16:49080057-49080079 GTGAGTGAGGGACAAGATGATGG - Intergenic
1137871739 16:51956234-51956256 ATGACTGAGGGTAAAGTGGGGGG + Intergenic
1138180192 16:54936115-54936137 GGGAGAGAGGGGAGAGTGGAGGG - Intergenic
1138308968 16:56006985-56007007 GTGAGTGAGTGAAATGTTGAGGG + Intergenic
1138579404 16:57930546-57930568 GAGAGAGAGGGGAAGGAGGAGGG + Intronic
1138752511 16:59440788-59440810 GGGAGGGAGGGGAAGGGGGAGGG - Intergenic
1138786193 16:59849820-59849842 GGGAGTGAGGAGCAAGGGGAGGG - Intergenic
1139130363 16:64135477-64135499 GGGGGTGAGGGGCAAGGGGAGGG - Intergenic
1139238562 16:65366560-65366582 CTGACTGTTGGGAAAGTGGATGG - Intergenic
1139624998 16:68180642-68180664 GTGGGGTGGGGGAAAGTGGAAGG - Intronic
1140506336 16:75475731-75475753 GGGAGTCAGGGGAGAATGGATGG + Exonic
1140602697 16:76497693-76497715 GGGAGTGGGGGGATAGGGGAGGG + Intronic
1140655157 16:77132406-77132428 GAGAGGGAGGGGAAGGGGGAGGG - Intergenic
1140877484 16:79166240-79166262 GGGAGTGAGGGGAATGAGGTGGG - Intronic
1141300481 16:82810869-82810891 GTGAGTCAGGGGGAAATGGGGGG + Intronic
1141397134 16:83715345-83715367 GTCAGTGAGGATAAAGTAGATGG - Intronic
1141838628 16:86559862-86559884 ATGAGTGAGGAGAAAGGGGGAGG + Intergenic
1142038542 16:87877774-87877796 GAGAGTGAGGGCTGAGTGGATGG + Intergenic
1142234513 16:88915448-88915470 GTGGAGGAGGGGAGAGTGGAGGG + Intronic
1142353120 16:89588814-89588836 GGGGGTGAGGGGAAGGTGGTGGG - Intronic
1203073948 16_KI270728v1_random:1107854-1107876 GTGCGTGATGGGAACTTGGATGG - Intergenic
1142764216 17:2056575-2056597 CTGAGGGAAGGGGAAGTGGAGGG + Intronic
1143163266 17:4885121-4885143 GGGGGAGAGGGGAAAGGGGAGGG - Intronic
1143278853 17:5735021-5735043 GTGGGTGGGGGGCAAGGGGAGGG + Intergenic
1143304387 17:5934288-5934310 GTGGGTGGGGGGCAAGGGGAGGG - Intronic
1143463212 17:7117297-7117319 ATTAGTGAGGGGAAACAGGATGG - Intergenic
1143530999 17:7503362-7503384 CTGAGAGAGGGGGAAATGGAGGG - Intronic
1143887493 17:10076086-10076108 AAGAGGGAAGGGAAAGTGGAGGG + Intronic
1143902679 17:10185856-10185878 GTGAGTGTGGAGAAACAGGATGG + Intronic
1143981330 17:10872887-10872909 GGGGGTGAGGGGCAAGGGGAGGG - Intergenic
1144848170 17:18230781-18230803 GTCAGTGCTGGGAAAGGGGAGGG + Intronic
1145386964 17:22421273-22421295 GTGAATGAGGGGAGAGGGGTTGG + Intergenic
1145398090 17:22511864-22511886 GTGAGTGAGGGAGAGGAGGAAGG - Intergenic
1146364072 17:32205158-32205180 GGGGGTGAGGGGCAAGGGGAGGG - Intronic
1146503724 17:33386536-33386558 GTCATTGAGGGAGAAGTGGATGG - Intronic
1146556349 17:33827866-33827888 GGGAGTGGAGGGAAAGAGGAGGG - Intronic
1146826864 17:36030671-36030693 GAGAGAGAGGGGAAAGGGGAAGG - Intergenic
1147403697 17:40195697-40195719 CTGAGGGAGGGGAGAGGGGATGG + Intergenic
1147487194 17:40827845-40827867 GTGAGGGAGGAGAAAATGGCTGG + Intronic
1148011105 17:44482219-44482241 GTGGGTGGGGGGCAAGGGGAGGG + Intronic
1148255799 17:46130791-46130813 ATGAGGGAGGGGAAAGAGGAGGG - Intronic
1148462307 17:47845809-47845831 GGGAGCGAGGGGAAGGGGGAGGG + Exonic
1148648100 17:49230684-49230706 GGGGATGAGGGGCAAGTGGAGGG - Exonic
1148686522 17:49504016-49504038 GGGAAGGAGGGGAAAATGGAGGG - Intronic
1148722448 17:49763788-49763810 AAGTGTGAGGGGAAAGTGGATGG - Intronic
1149020895 17:51962698-51962720 GGGAGTGGGGGGAAAGAGAAAGG + Intronic
1149174011 17:53847669-53847691 GGTAGTGAGGGAAAAGGGGAGGG - Intergenic
1150016837 17:61565578-61565600 GGCAGTGGGGGGAAAGGGGAGGG + Intergenic
1150564443 17:66326331-66326353 GTGAGTGAGGGCAGAGGGCAGGG - Intronic
1150784082 17:68148972-68148994 GGGAGTGAAGGGAAAATGGGAGG + Intergenic
1151081684 17:71336516-71336538 GGGTGTGAGGGGAAAGGGGATGG + Intergenic
1151533920 17:74726474-74726496 ACGAATGAGGGGAACGTGGATGG + Intronic
1152521666 17:80860077-80860099 GCAGGTGAGGGGAGAGTGGACGG + Intronic
1152797176 17:82314206-82314228 GTGAGTGAGGGGCAGGTGTGAGG + Intergenic
1153198648 18:2627620-2627642 GTGAGTGAGTGGTGAGTGAAAGG - Intergenic
1153281880 18:3422584-3422606 GTGAGTGAGTGGTGAGTGAATGG - Intronic
1153360369 18:4188456-4188478 GGGTGTGAGGGGCAAGGGGAGGG - Intronic
1153470146 18:5435329-5435351 GTGAGTGAGTGAAGAGTGAATGG - Intronic
1153522216 18:5963914-5963936 GTGGGTGCAGGGCAAGTGGATGG - Intronic
1153563290 18:6393933-6393955 GTGAGCAAGGGGAGAGCGGAAGG - Intronic
1153711200 18:7801015-7801037 GTGAGTGAGTGGTGAGTGAATGG + Intronic
1153955713 18:10094311-10094333 GTGAGTGAGTGGTGAGTGAATGG - Intergenic
1154002516 18:10494521-10494543 GTCAGTGTGGGGAAGGAGGATGG - Intergenic
1154052095 18:10970722-10970744 GTGAGTCAGGAGAAAGAGGAAGG + Intronic
1154980891 18:21501404-21501426 ATGGGTGAGGGGCAAGAGGAGGG - Intronic
1155222950 18:23701924-23701946 GTGAGTGGGGGAAAAGTGCGAGG + Intronic
1155224992 18:23721628-23721650 GGGAGGGAGAGGGAAGTGGAGGG - Intronic
1155281096 18:24240827-24240849 GGGAGGGAAGGGAAAGTGAAAGG - Intronic
1155558853 18:27052921-27052943 GGGGGTGAGGGGAAAGGGAAGGG + Intronic
1155814417 18:30287144-30287166 GGGAGTGAGGGGCTAGCGGAGGG + Intergenic
1155966073 18:32036632-32036654 GGGAGGGAGGGGAGAGGGGAGGG + Intronic
1156430850 18:37072760-37072782 GGGAGTCAGGGGCAAGGGGAAGG - Intronic
1156456679 18:37298793-37298815 GGGAGTGAGGGGAGAGTAGCAGG - Intronic
1156778887 18:40826165-40826187 GTGAGTGGGGGGTGAGGGGAGGG + Intergenic
1157436543 18:47674897-47674919 TTGATGGAGGGGAAAGTGGAAGG + Intergenic
1158368878 18:56773901-56773923 GTGGGTGAGGGGAGAGAAGAAGG - Intronic
1158425771 18:57338578-57338600 GAGAGAGAAGGGAAGGTGGAGGG - Intergenic
1158849355 18:61479450-61479472 GCGAAGGAGGGGAGAGTGGATGG - Intronic
1159157710 18:64605867-64605889 GGGGGTGGGGGGAAAGAGGAGGG + Intergenic
1159181799 18:64916858-64916880 GTTGTTGAGGGGAAAGGGGAAGG + Intergenic
1159402757 18:67958658-67958680 GTGAGTGAGGCAAAATTGAAGGG - Intergenic
1159428387 18:68319374-68319396 GGGAGTGGGGGAAAAGGGGAGGG + Intergenic
1159961261 18:74557408-74557430 GGGAGTGGGGGTAAAGTAGAGGG + Intronic
1160975452 19:1790349-1790371 GTGAGGGAGTGGGCAGTGGAGGG - Intronic
1161093869 19:2377543-2377565 GGGAGAGAGGGGAGAGGGGAGGG - Intergenic
1161657652 19:5525793-5525815 GTGAGGGAGGGGAGGATGGATGG - Intergenic
1161756580 19:6138472-6138494 GAGAGAGAGGGGAAGGGGGAAGG + Intronic
1161821575 19:6533632-6533654 GAGAGGGAGGGGAAGGAGGAAGG - Intronic
1162117787 19:8442031-8442053 GTGATTGAGGGGCAGGTGGCTGG + Intronic
1162572790 19:11482467-11482489 GGCAGTGCGGGGAGAGTGGAGGG + Intronic
1163351213 19:16777581-16777603 GGAGGGGAGGGGAAAGTGGAGGG + Intronic
1163609931 19:18295482-18295504 GTGGGTGAGTGGATGGTGGATGG - Intergenic
1163610059 19:18295944-18295966 GTGGGTGTGTGGTAAGTGGATGG - Intergenic
1164440862 19:28278906-28278928 GGGGGTGAGGGGCAAGGGGAGGG - Intergenic
1164680499 19:30131050-30131072 GGGAGTGAGGGGGGAGGGGAAGG - Intergenic
1164680525 19:30131123-30131145 GGGAGTGAGGGGGGAGGGGAAGG - Intergenic
1164938622 19:32233806-32233828 GGAAGGGAGGGGAAAGTGCAGGG + Intergenic
1164967168 19:32495368-32495390 GGGAGTGGAGGGGAAGTGGATGG + Intergenic
1165323869 19:35102793-35102815 GTGAGTGAGGGGCAGGTGGGAGG - Intergenic
1165378980 19:35464407-35464429 GGGAGAGAGGGGAAAGGGGAAGG + Intergenic
1165490632 19:36121034-36121056 GGGAGGGCTGGGAAAGTGGAGGG + Intronic
