ID: 995301165

View in Genome Browser
Species Human (GRCh38)
Location 5:110585103-110585125
Sequence CTACTTAAGAAGAAGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 219}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995301165_995301171 8 Left 995301165 5:110585103-110585125 CCCAGCTCCTTCTTCTTAAGTAG 0: 1
1: 0
2: 0
3: 17
4: 219
Right 995301171 5:110585134-110585156 CTTTACATGGTAAAAAGCTTTGG 0: 1
1: 0
2: 1
3: 19
4: 195
995301165_995301169 -5 Left 995301165 5:110585103-110585125 CCCAGCTCCTTCTTCTTAAGTAG 0: 1
1: 0
2: 0
3: 17
4: 219
Right 995301169 5:110585121-110585143 AGTAGGTGAAGACCTTTACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995301165 Original CRISPR CTACTTAAGAAGAAGGAGCT GGG (reversed) Intronic
902785549 1:18730702-18730724 CTACTTTAAAAGAAGGGGATGGG - Intronic
904549322 1:31302286-31302308 ATATAGAAGAAGAAGGAGCTAGG - Intronic
905848804 1:41257802-41257824 CTACTTAAGAAAAAGCAGTCTGG + Intergenic
906735385 1:48121196-48121218 CCATTTAAGAGGTAGGAGCTTGG - Intergenic
907375003 1:54029565-54029587 TTACTTTAGGAGAAGGGGCTTGG + Intergenic
907531021 1:55097100-55097122 CAACTTCAGAAGAAGAATCTTGG + Exonic
910837244 1:91527978-91528000 GTCCTTAAGAAAAAGGAGCAGGG + Intergenic
913389211 1:118291745-118291767 CTACTTACAAAGAAGTAGCCAGG + Intergenic
913443915 1:118929318-118929340 ATAATTAAGAAGATGGAGATTGG + Intronic
914340582 1:146756417-146756439 CTATTTAAAAAGAATGAGCTAGG + Intergenic
915559832 1:156680491-156680513 CTAGCAAAGAAGAAAGAGCTGGG + Intergenic
915980470 1:160416900-160416922 CTTCTGAGGAAAAAGGAGCTGGG - Intronic
918617370 1:186561224-186561246 CAAGTTAAGAAGAAAGAGCAAGG + Intergenic
919190995 1:194218624-194218646 CTACTCAAGAAGAAATATCTAGG - Intergenic
919774825 1:201187615-201187637 CTACCCAGGAAGATGGAGCTGGG - Intergenic
919871144 1:201822470-201822492 CTACTTGAGAAAAAGGAGAGGGG + Exonic
920991430 1:210943650-210943672 CTGCTTAAAAAGAAGGAGAGAGG - Intronic
922166656 1:223121137-223121159 CTACTTATAAAGAAGATGCTTGG - Intronic
922480417 1:225936823-225936845 CCTCTTAAAAAGGAGGAGCTGGG - Exonic
923628600 1:235634608-235634630 CTAATTAGGAACAAGGAGCCAGG - Intronic
923774634 1:236967413-236967435 CTACAAAAGATGAGGGAGCTTGG + Intergenic
1064261870 10:13792570-13792592 CGAATTAAAAAGAAGGAGATGGG - Intronic
1067664195 10:48259852-48259874 CTACTTAAGAAGGAGTTTCTAGG + Intronic
1067818174 10:49499603-49499625 CTACTGAAACACAAGGAGCTCGG + Intronic
1071587042 10:86833709-86833731 CTAGTTCAAAAGAAGGATCTGGG + Intronic
1074506304 10:114073900-114073922 TTAGTAAAGAAGAAGCAGCTGGG + Intergenic
1074691397 10:116007808-116007830 TTACTGAAGAGGGAGGAGCTCGG + Intergenic
