ID: 995297882

View in Genome Browser
Species Human (GRCh38)
Location 5:110541063-110541085
Sequence ACAAGGATCCTGGTGGTACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 2, 2: 3, 3: 16, 4: 137}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995297873_995297882 17 Left 995297873 5:110541023-110541045 CCCAACAGGAACAGCTAATACAG 0: 1
1: 0
2: 0
3: 12
4: 159
Right 995297882 5:110541063-110541085 ACAAGGATCCTGGTGGTACATGG 0: 1
1: 2
2: 3
3: 16
4: 137
995297874_995297882 16 Left 995297874 5:110541024-110541046 CCAACAGGAACAGCTAATACAGG 0: 1
1: 0
2: 0
3: 7
4: 129
Right 995297882 5:110541063-110541085 ACAAGGATCCTGGTGGTACATGG 0: 1
1: 2
2: 3
3: 16
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995297882 Original CRISPR ACAAGGATCCTGGTGGTACA TGG Intronic
900438070 1:2640871-2640893 ACCAGGTTGCTGGTGGTAGAAGG + Intronic
902764756 1:18606854-18606876 ACAAGGATGATGGTGGTGCCAGG - Intergenic
904052124 1:27646087-27646109 TCAAGGATCCTGGGGGTCCCTGG + Intergenic
905244451 1:36602905-36602927 ACAAGGATGGTGGTGGTGCTAGG + Intergenic
905736363 1:40329570-40329592 AAATGGATCCTAGTGGTAGATGG + Intergenic
906346847 1:45021023-45021045 AAAAGGATCCTGAGGGTAGAGGG - Intronic
909988427 1:82191467-82191489 ACAAGGAGGATGGTGGTAAAAGG - Intergenic
913539519 1:119805473-119805495 ACAAAGACCGTGGTGGTAGAGGG - Intronic
914858120 1:151366687-151366709 CCAAGGCTCCTGCTGGCACATGG + Intronic
917623892 1:176826424-176826446 ACAAGCATCCTGGAGATAAAGGG + Intronic
918515473 1:185358506-185358528 GCTAGGATCCTGGAGGTCCATGG - Intergenic
919756538 1:201069593-201069615 ACACGGATCCTGGTGGGGCGAGG + Exonic
919801491 1:201357273-201357295 ACAAGGACCCTGCTGGGAGAGGG + Intergenic
920786504 1:209047408-209047430 ACAGGGATCCTGGTGTTTCAGGG - Intergenic
924396376 1:243625599-243625621 ACAATGTTCCTGGTGGTCAAAGG - Intronic
1067332508 10:45334677-45334699 ACAAGGGTCCTGGTGTCACGGGG + Intergenic
1067687461 10:48475778-48475800 AGAAGGATCCTGGTAGAAGATGG + Intronic
1073317367 10:102592546-102592568 ACAAGGATCCTCATTGTTCAAGG - Intronic
1075828823 10:125385271-125385293 GCTAGGATCCTGGAGGTCCATGG + Intergenic
1076014291 10:127015364-127015386 ACAGGGCTCCTGGTGGGAGACGG - Intronic
1080276979 11:30513730-30513752 ACATGGATCCTGGTATAACATGG + Intronic
1081552737 11:44129233-44129255 AGAATGATCCTGTTGGAACATGG + Intronic
1083304662 11:61756139-61756161 ACCAGTATCCTGGTGCTTCAGGG - Intronic
1083864478 11:65446103-65446125 ACAAGGTGCCGGGTGGGACAGGG + Intergenic
1087129409 11:94655451-94655473 ACAAGGATCCTGGTGGCATATGG + Intergenic
1087322487 11:96679646-96679668 AGAAGGATTTTGGGGGTACAGGG + Intergenic
1088444842 11:109914979-109915001 AAAAGGAAACTGGTGGTAGAAGG - Intergenic
1092850928 12:12625737-12625759 ACAAGAATGCTGGTGGTGGAGGG - Intronic
1093662793 12:21775899-21775921 ACTAGGATCCTGGGCTTACAGGG - Intergenic
1094604495 12:31938808-31938830 ACAAGGATCCTGGTGGTATATGG - Intergenic
1096111521 12:49031816-49031838 ATAAGGCTCCTGGTGGGGCAGGG + Exonic