1165699089 19:37923573-37923595 GTGAGTGAGTGGTGAGTGGATGG + Intronic
1165823783 19:38693929-38693951 GTGAGTGCGGGGAAGGGGGGTGG - Intronic
1165847404 19:38827084-38827106 GGGAGGGAGGGGAAGGAGGAAGG + Intronic
1166500979 19:43341068-43341090 GAGAGTGAGGGGAGAGAGAAAGG - Intergenic
1166509116 19:43392380-43392402 GAGAGTGAGGGGAGAGAGAAAGG + Intergenic
1166690345 19:44818677-44818699 AGGAGTGAGGGGAGAGAGGAGGG - Intronic
1166822658 19:45590142-45590164 GTGACTCGGGGGAAAGTGGAAGG - Exonic
1167579989 19:50335622-50335644 GAGAGTGATGGGAACGGGGATGG + Intronic
1167598155 19:50438080-50438102 ATCAGTGGGTGGAAAGTGGAGGG - Intronic
1167679036 19:50908336-50908358 GTGAGAGAGGGGAAAGGGGAGGG - Intronic
1167779937 19:51592716-51592738 GGGAGGGAGGGGAAAGAAGATGG + Intergenic
1168000792 19:53444540-53444562 CTCAGTGAGGGGAATGTGGCAGG - Intronic
1168371601 19:55839117-55839139 GTGAGGGGTGGGAAAGGGGAGGG - Intronic
1168517198 19:57017882-57017904 GTGAGAGGGAGGGAAGTGGAGGG - Intergenic
924993866 2:339772-339794 GTGAGAGTTTGGAAAGTGGATGG - Intergenic
925076230 2:1018517-1018539 GTCAGGGAGGGGAGAGTGCATGG + Intronic
925347887 2:3183339-3183361 GTGGGTGAGTGGATAGTGGATGG - Intergenic
925427292 2:3760678-3760700 GGGGGTGAGGGGAAAGGGGAGGG + Intronic
925522632 2:4764700-4764722 GGGGGTGGGGGGAAAGGGGAGGG + Intergenic
925569298 2:5291959-5291981 TTGATTGGAGGGAAAGTGGAAGG - Intergenic
926476996 2:13336162-13336184 GAGAGTGCGGGGAAAGTGGTGGG + Intergenic
926664254 2:15502704-15502726 GCGAGTGAGTGGCAAGTGAATGG + Intronic
927114248 2:19885909-19885931 GAGAGTGAGGGGAGAGAGGAAGG - Intergenic
927927951 2:27026248-27026270 GGGAGAGAGAGGAAAGTGGTGGG - Intronic
928112682 2:28523505-28523527 GAGTGTGAAGGGAAAGTGGCTGG + Intronic
928295205 2:30076804-30076826 GTGGCTGAGGCAAAAGTGGATGG + Intergenic
928776107 2:34765582-34765604 GTGGGTGAGGGGAAAGAGGAGGG + Intergenic
929051617 2:37841835-37841857 TGGAGTGAGGGAAGAGTGGAAGG + Intergenic
929384935 2:41395312-41395334 GTAGGTGAGGGGATAGTAGAGGG - Intergenic
929385702 2:41403699-41403721 GAGAGGAAGGGGAAAGAGGATGG + Intergenic
929901240 2:46005513-46005535 GTTAGTGAGTGGGAAGTGGGAGG + Intronic
930084096 2:47480306-47480328 GAGGGGGAGGGGAAAGGGGAAGG - Intronic
930144594 2:47988980-47989002 GTGAGTGAGAGGTGAGTGAATGG - Intergenic
930175458 2:48296838-48296860 GGGGGTGAGGGGTAAGGGGAGGG - Intergenic
930335921 2:50045525-50045547 GTCTGTGAGGGGAAGGAGGAAGG - Intronic
930586703 2:53275990-53276012 GTGAGTGAGTGGTAAGGAGATGG - Intergenic
930672399 2:54164851-54164873 GGGGGTGAGGGGCAAGAGGAGGG - Intronic
930717740 2:54608581-54608603 GGGAGTGATGGGAAATAGGAAGG + Intronic
930819349 2:55629847-55629869 GGGAGTGAGTGGCAAGTGGAGGG - Intergenic
930851512 2:55965940-55965962 GTGTGTGAAGGGAAGGAGGAAGG + Intergenic
931604923 2:64042483-64042505 GAGAGGGAGGGGGAAGGGGAGGG + Intergenic
931930888 2:67132220-67132242 GGGGGTGGGGGGAAAGGGGAGGG - Intergenic
932107247 2:68955415-68955437 GGGAGTGAGGGGCTAGAGGAGGG - Intergenic
932641358 2:73450515-73450537 GTGTGTGAGTAGAAAGTAGAGGG - Exonic
932641388 2:73450800-73450822 GTGTGTGAGTAGAAAGTAGAGGG - Exonic
932705438 2:74020934-74020956 ATGAGTGAGTGGGAAGGGGAGGG - Intronic
932965455 2:76469335-76469357 GTGAGTCAGGGAAAAGAAGAAGG - Intergenic
933035129 2:77386787-77386809 GGGAGTGGGGGGCAAGGGGAGGG + Intronic
933557430 2:83848596-83848618 GTGAGTCTGGGGCAAGGGGAGGG - Intergenic
933679446 2:85086855-85086877 GGGGGTGAGGGGCAAGGGGAGGG - Intergenic
933703515 2:85273149-85273171 GTGAGTGAGGAGGAGGTGGGAGG - Intronic
933716162 2:85362394-85362416 GGGAGTGAGGGGAGGGTGTATGG + Intronic
934165927 2:89294194-89294216 GAGAGGGTGGGGACAGTGGATGG + Intergenic
934201350 2:89888262-89888284 GAGAGGGTGGGGACAGTGGATGG - Intergenic
934779272 2:96959304-96959326 GTGAGTGATGGGTGTGTGGAGGG + Intronic
934874912 2:97908571-97908593 ATGAGCAAGGGGAAAGAGGAGGG + Intronic
935008989 2:99113367-99113389 GGGGGAGAGGGGAAGGTGGAGGG + Intronic
936104351 2:109612698-109612720 GTGAGTGAGGGAAAATTGAGGGG - Intronic
936580771 2:113698610-113698632 GGGGGTGGGGGGAAAGGGGAGGG + Intergenic
936600193 2:113888513-113888535 GAGAATGAGAGGAAGGTGGAAGG - Intergenic
936637259 2:114272885-114272907 GTCAGTGACGTGACAGTGGAGGG + Intergenic
936850197 2:116886838-116886860 GGGAGTGGGGGGCAAGGGGAAGG + Intergenic
936949127 2:117959532-117959554 GAGAATGAGGAGAAATTGGATGG + Intronic
937515506 2:122650645-122650667 GAGAGTGAGGGCAAGGTGGGTGG + Intergenic
937552133 2:123107551-123107573 ATGGGGGAGGGAAAAGTGGAAGG - Intergenic
937825584 2:126365382-126365404 GTGAGTGCGGGGGAAGGTGAGGG + Intergenic
938671558 2:133591127-133591149 GTGAGTGCGGGGAGAGGGAAGGG + Intergenic
938902014 2:135806482-135806504 GTGGGTGAGGGGTGAGTGAATGG - Intronic
938982682 2:136541468-136541490 GTGAGTGACAGGGAAGTTGAGGG + Intergenic
939095136 2:137825607-137825629 GTGAGTAGTGGGAAAGGGGAAGG + Intergenic
939444156 2:142287478-142287500 GTGAGGGAGGGCAAAGTGATTGG + Intergenic
939657632 2:144847721-144847743 GAGAGGGAGGGGAAAGAGGAGGG + Intergenic
940160581 2:150708331-150708353 GTGAGGCAGGAGAAAGGGGAGGG + Intergenic
940162486 2:150728640-150728662 GGGGGTGAGGGGTAAGGGGAGGG - Intergenic
940210431 2:151251219-151251241 CTGAGTCAGGAGAAAGTGGATGG - Exonic
940442062 2:153727886-153727908 GTGGGTAAGGGGAAAGTGGAGGG - Intergenic
940555877 2:155227957-155227979 GGGAGTGGGGGGATAGGGGAGGG - Intergenic
941011501 2:160305239-160305261 GTGAGTGAGTGGTGAGTGAATGG - Intronic
941218825 2:162748865-162748887 GGGAGGGAGGGGAAGGGGGAGGG - Intronic
941415669 2:165217989-165218011 GGGAGTGTGGGGAAAGTGGAGGG - Intergenic
941428631 2:165383901-165383923 GAGAGTGAGAGGAAGGAGGAAGG + Intronic
941897196 2:170641103-170641125 GTGAGTGGATGTAAAGTGGACGG - Intronic
942191900 2:173478495-173478517 GTGGGTGATGGGAACCTGGATGG - Intergenic
942202670 2:173587580-173587602 GGGGGTGGGGGGAAAGGGGAAGG - Intergenic
942809686 2:179983257-179983279 GAGGGTGAAGGGAGAGTGGAGGG - Intronic
942945476 2:181667539-181667561 TTGAGGGAGGGGAAAGGGGCTGG + Intronic
943021364 2:182578000-182578022 GGGAGGGAGGGGAAAGAGCAAGG + Intergenic
943106563 2:183550980-183551002 GAGGGTGAGGGGATAGGGGAGGG + Intergenic
943553941 2:189377715-189377737 GTGAAGGAGGAGAAAGTGGAGGG - Intergenic
943761037 2:191609564-191609586 GTGTGTGAAGGAAAATTGGAAGG + Intergenic
943777765 2:191785643-191785665 GGGAGTGAGGGGCTAGGGGAGGG - Intergenic
943799004 2:192034393-192034415 AGGAGTGATGGGAGAGTGGAAGG - Intronic
944039548 2:195338380-195338402 GAGAGAGAGGGGAAAGAGAAAGG - Intergenic
944231009 2:197392759-197392781 GGCAGTGGGGGGAAAGGGGAGGG + Intronic
944932181 2:204530967-204530989 TAGAGTGAGGGAAAAGAGGATGG - Intergenic
944968069 2:204959118-204959140 GGGAGTGGCGGGAAAGGGGAGGG - Intronic
946052759 2:216877843-216877865 GTGGGTGAGAGGAGAGGGGAAGG + Intergenic
946115903 2:217461927-217461949 GAGAGAGAGGGCAAAGAGGAAGG + Intronic
946119476 2:217497021-217497043 GGGGGTGAGGGGCAAGGGGAGGG + Intronic
946393565 2:219431285-219431307 GGGAGCAAGGGGAGAGTGGAAGG - Intergenic
946625150 2:221603710-221603732 GTGAGTGGTGGGAAAATGGAAGG + Intergenic