1075202128 10:120413023-120413045 CCACTTTAGAAGCAGGAGCCTGG + Intergenic
1075871725 10:125775879-125775901 CTCCTTAAGGAGCAGGACCTAGG + Intergenic
1077073300 11:687789-687811 CTAGTTAAGAAGACAGGGCTGGG - Intronic
1078172024 11:8935480-8935502 CTACTGAAGAAGACAGAGATAGG + Intergenic
1078618131 11:12883716-12883738 CTTCTTAAGAAGAAGTGGCCAGG + Intronic
1078733858 11:14001706-14001728 CTACTTAAGAAGGAGTTTCTAGG + Intronic
1078924263 11:15859731-15859753 CTATTTGAGAAACAGGAGCTGGG + Intergenic
1080682845 11:34492117-34492139 CGGCTCCAGAAGAAGGAGCTTGG - Intronic
1080789548 11:35509801-35509823 CTACTTAGGAGGAAAGAGCTGGG + Intronic
1081193076 11:40128128-40128150 CTACTTAGGAAGGTGCAGCTCGG - Intronic
1083222445 11:61261915-61261937 GTGCTTCAGGAGAAGGAGCTGGG + Intronic
1085816932 11:79747482-79747504 CAACTTAAGAACAGGGAGCCAGG - Intergenic
1086411472 11:86548833-86548855 GTACATTAGTAGAAGGAGCTGGG - Intronic
1088400072 11:109413856-109413878 CTACCTGAGGAAAAGGAGCTGGG - Intergenic
1089826425 11:121281964-121281986 CTACTGAAGAAGCTGAAGCTGGG - Intergenic
1091419041 12:319019-319041 CTTTTAAAGAAGAATGAGCTTGG + Intronic
1092020189 12:5195733-5195755 ATATTGAAGAGGAAGGAGCTAGG - Intergenic
1092630440 12:10370659-10370681 CTACTGAAGAAGGGGGAGATGGG - Intergenic
1098218244 12:68242142-68242164 CTAATTAAGGAAAAGGAGTTAGG - Intergenic
1098513613 12:71347944-71347966 CTACTTAAAAAAAAGAAACTAGG - Intronic
1099692801 12:85981609-85981631 CTACATAAGAGGCAGGAGTTTGG + Intronic
1101205547 12:102483644-102483666 CTACTCAAGAAGAAGGCTTTAGG - Intergenic
1101372380 12:104141139-104141161 CTACTTAAGAAGAAGGGATCAGG - Intergenic
1101456091 12:104832278-104832300 CTACATAGGAAGAAAGAGCCAGG - Intronic
1102181617 12:110917008-110917030 CTACTAAAGAAAAATAAGCTGGG - Intronic
1103022117 12:117542266-117542288 CTACTCAATACGAAGGAGGTGGG - Intronic
1105671574 13:22623504-22623526 CTACTTAAGAAGGAGTCTCTAGG - Intergenic
1105687373 13:22797883-22797905 CTCTTTAAGGATAAGGAGCTTGG + Intergenic
1106066151 13:26352515-26352537 CTCCTTAAGAAGAAGATTCTTGG - Intronic
1106775764 13:33008074-33008096 CTATTTAAGAAGAAGTCTCTAGG - Intergenic
1107880666 13:44829497-44829519 CCACTTGAGAGGAAGGAGCTGGG - Intergenic
1109585437 13:64396114-64396136 CTACATCAGTAGAATGAGCTAGG - Intergenic
1109924221 13:69113580-69113602 GTAATTTAGAAGAATGAGCTGGG + Intergenic
1110684307 13:78353633-78353655 CTACCCAAAAAGAATGAGCTTGG + Intergenic
1112500589 13:99940147-99940169 CTACTTAAAAAAAATTAGCTGGG - Intergenic
1112829020 13:103425786-103425808 GTACTTAAGTAGAATGAGGTGGG + Intergenic
1115563180 14:34601515-34601537 CCTCTTAAGAAGTAGGAGCCAGG - Intronic
1115697664 14:35917777-35917799 CTAAGTCAGAAGAAGGACCTGGG - Intronic