1102590805 12:113955459-113955481 ACAGGGACCCTGGGGCTACAAGG + Intronic
1102618877 12:114177783-114177805 ACAAGGAACCTGGCAGTATACGG + Intergenic
1103023189 12:117553212-117553234 ACAAGGAGCCAGATGGTAAATGG + Intronic
1103618606 12:122171703-122171725 ATAATGACCCTGGTGGTACACGG - Intronic
1104407685 12:128531905-128531927 ACAAGGCTCCTGGTGGCAGACGG + Intronic
1105866271 13:24462137-24462159 ACTAGGCTCCTGGTGGGGCAGGG - Intronic
1108142913 13:47444747-47444769 AAAAGGATCTTGGTGGTAGGGGG + Intergenic
1110328322 13:74242728-74242750 CCAAGGATACTGGGGATACAAGG + Intergenic
1112448542 13:99489177-99489199 AAAAGGATCCTGGTGGCATATGG - Intergenic
1113506237 13:110818412-110818434 ACAAGGGTCCTGGCTGTACCTGG + Intergenic
1114458966 14:22874971-22874993 ACAAGGGGCCTGGTGGCACCAGG + Intronic
1116955551 14:50919475-50919497 ACAAGGATCTTGGGGGGACTAGG - Intronic
1120118126 14:80643710-80643732 AAAAAAATCGTGGTGGTACATGG + Intronic
1121675234 14:95747027-95747049 CCAATGGTCCTGGAGGTACAGGG + Intergenic
1126806351 15:52353147-52353169 ACATTGATCCTGCTGGTCCAGGG + Intronic
1128838869 15:70833205-70833227 ACAGGGATTCTAGTGTTACAGGG - Intronic
1130992874 15:88887050-88887072 ACAAGGGCCCTGCTGGAACAGGG + Intronic
1132233913 15:100205135-100205157 TCCAGGATCCTGGAGGTACCTGG - Intronic
1135610416 16:23861505-23861527 ACAAGGAGGCTGGTGGTTCCAGG + Intronic
1138177382 16:54912895-54912917 CCAGGGATCATGGTAGTACATGG - Intergenic
1140582056 16:76242101-76242123 ACAAGGATTCTGGAGGTAGATGG - Intergenic
1142000432 16:87661220-87661242 ACAAGGACCCTTGTGGTTCGGGG + Intronic
1143437311 17:6938937-6938959 CCCAGGATGCTGGTGGTACATGG - Intronic
1143834431 17:9678950-9678972 ACCAAGATCCTTGTGTTACATGG - Intronic
1147339221 17:39743997-39744019 AGAAACATCCTGGTGGTAGAGGG + Intronic
1152504547 17:80739206-80739228 CAAAGGATCCTGGTGGCACAGGG + Intronic
1152917413 17:83048356-83048378 AAAAGTATCCTGGTGGTAATTGG - Intronic
1153603580 18:6807962-6807984 ACAGTGATCCTGGAGGAACAGGG - Intronic
1155092143 18:22522461-22522483 ACAAAGATGCTAGTGGCACATGG - Intergenic
1155606439 18:27611654-27611676 ACAAGGACAGTGGTGGTACAAGG + Intergenic
1159518092 18:69483620-69483642 ACAAGGACTCTAGTGTTACAAGG - Intronic
1162333672 19:10046664-10046686 ACAAGGAGTCTGATGGAACATGG + Intergenic
1168338542 19:55610930-55610952 ACAAGGGGCCTGGTGGGAGAGGG - Intronic
927216055 2:20668294-20668316 TCAAGGATCCTGGTGGTGTGGGG + Intronic
928394545 2:30933399-30933421 ACAAGGATACAGGTATTACAGGG + Intronic
931535608 2:63272014-63272036 ACAAGCAACCTGGAGGTCCAAGG + Intronic
931900367 2:66781656-66781678 AGAATGAAGCTGGTGGTACAAGG - Intergenic
932095888 2:68847982-68848004 ACAATGATCCTGGTGGAAGGAGG + Intergenic
933140827 2:78791729-78791751 ACATTAATCCTGGTGGTACTGGG + Intergenic
933995843 2:87669238-87669260 AAAAGGATCGTGGTGGTAGCAGG + Intergenic
935391327 2:102556185-102556207 AGCAGGGTCCTGGTGGAACAGGG + Intergenic
936298014 2:111281674-111281696 AAAAGGATCGTGGTGGTAGCAGG - Intergenic
937447600 2:121971897-121971919 ACAAGCATAATGGTGCTACATGG + Intergenic