947921163 2:233875651-233875673 GGGGGTGGGGGGAAAGGGGAGGG - Intergenic
948330116 2:237157896-237157918 GTGAGTGAGGGGCTGGTGAATGG - Intergenic
948379908 2:237544174-237544196 GTGAGTGGGGGGACAGTGTGTGG + Intronic
948380081 2:237544816-237544838 GTGAGTGGGGGGACAGTGTGTGG + Intronic
948667486 2:239545664-239545686 CTGAGGGAGGGGAAAGTGTGAGG - Intergenic
948724267 2:239922113-239922135 ATAATTGAGGGGAAAATGGAAGG - Intronic
949001922 2:241619832-241619854 GTGAGTGAGGGGTGAGTGAGGGG + Intronic
949001930 2:241619869-241619891 GTGAGTGAGGGGTGAGTGAGGGG + Intronic
949001965 2:241620044-241620066 GTGAGTGAGGGGTGAGTGAGGGG + Intronic
1168828275 20:828908-828930 CTGACTGAGGGGAAAGGGGTGGG - Intergenic
1168852795 20:988155-988177 GTGACTGAGGGGAGAGTGGTGGG + Intronic
1169212531 20:3775396-3775418 GTTAGTTTGGGGCAAGTGGAGGG - Intergenic
1169275284 20:4229665-4229687 GTGATTGAGGGCAGAGAGGAAGG + Intronic
1169289703 20:4338664-4338686 GGGGGTGAGGGGCAAGGGGAGGG - Intergenic
1169550834 20:6699602-6699624 GAGAGAGAGGGGAGAGAGGAAGG - Intergenic
1169601819 20:7269708-7269730 GGGAGTGAGGAGGAAGGGGAGGG - Intergenic
1169954831 20:11089430-11089452 GGGGGTGAGGGGATAGGGGAGGG + Intergenic
1170696021 20:18659753-18659775 GGGAGTGGGGGGAAAAGGGAGGG + Intronic
1170731608 20:18980871-18980893 GAGGGTGAGGGGCAAGGGGAGGG - Intergenic
1170859911 20:20093289-20093311 GTGACTGGAGGGAAAGGGGAAGG + Intronic
1170905376 20:20511417-20511439 GTGAGTGAGGTGGTAGAGGATGG - Intronic
1171023089 20:21604209-21604231 GGGAGTGAGGGGCAAGGGAAGGG - Intergenic
1171054571 20:21893854-21893876 GTGGGGGAGAGGAAAGTGGAAGG - Intergenic
1171091714 20:22291437-22291459 GGGACTGGGGGGAAAGAGGAGGG + Intergenic
1171948196 20:31397163-31397185 GGGAGTGGGGGGCAAGGGGAGGG - Intergenic
1171986634 20:31665487-31665509 GTTAGTGTGGGGAGAGTGGGGGG + Exonic
1172089699 20:32421068-32421090 GGGGGTGGGGGGAAAGGGGAGGG + Intronic
1172134800 20:32679731-32679753 CTGAGGGAGAGGAAACTGGAGGG + Intergenic
1173534676 20:43800416-43800438 GTGAGGGTGGGGAGAGGGGAAGG + Intergenic
1174020829 20:47526776-47526798 GGGAGAGAGGGGAGAGGGGAGGG + Intronic
1174149717 20:48477610-48477632 GAGGGCGAGGGGAAAGAGGAAGG + Intergenic
1174200290 20:48802342-48802364 GTGAGTGAGGGGAGAATGGGTGG - Intronic
1174302101 20:49589859-49589881 GTGAGTTGGGGGAGAGTGGGAGG - Intergenic
1174339852 20:49888896-49888918 CTGGGAGAGGGGAAAGAGGATGG - Exonic
1174476842 20:50801820-50801842 GGGACTGAGGGGAAGGAGGATGG + Intronic
1174765122 20:53246361-53246383 GTGAGTAAGAGGAAAGTTTATGG - Intronic
1174843220 20:53919216-53919238 GTGTGTGAGGGCGAAGGGGAGGG - Intergenic
1175226063 20:57444657-57444679 GTGTGGGAGCGGAAAGAGGATGG + Intergenic
1175366867 20:58461674-58461696 GGGAGTGAGGAGAGAGAGGAGGG - Intronic
1175531232 20:59675119-59675141 GAGGGAGAGGGGTAAGTGGAGGG - Intronic
1175531252 20:59675175-59675197 GAGGGAGAGGGGTAAGTGGAGGG - Intronic
1177509674 21:22069154-22069176 GGGGGTGGGGGGCAAGTGGAGGG - Intergenic
1177572329 21:22903345-22903367 GTGAGTGAGTGGTGAGTGAATGG - Intergenic
1177758351 21:25373802-25373824 GAGGGGGAGGGGAAAGGGGAGGG - Intergenic
1177758365 21:25373829-25373851 GAGGGGGAGGGGAAAGGGGAGGG - Intergenic
1177997240 21:28116379-28116401 GTGGGAGTGGGGAATGTGGATGG - Intergenic
1178184169 21:30200630-30200652 GGGGGTGGGGGGATAGTGGAGGG - Intergenic
1178372626 21:32038816-32038838 GGGCATGGGGGGAAAGTGGAGGG - Intronic
1179289417 21:40005788-40005810 GTGAGTTCAGGGAAAGTGGGTGG + Intergenic
1179653850 21:42832981-42833003 GTGAGTGTGGGGAAAAGGCATGG - Intergenic
1180012213 21:45058617-45058639 GGGAGTGTGGGGGAAGTGGAGGG + Intergenic
1180026233 21:45163787-45163809 GTGACTGAAGGGAAACTCGAGGG + Intronic
1180129228 21:45816115-45816137 GTGAGTGAGTGGTGAGTGGTGGG + Intronic
1180570509 22:16712574-16712596 GTGGGTGGGGGGAAAGGGGAGGG + Intergenic
1180941697 22:19663793-19663815 GGGGGTGAGGGGAAAGGGGATGG - Intergenic
1181304600 22:21908033-21908055 GTGAGTTAGGGAAAAGGGGAAGG + Intergenic
1181537274 22:23552968-23552990 GAGATTGATGGGAAGGTGGATGG - Intergenic
1181602362 22:23960169-23960191 GCGAGGGAGGGGAAAGGCGAGGG - Intronic
1181606149 22:23981138-23981160 GCGAGGGAGGGGAAAGGCGAGGG + Intronic
1181839478 22:25644071-25644093 GTGAGTGAGTGGCAAGAGAAAGG + Intronic
1182673236 22:32015704-32015726 GGAAGTGAGGGGAAACTGGAGGG - Intergenic
1182767760 22:32771049-32771071 GGGGGTGAGGGGCAAGGGGAGGG - Intronic
1182774223 22:32819038-32819060 GTGAGCCAGAGGAAAGTGGAGGG + Intronic
1182886391 22:33777630-33777652 GGGAGGGAGGGGAAGGGGGAGGG + Intronic
1182949627 22:34360904-34360926 GTGGGTGGGGGGAAAGGGGAGGG + Intergenic
1184100767 22:42340843-42340865 GAGGGGGAGGGGAAAGGGGAGGG + Intronic
1184307657 22:43617521-43617543 ATGAGGAAGGGGAAAATGGATGG - Intronic
1184336382 22:43855596-43855618 GGGAGCGAGAGGAGAGTGGAGGG - Intronic
1184412857 22:44335640-44335662 GTGTGTGAGGTGTGAGTGGATGG + Intergenic
1184529956 22:45049066-45049088 TTGAGTGAGGGGAATGATGAAGG + Intergenic
1184674246 22:46031918-46031940 GTCAGTGATGGGGAAGTGGGGGG + Intergenic
1184731309 22:46372497-46372519 GTGGGTGGGGGGTGAGTGGATGG - Intronic
1184777084 22:46628635-46628657 GTGTCTGAGGGGCAGGTGGAGGG + Intronic
1184951616 22:47847069-47847091 GTGAGTGAATGGAGAGTGGATGG + Intergenic
1185004882 22:48270025-48270047 GAGAGGGAGGGGACAGGGGACGG + Intergenic
949247104 3:1938067-1938089 GGGAGTGTGGGGCAAGGGGAGGG + Intergenic
950456992 3:13098635-13098657 CTGAGCTAGGGGAAAATGGATGG + Intergenic
950697705 3:14716312-14716334 GTGAGAGAGGGGCAAGTGTTGGG + Intronic
950761813 3:15236882-15236904 GTGAGTGAGTGGTGAGTGAATGG + Intronic
950904382 3:16524573-16524595 GAGAGAGAGGGGAGAGGGGATGG - Intergenic
950922222 3:16705959-16705981 GTGAGTGAGGGGAGGCTGAAGGG - Intergenic
950958640 3:17081248-17081270 GTGAGGGAGGAGAAGGAGGAGGG - Intronic
951548114 3:23849498-23849520 GAGGGTGAGGGGTAAGGGGAGGG - Intronic
951719135 3:25679618-25679640 GAGGGCGAGGGGAAAGGGGAAGG + Intergenic
952022977 3:29045042-29045064 GAGAGGGAGGAAAAAGTGGAGGG + Intergenic
952192967 3:31043197-31043219 GTCAGGGAGGGGAGGGTGGAGGG - Intergenic
952640410 3:35587591-35587613 TTGAGTGGGGGGAAAGGGGAGGG - Intergenic
952763096 3:36933146-36933168 GGGAGAGAGGGGAAAGGGGAAGG - Intronic
952936254 3:38400525-38400547 GTGAACGAGGGGAGAGAGGAGGG + Intronic
953223360 3:40994818-40994840 GTGAGTGAGTGGTGAGTGAATGG + Intergenic
953287203 3:41622599-41622621 GGGAGTGGAGGGAAAGGGGAGGG + Intronic
953317442 3:41942034-41942056 GTGGTTGAGGTGAAGGTGGAGGG - Intronic
954840752 3:53509335-53509357 GTGAGTTAGGGGAAAGGTGGAGG + Intronic
955422990 3:58758679-58758701 GTGGGTGAGGGGAAGGGGGAGGG - Intronic
956474701 3:69607888-69607910 GAGAGGGAGGGGAAAGAGGATGG + Intergenic
956570666 3:70690888-70690910 GTGGGTGAGGGGCAAGGGGAGGG - Intergenic
957108055 3:75917179-75917201 GTGGGTGGGGGAAAAGAGGAGGG - Intronic
957530883 3:81439537-81439559 ATGAGTGCGGGTAAAGTTGAAGG + Intergenic
957564280 3:81865073-81865095 GTGAGGAAGGGGAAGGGGGAGGG - Intergenic
957755660 3:84483081-84483103 GAGGCTGAGGGGAAAGAGGATGG + Intergenic
957958802 3:87224244-87224266 GGGGGTGGGGGGAAAGGGGAGGG - Intergenic
958182416 3:90077097-90077119 GTGAGGGAGGGGAAAGAGAGAGG + Intergenic