1116608413 14:47033176-47033198 CTAATTAAGAAGCAGGAGAAAGG + Intronic
1116616460 14:47146831-47146853 CCACTTGACAAGAAAGAGCTGGG - Intronic
1118903902 14:70009517-70009539 CTTCTTAAGAGCAAGGAACTTGG - Intronic
1119553925 14:75539165-75539187 CTGCTTAGAGAGAAGGAGCTTGG - Intronic
1120285967 14:82501987-82502009 CCACTTAAAATGAAGGACCTAGG - Intergenic
1121864322 14:97348243-97348265 CCACTTAAGATCATGGAGCTGGG + Intergenic
1123695793 15:22878236-22878258 ATGCTGAAGAAGAAGGAGCAAGG + Intronic
1125206659 15:37161248-37161270 CTGCTTAACTATAAGGAGCTTGG + Intergenic
1126746942 15:51835764-51835786 CTACATAAGAATAATGAGGTTGG - Intronic
1127017853 15:54708530-54708552 CCACTCAGCAAGAAGGAGCTGGG - Intergenic
1127075409 15:55320492-55320514 CTACTGAAGACGAGGGAGCAAGG - Intronic
1130311677 15:82761453-82761475 TTACTTAAAAAGATGGAACTGGG + Intronic
1132396187 15:101476433-101476455 CTATTTAAAAAGAATGAGGTAGG + Intronic
1133375914 16:5287007-5287029 CTATTTAAAAAGAAGAGGCTGGG + Intergenic
1137584160 16:49654107-49654129 GCAATTAAGTAGAAGGAGCTTGG + Intronic
1139772653 16:69291546-69291568 CTATTTAAAAAAAATGAGCTGGG + Intronic
1139993703 16:70960989-70961011 CTATTTAAAAAGAATGAGCTAGG - Intronic
1145968439 17:28938551-28938573 CTCCTTAGGAAAAAGCAGCTGGG - Intronic
1146028824 17:29346808-29346830 CTACAAAAGAAAAATGAGCTGGG - Intergenic
1146780832 17:35670620-35670642 CTTGTAAAGAAGACGGAGCTGGG - Intronic
1147013629 17:37472554-37472576 CTAATTAAAATGAAGGAACTGGG + Intronic
1147025452 17:37578809-37578831 TTTCTTAAGAATAAGGAGCTAGG - Intronic
1151817012 17:76476321-76476343 CTACTTTAAAAGAAGAAGCTGGG - Intronic
1152968549 18:139521-139543 GTAATGAAGAAGCAGGAGCTGGG + Intergenic
1156402736 18:36755492-36755514 CTGCTAAATAACAAGGAGCTAGG + Intronic
1156967936 18:43118600-43118622 GTACTTCAGCAGAAGGATCTAGG - Intergenic
1158251987 18:55499501-55499523 CTACATAAACAGATGGAGCTAGG - Intronic
1159373046 18:67553918-67553940 CTACTTAAAAAGAGGGCGTTTGG - Intergenic
1160829460 19:1096533-1096555 CTACGGAAGAAGAAAGAGCAGGG + Intergenic
1162336179 19:10061937-10061959 CTACTAGAGAAGCAGGAGCTGGG + Intergenic
1163616091 19:18329338-18329360 AAACTTAAGAAGAATTAGCTGGG + Intergenic
1165070960 19:33254619-33254641 CGACTGCAGAAGAAGGGGCTGGG - Intergenic
1166869497 19:45862991-45863013 CTCCTAAAGAAGCAGGGGCTCGG - Intronic
925526592 2:4809598-4809620 ATTCTTCAGAATAAGGAGCTAGG - Intergenic
926835627 2:17016373-17016395 CTACTTACTAAACAGGAGCTAGG - Intergenic
926887021 2:17607158-17607180 CTACTTAATATGAAGGAGAATGG + Intronic
927642650 2:24855195-24855217 CTTCCTAAGAAGAAGGGGGTGGG - Intronic
928241786 2:29592812-29592834 ATACATATGAGGAAGGAGCTTGG + Intronic