938213001 2:129484362-129484384 ACGAGGATCCTGGAGGTACCAGG + Intergenic
940376692 2:152966017-152966039 AAAAGGATCTTGGTGGCATATGG - Intergenic
947004715 2:225497622-225497644 ACAAGGATCCTGAGGGATCATGG + Intronic
948410213 2:237753644-237753666 ACAATTAGCCAGGTGGTACATGG + Intronic
1169953408 20:11073817-11073839 AGAAACAGCCTGGTGGTACAAGG + Intergenic
1172811316 20:37650160-37650182 CCAAGGATCTGCGTGGTACATGG - Intergenic
1174801648 20:53568532-53568554 TCAAGGATCCTGGAGGTTCCAGG + Exonic
1175392059 20:58633748-58633770 ACAGGGATCCTGGTGATCAATGG - Intergenic
1177787695 21:25690015-25690037 TAAAGGATCCTGGTTGTACTTGG - Intronic
1177892564 21:26824519-26824541 TCAAGAATCCTGGTGGAACGTGG + Intergenic
1178155991 21:29854717-29854739 ACTAGGATCATGATGGTTCAAGG + Intronic
1179278726 21:39915536-39915558 AGAAGGATTCTGGAGGTAGATGG + Intronic
1180170350 21:46055111-46055133 ACAGGGATCCTGCAGGTTCAGGG + Intergenic
1180730158 22:17975317-17975339 CCAAGGATCTTGGTGGCTCACGG + Intronic
1183390082 22:37540748-37540770 ACAAGAAGCCTGGTGGGAGATGG - Intergenic
954048684 3:47954378-47954400 CCAAAGATCCTGGTGGGCCAAGG - Intronic
954424879 3:50438070-50438092 GCCAGGATGCTGGTGGGACAGGG + Intronic
955515506 3:59722627-59722649 ACATGGATACTGGTGGGTCAGGG - Intergenic
956101454 3:65772510-65772532 AGAATGATCATGGTGCTACAAGG + Intronic
961040018 3:123671638-123671660 TCAAGGATCCTGGAGGTGAAAGG + Intronic
961372471 3:126440056-126440078 ACAAGGTTGGTGGGGGTACAGGG - Intronic
963264988 3:143231098-143231120 ACAAGCTTCCAGGTGGTACAGGG - Intergenic
963903546 3:150755205-150755227 AGAGGGATCCTGGGGGTAAAAGG + Intronic
965214890 3:165850168-165850190 ATAAGGAATCTGGAGGTACATGG + Intergenic
968324696 3:197803443-197803465 ACAAGCACCCTGATGGTACTAGG + Intronic
969160417 4:5252904-5252926 ACAACAATCCTGGTGAGACAAGG - Intronic
970416945 4:15867611-15867633 CCAAGGTTCCTGGTCATACAGGG + Intergenic
971077085 4:23162493-23162515 CCAAGCTTCCTGTTGGTACAGGG - Intergenic
972057495 4:34822594-34822616 ACAGAGATACTGGTGGGACAAGG + Intergenic
972481987 4:39505617-39505639 AAAAGGACACTGGTGATACAAGG - Exonic
973944288 4:55941623-55941645 ACAAGGATCTTGGTAGTATATGG - Intergenic
975041384 4:69747745-69747767 GCTAGGATCCTGGAGGTCCATGG + Intronic
975443144 4:74435642-74435664 ACAAGGATCCTGGTGGTATATGG - Intergenic
976592134 4:86859636-86859658 ACAAGGATTCTGGTGGGGCCAGG + Intergenic
976750728 4:88449292-88449314 ACAGGGATCTTGGTGGTATAAGG + Intergenic
977286049 4:95108377-95108399 ACTAAGATCTGGGTGGTACAAGG - Intronic
979794983 4:124834774-124834796 GGATGGATCCTGGTGGTACCAGG + Intergenic
980980613 4:139651628-139651650 CCAAGGATCCCGGTGGGAGACGG + Intergenic
985516551 5:348215-348237 AACAGGCTCCTGGTGGCACAGGG - Intronic
985697231 5:1347515-1347537 GCAAGGAACCTGTTAGTACATGG + Intergenic
987050109 5:14142354-14142376 AGAGTGATCCTTGTGGTACAGGG - Intergenic
995297882 5:110541063-110541085 ACAAGGATCCTGGTGGTACATGG + Intronic
995598687 5:113773834-113773856 CCAAGGATCCTGGTGGTATATGG - Intergenic