958567344 3:95830996-95831018 GAGAGAGAGGGGAGAGTGAAGGG + Intergenic
958677409 3:97283606-97283628 GGGGGTGAGGGGCAAGGGGAGGG + Intronic
958725637 3:97902597-97902619 GGGAGTGAGGGGCGAGGGGAAGG - Intronic
958951077 3:100416874-100416896 CTGGGTTAGGGGAAAGGGGAGGG - Intronic
959563711 3:107812993-107813015 GTGTGGGAGGGAAAAGTGTAAGG - Intergenic
959698889 3:109279364-109279386 GTGAGTGAGAGGACAGGGCAAGG + Intergenic
959832167 3:110876865-110876887 GGGGGTGAGGGGCAAGGGGAGGG - Intergenic
959995523 3:112676448-112676470 GAGATGGAGAGGAAAGTGGAAGG + Intergenic
960138240 3:114126998-114127020 GTGAGTGAGCGGTGAGTGGATGG + Intergenic
960786498 3:121378169-121378191 GGGGGTGGGGGGAAAGGGGAGGG + Intronic
961171680 3:124801827-124801849 GGGAGGGAGGGGAGAGTGGCTGG - Intronic
961204524 3:125070734-125070756 GTGAGTGAGAGGTAGGTGAATGG + Intergenic
961425939 3:126847846-126847868 GTAAGAGAGGGGAAGGAGGACGG - Intronic
961849703 3:129803337-129803359 GAGAGTGAGGGGAGGGTAGAAGG + Intronic
961872229 3:129996832-129996854 GTGAATGAGGGGAGAGTAGGAGG - Intergenic
962140122 3:132781388-132781410 GGGGGTGAGGGGCAAGGGGAGGG + Intergenic
962249149 3:133824399-133824421 ATGGGTGAGGGGAAAGTGAGGGG + Exonic
962340052 3:134575154-134575176 GGGAGGGAGGGGAAGGGGGACGG - Intergenic
962520398 3:136193444-136193466 GTGAGGTAGGGGGAAGAGGAAGG - Intronic
962718796 3:138152864-138152886 TGGAGTGGGGGGAAAGTGCAAGG - Intergenic
963229173 3:142892444-142892466 GTGGGGCAGGGGAAAGAGGAAGG - Intergenic
963280924 3:143384162-143384184 GTCAGTGAGGAGAAAGGAGAGGG + Intronic
964516212 3:157511234-157511256 GGGGGTGTGGGGAAAGGGGAGGG + Intronic
964612877 3:158632439-158632461 TTGAGTGAGGGGCAGGGGGAGGG + Intergenic
964712663 3:159687741-159687763 GAGAGTGAGGGGCAAGGGGAGGG - Intronic
965284225 3:166796576-166796598 TTGAGTGAGGGGAGAGTAGAGGG + Intergenic
965558503 3:170040024-170040046 GAGGGTGGGGGGAAAGGGGAGGG + Intronic
965800658 3:172490611-172490633 GGGAGTGGGGGGCAAGGGGATGG - Intergenic
965844732 3:172947778-172947800 GGGAGTGAGGGGCAAGGGGAAGG + Intronic
965858563 3:173119156-173119178 GGGGGTGTGGGGAAAGGGGAGGG + Intronic
965868598 3:173238051-173238073 GAGACTGAGGGGAGAGTGCAGGG - Intergenic
966101728 3:176277556-176277578 GGGTGTGAGGGGCAAGGGGAGGG - Intergenic
966202020 3:177367469-177367491 GTGGGTGAGAAGAAAGTGGGTGG + Intergenic
966300108 3:178469405-178469427 GGGAGTTGGGGGAAAGGGGAGGG - Intronic
966374833 3:179285778-179285800 GGGAGTGGAGGGCAAGTGGAGGG - Intergenic
966559815 3:181307746-181307768 GGGAGTGGGGGGCAAGAGGAGGG + Intergenic
966594726 3:181715382-181715404 GTGGGGGAGGGGAAAGGGGTGGG + Intergenic
966894469 3:184433196-184433218 GTGGGTGGGGGGAAAGGGGAGGG - Intronic
967003988 3:185365915-185365937 GGGAGGGAAGGGAAAGGGGAGGG - Intronic
967271361 3:187736209-187736231 GTGAGTGAGTGGGGACTGGAGGG + Intronic
967487613 3:190052232-190052254 GGGGGTGAGGGGCAAGAGGAAGG - Intronic
967700951 3:192591689-192591711 GTGAGTGACAGGAAAGGGGATGG + Intronic
967799308 3:193638244-193638266 CTGAGTGAGGGGAGAGTGGTAGG + Intronic
968339315 3:197941473-197941495 GGGAGGGAGGGGAAGGGGGAGGG - Intronic
968940087 4:3633281-3633303 GGGAGGGAGGGGAAGGGGGAGGG - Intergenic
969273993 4:6122743-6122765 GTCAGGGAGGGGGATGTGGAGGG + Intronic
969364646 4:6687148-6687170 GGGAGTCAGGGGGATGTGGATGG - Intergenic
969481386 4:7448795-7448817 GGGAGGGAGGGAAAAGAGGAAGG - Intronic
969481514 4:7449136-7449158 GGGAGAGAGGGAAAAGAGGAAGG - Intronic
969677119 4:8620286-8620308 GTGAGAGAGGGGACAGGAGAGGG - Intergenic
969678072 4:8625925-8625947 GTGAGAGAGGGGACAGGAGAGGG - Intergenic
969679027 4:8631562-8631584 GTGAGAGAGGGGACAGGAGAGGG - Intergenic
969682935 4:8653178-8653200 GTGAGAGAGGGAAAAATAGAGGG - Intergenic
969711331 4:8845917-8845939 GAGAGAGAGGGGAAAAGGGAAGG + Intergenic
970489291 4:16555845-16555867 GTGAGTGAGGGCGGAGTGGTTGG - Intronic
971109288 4:23565111-23565133 GGGAGTGAGGGGGAGGTGAAGGG - Intergenic
971185381 4:24370922-24370944 GGGAGTGAGGGGCAAGGGGAGGG - Intergenic
971500958 4:27317551-27317573 GGGGGTGGGGGGAAAGGGGAAGG - Intergenic
971871198 4:32241283-32241305 GTGGGTGGGGGGAAAGGGGAGGG + Intergenic
972919392 4:43919645-43919667 GGGAGTGGGGGGCAAGAGGAGGG - Intergenic
973210971 4:47615176-47615198 GTGAGTGATGGGAGACTAGAAGG + Intronic
973589352 4:52425053-52425075 GGGAGTGGGGGGCAAGGGGAGGG - Intergenic
973816410 4:54623405-54623427 GTGAGGAAGGCGAGAGTGGAAGG - Intergenic
973835627 4:54806456-54806478 GGGAGGGAGGGGAAAAAGGAAGG + Intergenic
974126353 4:57701159-57701181 ATGAGGGAGGGGAATATGGAGGG - Intergenic
974738395 4:65971774-65971796 GTGAGTGATTGCAAAGTAGAGGG - Intergenic
975350829 4:73344041-73344063 GTGAATTAGGGGGAAGTGCAGGG + Intergenic
975446503 4:74471666-74471688 GTGAGAGAGGGAAAGCTGGAAGG + Intergenic
975547314 4:75573247-75573269 GTGAGTAAAGGCAGAGTGGAAGG - Intergenic
976221058 4:82757159-82757181 GAGAGTGACGGGAAAGGAGATGG - Intronic
976497753 4:85750026-85750048 GTACGTGAGGGGCAGGTGGATGG - Intronic
976665639 4:87587956-87587978 GTGGGTGGGGGGAAAGGAGAGGG + Intergenic
977122502 4:93120595-93120617 GGGAGTGAGGAGCAAGGGGAGGG + Intronic
977398321 4:96499442-96499464 GGAAGTGAGGGGTAAGGGGAGGG - Intergenic
977572420 4:98643052-98643074 GTGAGTGAGTGGTGAGTGAAAGG - Intronic
977687512 4:99865079-99865101 GAGAGTGAGTGGACAGTGGTGGG - Intronic
977877887 4:102170022-102170044 GTTAGTGAGGATAACGTGGATGG - Intergenic
977959139 4:103065075-103065097 GTGGGGGAGGTGAAAGTGGCAGG + Intronic
978167948 4:105631455-105631477 GTGAGTTTGGGGAAAGAAGACGG - Intronic
978429028 4:108613770-108613792 GTGAGTGAGTGGTGAGTGAATGG - Intergenic
978467729 4:109027388-109027410 GTGAGTGAGGAAAAAGAGTAAGG + Intronic
978692570 4:111532924-111532946 GGGAGTGGGGGGCAAGGGGAGGG - Intergenic
978989500 4:115061622-115061644 GGGGGTGAGGGGCAAGGGGAGGG + Intronic
979711890 4:123789654-123789676 GTGGGTGGGGGGCAAGGGGAGGG - Intergenic
979780736 4:124648484-124648506 GTGAGTGAGTGGTGAGTGAATGG + Intergenic
979788783 4:124751200-124751222 GGGGGTGAGGGGCAAGGGGAGGG + Intergenic
979921204 4:126498718-126498740 GTGGGTCAGGGGGAAGGGGAGGG + Intergenic
979981335 4:127258913-127258935 GTGAGTAAGGGGATAATGGAAGG - Intergenic
980139942 4:128902619-128902641 GTGAGTGAGTGGAGAATGAATGG + Intronic
980157063 4:129120605-129120627 GGGGGTGAGGGGAAAGGGGAGGG - Intergenic
980420692 4:132556322-132556344 CTGTGTGAGGGGAAAGTGCCAGG + Intergenic
980549762 4:134319755-134319777 GTGAGTGAAAGGAAAAGGGAAGG + Intergenic
980896998 4:138869158-138869180 GAGGGTGAGGGGAGAGGGGAGGG + Intergenic
981037067 4:140182825-140182847 GTGAGTGAGTGGTGAGTGAATGG - Intergenic
981395523 4:144244283-144244305 GGGGGTGGGGGGCAAGTGGAGGG - Intergenic
981443946 4:144813013-144813035 GTGGGTAGGGGGAAAGGGGAGGG + Intergenic
981661365 4:147170723-147170745 TTGCGTGGGGGGAAAGGGGAGGG + Intergenic
982007456 4:151077066-151077088 GTGGGTGGGAGGAAAGGGGAGGG - Intergenic
982140372 4:152311698-152311720 ATGGTTGGGGGGAAAGTGGAGGG - Intergenic
982181307 4:152751011-152751033 GTGAGTGGGGGGAGGGAGGAGGG + Intronic
982199373 4:152945198-152945220 GAGAGAGAGAGGAAAGTGGCAGG + Intronic