930366093 2:50441348-50441370 TTATTTAAAAAGAAGGATCTGGG + Intronic
932349975 2:71023835-71023857 CTTCTTTAGAAGAAGTAGGTAGG - Intergenic
937435718 2:121879560-121879582 CTATTTAAGAAGTAGGCTCTTGG - Intergenic
938807180 2:134817257-134817279 CTATTTAAAAAAAAGGAGTTGGG + Intergenic
939201385 2:139039729-139039751 TTAGGTAAGAAGAAGGAGATAGG + Intergenic
940511605 2:154622603-154622625 CTACTAAGGAAGTAGGACCTGGG - Intergenic
941231756 2:162918413-162918435 CAAATTAGGATGAAGGAGCTTGG - Intergenic
941260466 2:163291033-163291055 TCAATTAAGAAGAAGGAGCCAGG + Intergenic
944859981 2:203806492-203806514 TTAGTTGAGAAGATGGAGCTGGG - Intergenic
945126677 2:206519714-206519736 CTATTTAAGAAGAACCAGCCTGG + Intronic
945276686 2:207994882-207994904 CTTCTTAAGAAGACAGAGCTAGG + Intronic
946194098 2:218022904-218022926 CTACTGAGGGAGAGGGAGCTGGG + Intergenic
946900669 2:224368519-224368541 CTGCTAAAGGAGTAGGAGCTGGG + Intergenic
947624965 2:231613554-231613576 CTTTTTATGAAGAAGGAACTGGG - Intergenic
948026688 2:234783971-234783993 AAGCTTAAGAAGCAGGAGCTAGG - Intergenic
949057266 2:241934896-241934918 CCAGTTCAGAAGAAGGAGCCTGG - Intergenic
1170008726 20:11697376-11697398 CTCCTTAAGACAAAGGATCTAGG + Intergenic
1172554794 20:35831573-35831595 CTACTTAAGAGGTTGGAGTTGGG - Intronic
1173533933 20:43794424-43794446 ATACTTAAGAAGAGGCTGCTGGG - Intergenic
1174440186 20:50545254-50545276 CTACTCAAGAAAAAGTATCTGGG - Intronic
1174835222 20:53850612-53850634 CTACTTTAGAACAAGGAGTTTGG - Intergenic
1175815723 20:61882294-61882316 TTACTTAGGAGGAAGGAGCGGGG + Intronic
1178736970 21:35161264-35161286 CTTCTACAGAAGATGGAGCTTGG - Intronic
1180982530 22:19885557-19885579 CCACATCAGAGGAAGGAGCTGGG + Intronic
1185243833 22:49762473-49762495 CTAGTTAAGAAAAACTAGCTAGG + Intergenic
950394171 3:12721005-12721027 CTATGTAAGAAGAGGGGGCTGGG - Intergenic
952634538 3:35511583-35511605 CTACTTAAGAATCAGGAACCTGG + Intergenic
953149670 3:40313363-40313385 CTACTTAATAGAAAGGAGCCTGG - Intergenic
956051230 3:65250723-65250745 CTACTTCAGATCAAGGAGCTAGG + Intergenic
956757792 3:72406279-72406301 CTACTAAAAAATAAGCAGCTTGG + Intronic
956792194 3:72688654-72688676 TTTCATAAGAACAAGGAGCTAGG + Intergenic
959611474 3:108299987-108300009 CTTCTTAAGAAAAAGGAGATAGG + Intronic
960351958 3:116604865-116604887 CCACTGAAGAAGAATGACCTGGG + Intronic
962584904 3:136832307-136832329 CTAGATTAGAAGAATGAGCTGGG - Intronic
963919780 3:150894209-150894231 CTAGTTCAGAAGAAGGATCATGG + Exonic
967264805 3:187681031-187681053 ATATTTAAGAAGAAGGTGTTTGG - Intergenic
968076318 3:195817564-195817586 CTGCTTAAGGAGAAGGAGGCCGG - Intergenic
970401034 4:15718073-15718095 CTAATTAGGAAAAAGGAGCCAGG - Intronic