997382136 5:133445554-133445576 CCAAGGATCCTTGTGGAACCTGG + Intronic
998922420 5:147084342-147084364 ACAGGTAGCCTGGTGGTAAAAGG - Intronic
1000296808 5:159919367-159919389 ACAAAGATCATGGTTGTACATGG + Intronic
1000464219 5:161555249-161555271 AAAAGGATCATGGTGGCAGAAGG - Intronic
1001885549 5:175287180-175287202 ACGAAGATCCAGGTGGTAGACGG + Intergenic
1002201269 5:177529939-177529961 AGAAGGATCCTGGTTGTCCTTGG + Intronic
1005122341 6:22403467-22403489 TAAACAATCCTGGTGGTACAAGG - Intergenic
1009488269 6:64253684-64253706 GCAAGGGTCCTGCTGGTTCAGGG - Intronic
1009968628 6:70603822-70603844 AGAAGGATCATCATGGTACATGG + Intergenic
1011757151 6:90511653-90511675 GCAATGATCCTGCTGCTACATGG + Intergenic
1014841499 6:126225292-126225314 GCTAGGATCCTGGAGGTCCATGG + Intergenic
1021263459 7:18488665-18488687 ACAAGGTTACTAGTAGTACAAGG + Intronic
1022665444 7:32406188-32406210 AGAAGGAGCCTGATGGTGCAGGG - Intergenic
1022841865 7:34172157-34172179 ACAAGGATCCACAAGGTACAAGG - Intergenic
1023890188 7:44386409-44386431 ACAGAGATCCTGGTGGAAAAGGG - Intronic
1027342394 7:77223137-77223159 CCAAGGATCCTGGGGGGAGATGG - Intronic
1027417731 7:77990656-77990678 TGAAGGATCCTGGTGGTGCCAGG + Intergenic
1027719196 7:81717274-81717296 TCATGGACCCTGGTGCTACACGG - Exonic
1033256368 7:139805094-139805116 GCAGGGATCCTGGTGGTGCTGGG + Intronic
1035132199 7:156665848-156665870 ACAATGATTCTGATGGTACGTGG - Intronic
1035472737 7:159120458-159120480 AAAAGAATCCTGGTGGCCCAGGG - Intronic
1035562581 8:617272-617294 AGAATGTTCCTGGTGGTTCAGGG + Intronic
1040709979 8:50176262-50176284 ACAATGATTCTGGTGGCACATGG - Intronic
1043592633 8:81848019-81848041 ATAAGTATCCGGGTGGTATATGG + Intergenic
1043684489 8:83069228-83069250 AAAAGGATTCTCGTAGTACATGG + Intergenic
1046382909 8:113473847-113473869 AAAAGGATCCTGGTGGTATGTGG - Intergenic
1046454488 8:114440624-114440646 ACTAGGATCCCGGAGGTCCATGG - Intergenic
1048150335 8:131887573-131887595 ACCAGGAGGCTGGTGGTAGAGGG + Intergenic
1048431791 8:134377601-134377623 ACAGGGATGCAGGTGGTAGAGGG - Intergenic
1048753881 8:137713125-137713147 AGAAGGACCCTGATGGTCCATGG - Intergenic
1052600297 9:30619262-30619284 CCAAGAATGCTGGTGGTTCAAGG - Intergenic
1052641466 9:31171360-31171382 ACAAGGATTTTGGAGTTACATGG - Intergenic
1056463437 9:86830269-86830291 ACAAGGATCCTGAAGGTGCAGGG - Intergenic
1057123507 9:92598564-92598586 ACAAGGGTCCAGTTGGAACAAGG + Intronic
1057951215 9:99370304-99370326 ACAAGCATTCTGGTGGTGGAGGG - Intergenic
1059529518 9:115023169-115023191 ATAAGCATCCTTGTGGTCCAGGG + Intronic
1061332785 9:129907126-129907148 AAAAGGAAACTGGTGTTACAAGG - Intronic
1061864748 9:133486357-133486379 ACCAGGATCCAGGTGGGAAAAGG - Intergenic
1187623190 X:21081775-21081797 AGAAAGATCCTGGAGGGACATGG - Intergenic
1192369500 X:70501629-70501651 ACATGGATGCTGATGGTAAAGGG - Intronic
1195144427 X:101999439-101999461 TCCAGGATTCTGGAGGTACATGG - Intergenic
1197794602 X:130285768-130285790 ACAAGGATCCTGGTGGTATTGGG + Intergenic