982551451 4:156805773-156805795 GTGAGAGGGGGAAAAGAGGAGGG - Intronic
982708591 4:158737266-158737288 GTAAGGGAGGGGAAAGGGAAGGG + Intergenic
982988412 4:162239495-162239517 GTGGGTGGGGGGCAAGGGGAGGG + Intergenic
983003840 4:162457275-162457297 GTGAGTGAGTGGTGAGTGAATGG + Intergenic
983365004 4:166775219-166775241 GTGGATGAGGAGAAAGTGGCAGG + Intronic
983523413 4:168734937-168734959 GAGAGAGAGGAGAAAGAGGAGGG + Intronic
983991680 4:174127655-174127677 GTGGGTTACAGGAAAGTGGAAGG - Intergenic
984478234 4:180264903-180264925 GGGAGTGAGGGGAAGGGGCATGG - Intergenic
984637979 4:182134416-182134438 CTGAGTTAGGGGAAAGAGAAGGG - Intergenic
985128384 4:186717855-186717877 GTGGATGAGGAGAAAGTGGTTGG - Intronic
985965475 5:3336167-3336189 CTGAGTGATGGGAAAGTTTAAGG - Intergenic
986118871 5:4811522-4811544 GGGAGTGGGGGGCAAGGGGAGGG - Intergenic
986152913 5:5143979-5144001 GGGGGTGAGGGGCAAGGGGAGGG + Intronic
986775947 5:11013888-11013910 GTGAGAGAGGGGAGAGGGGAGGG - Intronic
986822495 5:11482861-11482883 GGGAGTGAGGGGAGAGAGCAGGG + Intronic
987717721 5:21593579-21593601 GAGAGTGAGAGGATAGTGTAGGG + Intergenic
987852372 5:23373199-23373221 GGGAGTGGGGGGCAAGGGGAGGG - Intergenic
988443483 5:31258487-31258509 GTGGGTGAGGGGCTAGGGGAGGG + Intronic
988451184 5:31344605-31344627 GTGAGAGAGGGCAGAGTGCACGG - Intergenic
988664964 5:33316362-33316384 GTGATTGAGTGGGAAGAGGATGG + Intergenic
988735984 5:34021764-34021786 CAGGGTGAGGGGAAAGGGGAGGG + Intronic
989200741 5:38760343-38760365 GTGAGTGTGGGTAAAAGGGAGGG + Intergenic
989281332 5:39646937-39646959 GTGAGGGAGAGGAGAGTGGTAGG + Intergenic
989474417 5:41857552-41857574 GTGGGTGAGGGGAAAATGTTGGG + Intronic
989687155 5:44103781-44103803 GGGGGTGGGGGGAAAGGGGAGGG - Intergenic
989809328 5:45653769-45653791 GTGGGTGGGGGGAGAGGGGACGG + Intronic
990059609 5:51630896-51630918 GTGAGTCAGGGGGAAGGGGAGGG + Intergenic
990064597 5:51697315-51697337 GAGAGAGAGGAGAAAGTGAAGGG + Intergenic
990410475 5:55535719-55535741 GTGAGGGAGGTGACGGTGGATGG - Intergenic
990530983 5:56673484-56673506 GTGAGCGAGGAGACAGTGGAAGG + Intergenic
990589068 5:57243401-57243423 GGGACTGAGAGGAAAGGGGAGGG - Intronic
990624795 5:57598733-57598755 GGGAGTGAGGGAAAAGGAGAGGG - Intergenic
990649788 5:57885354-57885376 TTGAATATGGGGAAAGTGGAAGG + Intergenic
990982111 5:61611156-61611178 TGGAGTGAGGGGTATGTGGAGGG + Intergenic
991375274 5:65958656-65958678 GTGAGGGAGGGGGAGGGGGAGGG + Intronic
991379200 5:66001955-66001977 GGGAGTGAGGGGAAAGTGGAGGG - Intronic
991494863 5:67216878-67216900 GCAAGTGAGGGAAAAGTGGAAGG + Intergenic
991687578 5:69195839-69195861 GGGTATGAGGGGAAAGTGGAGGG + Intronic
991950903 5:71946036-71946058 GTGAGTGAGGTCACAGGGGAGGG + Intergenic
992029314 5:72705218-72705240 GGGAGGGAGGGTAAAGGGGAAGG + Intergenic
992771816 5:80055726-80055748 GTGGCAGAGGGGGAAGTGGAGGG - Intronic
993034916 5:82746187-82746209 GTAAGAGAGGGGAAGGTGGTTGG + Intergenic
993077935 5:83258038-83258060 GTGGGTGAGGAGCAAGAGGAGGG + Intronic
993374411 5:87133180-87133202 GTGAGTGAGTGGTGAGTGAATGG + Intergenic
993707383 5:91186424-91186446 GCCCGTGAAGGGAAAGTGGAAGG + Intergenic
993764064 5:91833573-91833595 GGGTGTGGGGGGAAAGGGGAGGG - Intergenic
993904957 5:93612319-93612341 GGGGGTAAGGGGAAAGGGGAGGG + Intergenic
994002189 5:94793107-94793129 GAGAGGGAGGGGACAGTGGTGGG + Intronic
994155190 5:96495409-96495431 GGGAGTGGAGGGAAAGAGGAGGG - Intergenic
994594156 5:101809124-101809146 GGGGGTGAGGGGCAAGGGGAGGG + Intergenic
994792358 5:104245528-104245550 GTGAGTGGGGGGAAGTGGGAGGG + Intergenic
995122373 5:108549829-108549851 GGGAGTGAGTGGAAGGTGGTGGG + Intergenic
995294419 5:110502672-110502694 GTGAGTGAGGGGAAAGTGGAAGG - Intronic
995518105 5:112974246-112974268 GTGTGTGAGGAGGCAGTGGAGGG + Intergenic
995543014 5:113202737-113202759 GGGGCTGAGGGGAAAGTAGAAGG - Intronic
995551413 5:113285495-113285517 GTGAGCAGGGGGAGAGTGGAAGG - Intronic
995867363 5:116706055-116706077 TTGAGGGAAAGGAAAGTGGAAGG - Intergenic
996060193 5:119024466-119024488 GGGGGTGAGGGGAAAGGGGAGGG - Intergenic
996262758 5:121493757-121493779 GTGAGTGAGACGAAACTGGAAGG - Intergenic
996495606 5:124151544-124151566 TGGAGTTAGGGGAAAGGGGATGG + Intergenic
996800561 5:127398065-127398087 GGGGGTGGGGGGAAAGGGGAGGG + Intronic
997056196 5:130447866-130447888 GTGGGTGGGGGAAAAGGGGAGGG + Intergenic
997089553 5:130841380-130841402 GGGAGTGGGGGGCAAGGGGAGGG - Intergenic
997149675 5:131479986-131480008 GTCAGTGGGGGGAAAGGGAAAGG + Intronic
997368408 5:133340324-133340346 GTGAGTGTGGGGTGTGTGGAAGG + Intronic
997394938 5:133552140-133552162 GGGGGAGAGAGGAAAGTGGAGGG - Intronic
997424052 5:133791036-133791058 GTGAGTGAGGGGACTGTGGTAGG - Intergenic
997428196 5:133818748-133818770 GTGAGGCAGGGGAAGGTGTAGGG - Intergenic
997866554 5:137468891-137468913 GTGGGTGAGGGGACAGTTGTCGG - Intronic
998025481 5:138811942-138811964 GAGAGGGAGGGGAAGGGGGAGGG + Intronic
998704573 5:144743940-144743962 GTGGGTGAGGGGGAAAGGGAAGG - Intergenic
999084765 5:148877661-148877683 GGGAGTGAGCGGAAAGGGGAAGG + Intergenic
999195014 5:149775921-149775943 GTCAGGGAGAGGAAAATGGAAGG - Intronic
999569001 5:152897521-152897543 GGGAGTGAGGGTAAAGCAGAAGG + Intergenic
999612871 5:153389629-153389651 GTGAAAGAGGGGAAAGGGAATGG - Intergenic
999645405 5:153712500-153712522 GGGAAAGAGGGGAAAGAGGAAGG - Intronic
999926012 5:156378653-156378675 TTGAGTGATGGGAAAATGGTAGG - Intronic
1000102674 5:158031782-158031804 GGGGGTGAGGGGCAAGGGGAGGG - Intergenic
1000579576 5:163018698-163018720 GTGGGTGGGGGGCAAGGGGAGGG + Intergenic
1000812973 5:165885623-165885645 GTAAGTGAGGAGAAAGGTGAGGG - Intergenic
1000964359 5:167637812-167637834 GTGGGTTGGGGGAAAGGGGAGGG + Intronic
1001110690 5:168893712-168893734 GTGAGTGAGGGGGAGGTGGCAGG + Intronic
1001149688 5:169216352-169216374 GTGAGAGAAGGGAAAAGGGACGG - Intronic
1001290644 5:170456309-170456331 GAGGGTGGGGGGCAAGTGGAGGG + Intronic
1001362119 5:171097777-171097799 GGGAGTGTGGGGCAAGGGGAGGG - Intronic
1001946919 5:175786871-175786893 GTGAATGAGGGGAAAGTGGTTGG - Intergenic
1002303646 5:178271278-178271300 GGGGGTGAGGGGACAGTGGTGGG - Intronic
1002851796 6:1003320-1003342 GAAAGTGAAGGGAACGTGGAGGG + Intergenic
1003215904 6:4111542-4111564 ATGAGTAGGGTGAAAGTGGAAGG - Intronic
1003299058 6:4860323-4860345 GGGAGTGAGGGGAATATGGATGG - Intronic
1003343800 6:5246632-5246654 GGTAGTGAGGGTGAAGTGGAGGG + Intronic
1003384085 6:5651355-5651377 GTCAGTGAGGAGAAAATCGAGGG - Intronic
1004030026 6:11859411-11859433 GTGAGAGAGGGGAGAGTGGAGGG + Intergenic
1004050144 6:12069374-12069396 GTGAGTGGGTGGTGAGTGGATGG + Intronic
1004169244 6:13283278-13283300 GTGAGTGAGGGGCAGGGGCAGGG - Intronic
1004535897 6:16501465-16501487 GTGAGTGGGGGGCAAGGGGAGGG - Intronic
1004578518 6:16923970-16923992 GTGAGTGAGTGGTGAGTGAATGG + Intergenic
1004993062 6:21160856-21160878 GAGAGTGGGGGGCAAGGGGAGGG - Intronic
1005083053 6:21976571-21976593 GGGAGTTGGGGGAAAGGGGAGGG + Intergenic
1005207972 6:23426856-23426878 GTGGGTGAGGGGATAGGAGAGGG - Intergenic
1005217169 6:23543983-23544005 ATGAGTGAGGGGGATGTGGAAGG + Intergenic