970698350 4:18704942-18704964 CTACAAAAGAAAAATGAGCTAGG - Intergenic
972932252 4:44086781-44086803 CTGCTTAAGAAAAAGGAGTCTGG - Intergenic
973194741 4:47426804-47426826 TTTCTTGAGAATAAGGAGCTTGG + Intergenic
973767765 4:54179570-54179592 CTAATTAAGATGAATTAGCTAGG - Intronic
976046811 4:80958559-80958581 TTTCTTAAGAAGAAGGAGAAAGG + Intronic
977918713 4:102621040-102621062 CTACTTCAGAAGACGCAGATAGG - Intergenic
978693574 4:111546930-111546952 CAACTTAAAAATAAGAAGCTTGG + Intergenic
979603283 4:122609290-122609312 CTACTCAAGAAGAATGAGGAGGG + Intergenic
980343972 4:131587763-131587785 CTAGTTAGAAAGAAGGAGATTGG - Intergenic
980417624 4:132512597-132512619 CTACTGAAAAAGTAGGAACTTGG + Intergenic
984309342 4:178036911-178036933 CAACATAAGAAGAAGCACCTTGG + Intergenic
984868554 4:184307012-184307034 GTACTAAAGAAAAAGGGGCTTGG + Intergenic
988934045 5:36065374-36065396 CCACGTAAGAACAGGGAGCTGGG + Intronic
990589409 5:57247522-57247544 CTACTTAAAAAAAAATAGCTGGG + Intronic
990809523 5:59706784-59706806 GTGCATAAGGAGAAGGAGCTCGG - Intronic
990930137 5:61079827-61079849 TAAGTTAAGAAGATGGAGCTGGG - Intronic
992133027 5:73714004-73714026 CTAAATAAGAGGAATGAGCTGGG + Intronic
993622539 5:90185878-90185900 CTAATTAAGATGGAGGAACTGGG - Intergenic
993764488 5:91838937-91838959 CTACTTCATCAGAATGAGCTTGG - Intergenic
994519762 5:100818208-100818230 CTACTTAAGAACATTCAGCTTGG + Intronic
995301165 5:110585103-110585125 CTACTTAAGAAGAAGGAGCTGGG - Intronic
997702123 5:135909914-135909936 CTACTTCATAAGAAGCAGATTGG + Intergenic
998607139 5:143647057-143647079 CTCCTTCAGAGGAAGGAGCTGGG + Intergenic
999844301 5:155461596-155461618 CTCCTTAACAGGAAGGATCTTGG + Intergenic
1001690493 5:173629308-173629330 CTAAATAACAAGAAGGAGCTGGG + Intergenic
1001851815 5:174974317-174974339 CTTATTAGGAAGAAGTAGCTTGG - Intergenic
1001892192 5:175348907-175348929 CCACATAAGAAGGAGGGGCTGGG - Intergenic
1004390095 6:15202742-15202764 CAACTGAAGAAGAAGAAGATGGG + Intergenic
1006799999 6:36753644-36753666 CTACTTATGAGGCAGGATCTTGG - Intronic
1007004459 6:38347571-38347593 TTGCTTGAGAAAAAGGAGCTTGG - Intronic
1007020236 6:38512438-38512460 CTATTTAAGAATAAGGATGTGGG + Intronic
1007707231 6:43798333-43798355 CTACCTCAGAAGAAGGACCAAGG - Intergenic
1007863349 6:44938306-44938328 CCTCTTCAGAAAAAGGAGCTGGG - Intronic
1009351889 6:62690742-62690764 CTAGTTAATAAGAAAGAGATTGG + Intergenic
1010271869 6:73924654-73924676 CTTTTTCAGAAGAAGGAACTTGG - Intergenic
1012501447 6:99892647-99892669 TTACTTAAGAAGGAGTATCTAGG - Intergenic
1012557378 6:100530958-100530980 CTAATTATGATGAAGGAGCATGG + Intronic
1015986937 6:138894044-138894066 ATAATTAAAAAGAAAGAGCTTGG - Intronic