1005234899 6:23748333-23748355 GGGGGTGAGGGGCAAGGGGAGGG + Intergenic
1005364138 6:25060505-25060527 GTGTGTGTGTGGAAAGGGGAGGG + Intergenic
1005387918 6:25304272-25304294 GTGAGGGTGGGGATAGAGGATGG + Intronic
1005986935 6:30881491-30881513 GAGAGTGGAGGGAAAGAGGAGGG - Intronic
1006200502 6:32284642-32284664 GGGTGTGAGGGGCAAGAGGAGGG + Intergenic
1006430584 6:33993324-33993346 CTGAGTGAGTGGGAAGTGGAAGG + Intergenic
1006510801 6:34520083-34520105 GTGAGTGATGGGAGGGAGGATGG + Intronic
1006739199 6:36295216-36295238 GTGAGGGATGGGACACTGGATGG + Intronic
1006984186 6:38166643-38166665 GGGAGTGCGGGGGAGGTGGAGGG - Intergenic
1007298199 6:40844944-40844966 GTGAGGAAGGGTACAGTGGAAGG + Intergenic
1007649656 6:43411178-43411200 GGGGGTGAGGGGCAAGGGGAGGG + Intergenic
1008273079 6:49512442-49512464 GGGGGTGAGAGGAAAGGGGAGGG - Intronic
1008475550 6:51931991-51932013 GGGAGAGAGGAGAAAGAGGAAGG + Intronic
1009378364 6:62999397-62999419 GGGAGAGAGAGGAAAGGGGAAGG + Intergenic
1009507120 6:64498614-64498636 GTGGGTGGGGGGAAAGGGGAGGG - Intronic
1009942964 6:70310537-70310559 GTTAGTGAGGTCAGAGTGGATGG - Intergenic
1009944791 6:70330777-70330799 GGGAGTGAGGGGCTAGGGGAGGG - Intergenic
1010769374 6:79811121-79811143 GTGGGAGAGGGGAAAGAAGAGGG + Intergenic
1010803250 6:80202698-80202720 GGGAGGGAGGGAAAAATGGAGGG - Intronic
1010889822 6:81292845-81292867 ATGAGTGAGAGGAACTTGGAGGG + Intergenic
1011190079 6:84719293-84719315 GAGAGAGAGGGGAAAGAGAAAGG - Intronic
1011414510 6:87103538-87103560 GGGAAAGAGGGGAAAGAGGAAGG + Intergenic
1011609958 6:89141143-89141165 GAGAGTGAGGGGCAAATTGATGG - Intergenic
1011710012 6:90043515-90043537 GTGAGGGAGGAGAGAGAGGAAGG - Intronic
1011787741 6:90865687-90865709 GAGAGTGAAGAGAAAGTGAAAGG + Intergenic
1011831002 6:91371537-91371559 GGGGGTGAGGGGCAAGAGGAGGG - Intergenic
1011833326 6:91401067-91401089 GTGGGAGAGGGGAGAGGGGAGGG - Intergenic
1012627727 6:101424708-101424730 GTGGGTGGGGGGAGAGGGGAGGG - Intronic
1012833698 6:104238925-104238947 CTGAGAGAGGGGAAAGTTGCTGG - Intergenic
1012864238 6:104598242-104598264 GTGAATGAAGTGAAAATGGAGGG + Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013637895 6:112046665-112046687 GTGAGTGAGTGGTGAGTGAATGG - Intergenic
1013651632 6:112200882-112200904 GTGGGTGGGGGGCAAGGGGAGGG + Intronic
1014308704 6:119771756-119771778 AGGAGAGAGGGGAAAGGGGAAGG + Intergenic
1014426411 6:121312193-121312215 GGGAATGAGGGGCAAGGGGAGGG + Intronic
1014537618 6:122634208-122634230 GGGAGTGTGGGGCAAGGGGAGGG + Intronic
1015075495 6:129151681-129151703 GAGAGAGAGGAGAAAGTGAATGG + Intronic
1015177811 6:130329915-130329937 GGGGGTGGGGGGAAAGGGGAGGG + Intronic
1015189835 6:130460602-130460624 GTGGGTGAGAAGAGAGTGGATGG - Intergenic
1015286847 6:131495267-131495289 GTGATCCAAGGGAAAGTGGATGG - Intergenic
1015319245 6:131853668-131853690 GTGTGTGAGGGTAAGGTGGGAGG + Intronic
1015334568 6:132022491-132022513 GTGAGAGTGGGGAAAGGAGAAGG + Intergenic
1015401308 6:132791647-132791669 GTGGGTGAGGGCAGAGAGGATGG + Intronic
1015679834 6:135793512-135793534 GTGAGGGAGGGAACAGGGGAAGG + Intergenic
1015702431 6:136051121-136051143 GTGAGTGAGGGGAGTGGGGGCGG + Intronic
1015764288 6:136699545-136699567 GTGGGCGAGGGGAGAGTGGCAGG - Intronic
1015860986 6:137679505-137679527 GAGAGAGAGAGGAAAGGGGAGGG + Intergenic
1016307665 6:142700395-142700417 GTGGGTGTGGGGAGATTGGAGGG + Intergenic
1016363727 6:143293921-143293943 GAGAGTGAGGTGGAGGTGGAGGG - Intronic
1016428890 6:143962720-143962742 GTGAATGAGCTGAAACTGGAAGG - Intronic
1016730744 6:147425052-147425074 GGGGGTGAGGGGCAAGGGGAGGG - Intergenic
1016873120 6:148838314-148838336 GTGAGTGTGGGGACAGTGCCAGG + Intronic
1016948793 6:149560544-149560566 GTGAGTGAGGGGGAAAGGGAAGG + Intergenic
1017054833 6:150427406-150427428 CTGAGGGAGGGGAATGAGGAAGG + Intergenic
1017643378 6:156515871-156515893 GTGAGTGAGGCAAAGGTGGGTGG - Intergenic
1017927709 6:158924644-158924666 GAGAGTGAGGGGGAAGGGAAGGG + Intergenic
1017961554 6:159226559-159226581 GAGACTGAGGGGAAAGTGAAAGG + Exonic
1018062768 6:160103542-160103564 GTGATTGAGTGGAAAGAAGATGG - Intronic
1018203116 6:161413315-161413337 GGAAGTGAAGGGAAAGCGGAGGG - Intronic
1018619426 6:165715659-165715681 GTGTGTGAGGGGCTAGTGCATGG + Intronic
1018822430 6:167383617-167383639 GGGTGTGAGGGGAATGTGAATGG + Intronic
1019202304 6:170327937-170327959 GTGAGCGAGTGGGAAGTGAATGG + Intronic
1020035193 7:4959756-4959778 GTGGGGGAGCGGAAAGTGGGGGG + Intergenic
1021213293 7:17883702-17883724 GGGGGTGAGGGGCAAGGGGAGGG - Intronic
1021226469 7:18033752-18033774 GGGAGTCGGGGGAGAGTGGAAGG - Intergenic
1022109130 7:27217285-27217307 GTGTGTGTGGGGAAGGTGGTGGG + Intergenic
1022976276 7:35559225-35559247 GTGAGTGAGGGAAAAATGAAGGG + Intergenic
1023156395 7:37256582-37256604 GGGAGGGAGGGAAAAGGGGAGGG + Intronic
1023575123 7:41619004-41619026 GTCATAGAGGGGAAAGTGGGAGG + Intergenic
1024014953 7:45305230-45305252 GTGAGTGAGCAGGATGTGGAAGG + Intergenic
1024434327 7:49331769-49331791 GGGGGTGAGGGGAAAGGGGAGGG + Intergenic
1024514100 7:50229429-50229451 GGGGGTGATGGGAAAGAGGAAGG + Intergenic
1025034512 7:55585258-55585280 GTGGGGGATGGGACAGTGGAGGG + Intergenic
1026120869 7:67536145-67536167 GGGTGTTAGGGGAAAGCGGAGGG - Intergenic
1026171759 7:67960103-67960125 GTGAGTCAGGGGAATATGCAGGG + Intergenic
1026292709 7:69022717-69022739 GGGAGTAAGGGGCAAGGGGAGGG - Intergenic
1026311188 7:69186085-69186107 CTGAGGCAGGGGAAAGTGGCAGG - Intergenic
1026774680 7:73223957-73223979 GTGAGTGTGGGGACGGAGGAGGG + Intergenic
1027015539 7:74777348-74777370 GTGAGTGTGGGGATGGAGGAGGG + Intronic
1027072493 7:75168609-75168631 GTGAGTGTGGGGACGGAGGAGGG - Intergenic
1027541780 7:79476249-79476271 AGGAGTGAGGGGAAAAGGGAGGG - Intergenic
1027988658 7:85329858-85329880 GTGGGTGGGGGGAGGGTGGAGGG - Intergenic
1028023985 7:85813609-85813631 GGGAGAGAGAGCAAAGTGGAAGG + Intergenic
1028454722 7:91026637-91026659 GTGAGGGAGGGGAGAGACGATGG - Intronic
1028720598 7:94026645-94026667 GGAGGTGAGGGGAAAGGGGAGGG - Intergenic
1028740720 7:94271263-94271285 GTGGGTGAGGGGAGAGGGGAGGG + Intergenic
1028778952 7:94714006-94714028 GTCGGTGGGGGGAAAGAGGACGG - Intergenic
1028966464 7:96807198-96807220 GAGAGAGAGGAGAAAGTGAAGGG + Intergenic
1029020215 7:97357234-97357256 AGGAGTGGGGGGAAGGTGGAAGG + Intergenic
1029188326 7:98755036-98755058 GCGGGAGAGGGGAAAGGGGAAGG - Intergenic
1029486035 7:100841933-100841955 TTGAGAGAAAGGAAAGTGGAAGG - Intronic
1029628271 7:101734073-101734095 GTGAGGGTGGGGATAGTGGGAGG - Intergenic
1030099336 7:105931347-105931369 GAGAGGAAGGGGAAAGAGGAGGG - Intronic
1030169112 7:106583985-106584007 GTGAGTGAGCGAAAAGGGAAGGG + Intergenic
1030377246 7:108767903-108767925 GTGGGTGGGGGGCAAGGGGAGGG - Intergenic
1031081245 7:117259057-117259079 GGGAGTGTGGGAAAAGTGGGAGG - Intergenic
1031370745 7:120962549-120962571 GTGAGTTAGGGCAAGGTGTATGG + Intronic
1031666700 7:124493024-124493046 GGGAGTGAGGGGATAGGTGAGGG + Intergenic
1031710677 7:125042517-125042539 GGGGGTGGGGGGAAAGGGGAGGG + Intergenic
1032408721 7:131676857-131676879 GTGGGTGAGGGGCTAGGGGAGGG - Intergenic
1032454919 7:132065949-132065971 GCAGGGGAGGGGAAAGTGGAGGG - Intergenic
1032591931 7:133199859-133199881 GTGAGTGGGGGTCAAGGGGATGG - Intergenic
1032724782 7:134580712-134580734 GGGAGTCAGGGGAATGGGGATGG - Intergenic
1032888963 7:136172780-136172802 GAGGGTGAGGGGCAAGGGGAGGG + Intergenic
1033652556 7:143353788-143353810 GTGGGGGAGGGGACAATGGAGGG + Exonic
1033991369 7:147291311-147291333 TGGAGTGAGGGGAAAGGGGAGGG - Intronic
1034065874 7:148136070-148136092 GAGAGGGAGGGGGAGGTGGAAGG + Intronic
1034277239 7:149829296-149829318 ATGACTGAGGGGACTGTGGAGGG - Intergenic
1034277322 7:149829571-149829593 GGGACTGAGGGGACTGTGGAGGG - Intergenic
1034277384 7:149829786-149829808 GTGACTGAGGGGACTGTGGGGGG - Intergenic
1034277412 7:149829865-149829887 GTGACTGAGGGGACTGTGGGGGG - Intergenic
1034277472 7:149830056-149830078 GGGACTGAGGGGACTGTGGAGGG - Intergenic
1034277505 7:149830168-149830190 ATGACTGAGGGGACTGTGGAGGG - Intergenic
1034277517 7:149830207-149830229 GGGACTGAGGGGACTGTGGAGGG - Intergenic
1034277550 7:149830319-149830341 GTGACTAAGGGGACTGTGGAGGG - Intergenic
1034277571 7:149830396-149830418 GTGACTGAGGGGACTGTGGGGGG - Intergenic
1034277638 7:149830622-149830644 GTGACTGAGGGGACTGTGGAGGG - Intergenic
1034277659 7:149830701-149830723 GTGACTGAGGGGACTGTGGGAGG - Intergenic
1034277682 7:149830782-149830804 GTGACTGAGGGGACTGTGGAGGG - Intergenic
1034277700 7:149830858-149830880 ATGACTGAGGGGACTGTGGAGGG - Intergenic
1034277711 7:149830896-149830918 GTGACTGAGGGGACTGTGGGAGG - Intergenic
1034277723 7:149830937-149830959 GTGACAGAGGGGACTGTGGAGGG - Intergenic
1034396505 7:150829689-150829711 GTGAGTCTGGGGAAAGGGGGAGG - Intronic
1034691027 7:153013751-153013773 GGGAAGGAAGGGAAAGTGGAGGG + Intergenic
1035435855 7:158858831-158858853 GGAAGGGAGGGGAAAGGGGAGGG - Intronic
1035892712 8:3363045-3363067 GAAACCGAGGGGAAAGTGGAGGG - Intronic
1035925731 8:3725743-3725765 GTTAGTGAGGGCAGAGTGGAAGG + Intronic
1036081120 8:5557085-5557107 GTGGGTGGGGGGAAGGGGGAGGG - Intergenic
1037547965 8:19941642-19941664 GTGAGTAGAGTGAAAGTGGAGGG - Intronic
1037669248 8:21000216-21000238 TTGAGAGGGGGCAAAGTGGATGG + Intergenic
1037886583 8:22599208-22599230 GAGAGGGAGGGGAGAGGGGAGGG - Intronic
1037886627 8:22599309-22599331 GCGAGGGAGGGGAAAGGAGAGGG - Intronic
1038232478 8:25714982-25715004 GTGAGGGAGGGAAAAAGGGAGGG - Intergenic
1038400919 8:27283976-27283998 GTGAGTGATGGGGCAGTGGCGGG - Intergenic
1039412012 8:37362741-37362763 AGGGGTGAGGGGAAAGGGGAGGG + Intergenic
1039802320 8:40969833-40969855 GGGAGTGAGGGGCAAGGGGAGGG + Intergenic
1041500170 8:58531684-58531706 GTGGGTGAGGGGCAAGGGGAGGG + Intergenic
1041729311 8:61048818-61048840 GTGAGGGAGGGGAAGAGGGAAGG - Intergenic
1042164044 8:65928015-65928037 GTGAGTGAGTGGTGAGTGAATGG + Intergenic
1042837356 8:73090766-73090788 GTGAGTGGGGGAAAAGGAGATGG - Intronic
1043101679 8:76055105-76055127 ATGAGTGAGGGGGAAGTACAAGG - Intergenic
1043326842 8:79062757-79062779 GGGGGTGAGGGGAAAAGGGAGGG + Intergenic
1043508478 8:80926119-80926141 GTGAGGGAGGAGAGAGTGGGAGG - Intergenic
1043516170 8:80996792-80996814 TTGAGTGAGGGGAAGGTGGAGGG + Intronic
1043532969 8:81171185-81171207 GGGAGTGGGGGGCAAGGGGAGGG + Intergenic
1043871078 8:85433694-85433716 GGGAGTGGGGAGAAAGTGGAGGG + Intronic
1043990998 8:86754522-86754544 GGGGGTGGGGGGAAAGGGGAGGG - Intergenic
1044313225 8:90719346-90719368 GGGTGTGGGGGGAAAGGGGAGGG + Intronic
1044405790 8:91824470-91824492 GGGGGTGGGGGGAAAGGGGAGGG + Intergenic
1044514972 8:93127188-93127210 GTGGGTGAGTGGAGAGTGAATGG + Intergenic
1044773149 8:95658928-95658950 GAGAAGGAAGGGAAAGTGGAGGG - Intergenic
1044944865 8:97380469-97380491 GTGACTGAGGAGAAAGTGACAGG - Intergenic
1045494020 8:102693046-102693068 GAGAGTGTGGACAAAGTGGACGG + Intergenic
1045567032 8:103329902-103329924 ATGAGAGAGGTGAAAGCGGACGG + Exonic
1045619479 8:103957607-103957629 GGGAGTGAGGGGCTAGAGGAGGG + Intronic
1045709548 8:104966998-104967020 GTGTGAGTGGGGAAAGTGGGAGG - Intronic
1045881521 8:107045958-107045980 GAGAGGGAGGGGAAAGCAGAGGG + Intergenic
1046004579 8:108463934-108463956 GTGAATGAGGGGTTAGTGGAGGG - Intronic
1046117616 8:109803247-109803269 GCGATGGAGGGGAAAATGGAAGG - Intergenic
1046330577 8:112709751-112709773 GAAAGTGAAGGGAAAGTGTAAGG + Intronic
1046436731 8:114199241-114199263 GGGAGAGAGGAGAAAGAGGAAGG - Intergenic
1046587198 8:116162130-116162152 GCAAGTGAGGGGAGACTGGATGG - Intergenic
1046994083 8:120496254-120496276 GTGAGTGATGGGAAGGAAGAGGG + Intronic
1047006048 8:120621451-120621473 GTGAGAAATGGGAAAGTGGAGGG + Intronic
1047054655 8:121150700-121150722 GTGGGTGGGGGGCAAGGGGAGGG + Intergenic
1047086871 8:121527371-121527393 GTGAGTGGGGGGCTAGGGGAGGG - Intergenic
1047325796 8:123834713-123834735 GTGAGTGAGAGGACAGAGGATGG - Intergenic
1047557174 8:125944931-125944953 ATGAGAAAGGGGAAAGTGTAGGG + Intergenic
1047907936 8:129492747-129492769 GGGGGTGGGGGGAAAGGGGAAGG + Intergenic
1048114303 8:131504685-131504707 CTGAGTGAGATGATAGTGGAGGG - Intergenic
1048146611 8:131851169-131851191 GAGAGTGAGTGGAAATTAGAAGG - Intergenic
1048296440 8:133218052-133218074 GTGAAGGAGGGGACAGAGGAAGG - Intronic
1048516570 8:135116800-135116822 GAGGGGGAGGGGAAAGGGGAGGG - Intergenic
1048630435 8:136236458-136236480 GAGAGTGAAGAGAAAGAGGAGGG - Intergenic
1048862596 8:138735016-138735038 GTGGGTTGGGGGAAAGGGGAGGG + Intronic
1049361145 8:142213062-142213084 GTGAGGGAGGGGAGACAGGAAGG - Intronic
1049529585 8:143147723-143147745 GGGAGTGTGGGGACAGGGGAGGG + Intergenic
1049541194 8:143209971-143209993 CTGACTGAGGGGCAAGTGTAGGG - Intergenic
1050175582 9:2866580-2866602 GTGAGTCAGAGGAGAGGGGAGGG + Intergenic
1050396671 9:5205170-5205192 GTGATCAAGAGGAAAGTGGAGGG - Intergenic
1050427192 9:5523489-5523511 GTGAGTGAGAGGAATGTGACTGG - Intronic
1050472671 9:6008360-6008382 GTGAGGGGGGAGAAAGGGGAGGG + Intergenic
1050525823 9:6545501-6545523 GTGAGTGAGTGGTGAGTGAACGG + Intronic
1050595164 9:7197732-7197754 GTGAGTGAGAGGAAAAGGGTGGG - Intergenic
1050615958 9:7402050-7402072 GTGTGTGTTGGGAAAGGGGATGG - Intergenic
1050897722 9:10904515-10904537 GTGAATGAGGGGAAAGGTGAAGG + Intergenic
1050897784 9:10905683-10905705 GTGAATGAGGGGAAAGGTGAAGG + Intergenic
1050963938 9:11772193-11772215 GGGGGTGGGGGGAAAGGGGAGGG + Intergenic
1051451089 9:17198670-17198692 GGGAGTGGGGGGCAAGGGGAGGG - Intronic
1051705068 9:19869475-19869497 GTTAGTGAAGGGAAAGCAGAAGG - Intergenic
1051718076 9:20006331-20006353 GTGGGTGAGGGGAGGGGGGATGG + Intergenic
1052143494 9:25019729-25019751 GGGAGTGGGGGGCAAGGGGAGGG - Intergenic
1052323424 9:27192669-27192691 GGGAGGAAGGGGAAAGAGGAAGG + Intronic
1052839925 9:33284133-33284155 GTGAATTAAAGGAAAGTGGAAGG + Intergenic
1053163205 9:35827936-35827958 GTGAGGAAGGGGAAAGAGAAGGG + Intronic
1053440581 9:38112927-38112949 GTGGGTGAGGGGGAAGAGGTGGG + Intergenic
1053635186 9:39990969-39990991 GGGCGTGGGGGGAAAGGGGAGGG + Intergenic
1053770746 9:41473342-41473364 GGGCGTGGGGGGAAAGGGGAGGG - Intergenic
1054208701 9:62259729-62259751 GGGCGTGGGGGGAAAGGGGAGGG - Intergenic
1054316103 9:63588411-63588433 GGGCGTGGGGGGAAAGGGGAGGG + Intergenic
1054450663 9:65401992-65402014 GGGAGGGAGGGGAAGGGGGAGGG + Intergenic
1054549477 9:66385166-66385188 GGGCGTGGGGGGAAAGGGGAGGG - Intergenic
1054739595 9:68791361-68791383 GGGAGTGAGGGGATGATGGATGG + Intronic
1054925590 9:70585637-70585659 GTGATAGTGGGAAAAGTGGATGG - Intronic
1055535989 9:77245021-77245043 ATGAGTGAGGGGAGAGTGGAGGG + Intronic
1055763238 9:79632461-79632483 GTGTCTGCCGGGAAAGTGGAGGG - Intronic
1056265219 9:84890175-84890197 GTGAGGGAGGGGGAAGTAAAGGG - Intronic
1056870473 9:90272788-90272810 GGATGTGAGAGGAAAGTGGAGGG + Intergenic
1057195954 9:93115716-93115738 GTGAGGGAGGGGATAAGGGAGGG + Intergenic
1057275782 9:93675408-93675430 GCGGGTGAGGGTAATGTGGAAGG - Intronic
1057414989 9:94853488-94853510 GTGAGTGAGGTGAGACTGAATGG - Intronic
1057431137 9:94995288-94995310 GTTTCTGAGGGGAAAGAGGAAGG + Intronic
1057494447 9:95549687-95549709 GTGAGTGGGTGGAGAGTGAATGG - Intergenic
1057545773 9:96019853-96019875 GTGAGAGAGAGGAAGGGGGACGG + Intergenic
1057734080 9:97637077-97637099 GTGAGTGAGGGGGAAGTTGTAGG + Intronic
1058093555 9:100833033-100833055 GTGGGTGGGGGGAAGGAGGAGGG + Intergenic
1058307430 9:103460918-103460940 GGGAGAGAGGGGAAAGGGGAAGG - Intergenic
1058346530 9:103970190-103970212 GTGAGAGAGGGGAAGGTGGGGGG - Intergenic
1058726392 9:107808605-107808627 GGGAGTTGGGGGAAAGGGGAGGG + Intergenic
1058943504 9:109835357-109835379 GGGATAGAGGGGAAGGTGGAGGG + Intronic
1059054598 9:110966125-110966147 GGGAGTGGGGGAAAAGGGGAGGG + Intronic
1059382449 9:113936982-113937004 GTGAGCGAGGGGAATGAGGTTGG - Intronic
1059842035 9:118228420-118228442 GTGTGTGAGGGGACAGGGAATGG - Intergenic
1060756189 9:126215638-126215660 GTGAGTGAGGGGAAGGCCGGTGG - Intergenic
1060947721 9:127579856-127579878 GGGAGTGTGGGGCAAGGGGAGGG + Intergenic
1060975387 9:127762109-127762131 GTGAGTGCAGGGTAAGAGGACGG - Intronic
1061716240 9:132520133-132520155 CTGAGTGAGAGGAGAGGGGAGGG - Intronic
1062119597 9:134827232-134827254 GTGATTGAGGGGTAAGGGGATGG - Intronic
1062141397 9:134961049-134961071 GTGTGTGATGGGAGAGGGGAGGG + Intergenic
1062708729 9:137960190-137960212 CTGAGTGAGGGGGAGGGGGAGGG + Intronic
1203365348 Un_KI270442v1:250720-250742 GGGAGAGAGAGAAAAGTGGATGG + Intergenic
1185625730 X:1480671-1480693 GGGGGTGAGGGGATAGAGGAGGG + Intronic
1185839490 X:3375414-3375436 GTGAATCAGGGCAAAGAGGAAGG + Intergenic
1186112089 X:6269200-6269222 GTGTGTGAGGGGAAGGTGAGCGG - Intergenic
1187237249 X:17479045-17479067 GGGAGTGAGGGGCTAGGGGAGGG - Intronic
1187634672 X:21213517-21213539 GTGTGTCAGGGGATAGTGGTGGG + Intergenic
1187685861 X:21815020-21815042 GAGAGTGAGATGAAGGTGGAGGG - Intergenic
1188036214 X:25320044-25320066 GGGAGTGGGGGGACAGCGGAGGG - Intergenic
1188345114 X:29054394-29054416 GAGACTGAGGGGTAAGTGGGAGG - Intronic
1188821009 X:34775068-34775090 GGGGTTGGGGGGAAAGTGGAGGG + Intergenic
1188924367 X:36021658-36021680 GGGGGTGGGGGGAAAGGGGAGGG - Intergenic
1189298630 X:39936354-39936376 GTGAGGGAGGGGAAAGGGGCAGG + Intergenic
1189777248 X:44481603-44481625 GAGTGTCAGGGGAAAGAGGAAGG + Intergenic
1189892964 X:45624651-45624673 AGAAGTGAGGGGAAAGTGGCTGG + Intergenic
1190256031 X:48762830-48762852 GTGAGTGAGAGATAAGTGGGAGG - Intronic
1190336357 X:49265141-49265163 GTGAGTGAGAGGATATTTGAGGG + Intergenic
1190493693 X:51007122-51007144 GGGGGTGAGGGGCAAGGGGAGGG - Intergenic
1190693313 X:52930597-52930619 GTGGGTGGGGGGATAGAGGAGGG + Intronic
1190739436 X:53279754-53279776 GTGCGGGAGGGGAAAAGGGAAGG + Intronic
1191772580 X:64777354-64777376 GTGAGTGTGGGGGATGTGGGTGG - Intergenic
1192211564 X:69131111-69131133 ATGAATGCGGGGAAAGTGTAAGG + Intergenic
1192403340 X:70859141-70859163 CTGAGTGATGGGTAAATGGAGGG + Intronic
1192656451 X:72999829-72999851 GTGTGAGAGGGGATAGAGGAAGG - Intergenic
1192665669 X:73083172-73083194 GTGTGAGAGGGGATAGAGGAAGG + Intergenic
1192758657 X:74072142-74072164 GCGGGTGGGGGGAAAGGGGAGGG - Intergenic
1192957556 X:76089390-76089412 GGGGGTGAGGGGCAAGGGGAAGG - Intergenic
1192998976 X:76542727-76542749 GGGAGTGAGGGGCTAGGGGAGGG - Intergenic
1193096559 X:77555705-77555727 GGGGGTGGGGGGAAAGGGGAGGG + Intronic
1193235845 X:79106306-79106328 GGGGGTTAGGGGTAAGTGGAGGG + Intergenic
1193401700 X:81053530-81053552 GGGGGTGAGGGGCAAGAGGAAGG - Intergenic
1193579539 X:83247183-83247205 GTGAGTGGGGGGAGGGGGGAGGG + Intergenic
1194031390 X:88820226-88820248 GTGGGTGGGGGGCAAGGGGAGGG + Intergenic
1194216857 X:91140873-91140895 GTCTGTGAAGGGATAGTGGAGGG - Intergenic
1194336475 X:92653641-92653663 GTGGGTGGGGGGAAAGGAGAGGG - Intergenic
1194348509 X:92796022-92796044 GCGAGGGAGGGGGAAGGGGAGGG + Intergenic
1194356829 X:92895975-92895997 GTGTGTGATGGCAAAGTGGTGGG + Intergenic
1194456220 X:94106913-94106935 GGGGGTGAGGGGCAAGGGGAGGG + Intergenic
1194492140 X:94565172-94565194 GGGGGTGAGGGGCAAGGGGAGGG - Intergenic
1195573674 X:106425185-106425207 GTGAGCCAGGGTAGAGTGGAAGG - Intergenic
1196019070 X:110970596-110970618 GTGGGTGGGGGGAAAGAGGAGGG + Intronic
1196064932 X:111453724-111453746 GTGAGAGTGGTGGAAGTGGAAGG + Intergenic
1196503205 X:116410232-116410254 GAGAATGAGGGCCAAGTGGAAGG - Intergenic
1196544003 X:116941421-116941443 GTGAGTGGGGGGAGGGAGGAGGG - Intergenic
1196568319 X:117235025-117235047 GTGGGAGTGGGGAAAGAGGAAGG - Intergenic
1197088139 X:122503675-122503697 ATTAGAGAGGGGAAAGTGGAAGG - Intergenic
1197157035 X:123282303-123282325 GGCAGTGAAGGGAAAGAGGAGGG - Intronic
1197618036 X:128715950-128715972 GGGGGTGGGGGGAAAGGGGAGGG + Intergenic
1197865540 X:131012792-131012814 GGGAGTGAGGAGGAAGTGGTTGG + Intergenic
1198042896 X:132871780-132871802 GGGAGTGAGGGGCTAGGGGAGGG + Intronic
1198445356 X:136708213-136708235 GGGAGTGGGGTGAAAGGGGAGGG + Intronic
1198773121 X:140151616-140151638 GAGGGTGGGGGGAAAGGGGAGGG - Intergenic
1199372021 X:147060663-147060685 GTGGGTGATAGGAAAGTGCAGGG - Intergenic
1199435099 X:147804248-147804270 GTGAGTGAGGGGTGGGTGGAAGG + Intergenic
1199951274 X:152708204-152708226 GGGAGTAAGGGGAAAGAGGTGGG - Intergenic
1199958409 X:152760257-152760279 GGGAGTAAGGGGAAAGAGGTAGG + Intergenic
1200230198 X:154440136-154440158 ATGAGTGAGGGGAAGCTGGGTGG + Exonic
1200230731 X:154442747-154442769 GTGGGTGATGGGAACGTGGTGGG - Exonic
1200251398 X:154556139-154556161 GTGGCAGAGGGGACAGTGGAGGG - Intronic
1200266369 X:154648277-154648299 GTGGCAGAGGGGACAGTGGAGGG + Intergenic
1200665161 Y:6012969-6012991 GTGTGTGATGGCAAAGTGGTGGG + Intergenic
1200689120 Y:6288810-6288832 GTGGGGTAGGGGGAAGTGGAGGG - Intergenic
1201046153 Y:9885912-9885934 GTGGGGTAGGGGGAAGTGGAGGG + Intergenic
1201328979 Y:12798053-12798075 GGGAGGGAAGGGAAAGGGGAAGG - Intronic
1201328985 Y:12798069-12798091 GAGAGGGAGGGGAAGGGGGAGGG - Intronic
1201854545 Y:18527071-18527093 GGGAGTAGGGGGCAAGTGGAAGG + Intergenic
1201878776 Y:18793314-18793336 GGGAGTAGGGGGCAAGTGGAAGG - Intronic
1202132918 Y:21630853-21630875 GTGACTGAGGCTAAAGAGGAAGG - Intergenic
1202173411 Y:22074913-22074935 GGGAGTAGGGGGTAAGTGGAAGG - Intronic
1202217949 Y:22511461-22511483 GGGAGTAGGGGGTAAGTGGAAGG + Intronic
1202325236 Y:23684598-23684620 GGGAGTAGGGGGTAAGTGGAAGG - Intergenic
1202545535 Y:25985456-25985478 GGGAGTAGGGGGTAAGTGGAAGG + Intergenic