1016145891 6:140672959-140672981 CTCCTAAAGAAGAAAGACCTGGG + Intergenic
1017217619 6:151928017-151928039 CTAATTAAGAAAAAGAAGCCGGG - Intronic
1017756674 6:157535039-157535061 CTACTTAAGATACAGGACCTGGG - Intronic
1026243693 7:68599288-68599310 CTACATAAGTAGATGGAGCCTGG - Intergenic
1027537399 7:79421430-79421452 CTACTTTAGAAGCAAGAGTTTGG - Intronic
1027632071 7:80619399-80619421 TTACTTAAGAAATAGGAGGTGGG + Intronic
1028122834 7:87076156-87076178 CCACTTAAAAAGAAAGAGGTGGG - Intergenic
1028292168 7:89078757-89078779 CAATTTAAGAAGAAGGAATTAGG + Intronic
1028367642 7:90052834-90052856 ATACTTCAGAAGAAGGAAATAGG + Intergenic
1030842885 7:114377967-114377989 CTACTTAAGGAGAGGGAGAGAGG - Intronic
1032928466 7:136637222-136637244 GTACTTAACAAGAATGAGCAGGG + Intergenic
1033617379 7:143029512-143029534 CTAATTAAGAAGTAGTAACTCGG - Intergenic
1033772791 7:144572011-144572033 CTACTTAATAAATTGGAGCTGGG - Intronic
1034492244 7:151399616-151399638 CTTCTTGAGAAGGAGGGGCTGGG + Intronic
1036248503 8:7141424-7141446 CTATTTAAAAAGAAGAGGCTGGG + Intergenic
1036710848 8:11077677-11077699 CCACTTAATAAGAGGGAGCTGGG - Intronic
1037965349 8:23129718-23129740 TTATTTTACAAGAAGGAGCTGGG - Intergenic
1037976939 8:23220504-23220526 CTAGTTTATAGGAAGGAGCTGGG - Intronic
1037977075 8:23221290-23221312 CTAGTTTATAGGAAGGAGCTGGG + Intronic
1041850164 8:62381945-62381967 TTACTTTAGTAGAAGGAGCAAGG - Intronic
1042778128 8:72458185-72458207 CTTCTTAAGAAGCATAAGCTGGG - Intergenic
1045559075 8:103243644-103243666 CTGCTTAGGCAGAAGGAGCAGGG + Intergenic
1049461308 8:142729579-142729601 CTACTGAAGAAGGGGGAGATGGG + Intronic
1050905544 9:11000122-11000144 CTACTTAAGAGAAAGGAACAGGG - Intergenic
1052350511 9:27453977-27453999 CTTCTTAACAGGAAGGAGGTAGG - Intronic
1055069117 9:72148696-72148718 CCACTTATGAAAATGGAGCTTGG - Intronic
1055443189 9:76356635-76356657 TTACTTTAGAAGAAGAAACTCGG + Intronic
1055979761 9:81990520-81990542 GTACTAAAGAAGAAGGAGTGGGG - Intronic
1056157963 9:83858287-83858309 CTAGTTAAGAAATAGGAGCAAGG - Intronic
1056251048 9:84748471-84748493 CTAATGAAGAAGCAGAAGCTTGG + Intronic
1056352583 9:85765805-85765827 CTAGTTAAGAAATAGGAGCAAGG + Intergenic
1056960194 9:91116642-91116664 CTACTGATGAAGAAGGGGCCTGG - Intergenic
1057033075 9:91793395-91793417 CTTTTTATGAAGAAGGAGATAGG - Intronic
1057060902 9:92003429-92003451 CTATTTAAGACTAAGGCGCTAGG + Intergenic
1057542108 9:95985232-95985254 CTACTTAAGAATCAGGACCATGG + Intronic
1058019422 9:100071499-100071521 CTACTTAAGAATAAGAAACTAGG - Intronic
1186748955 X:12601850-12601872 CAACTTCAGGAGAAGCAGCTTGG - Intronic
1187070490 X:15882710-15882732 CTAATTAAGGAGAGGGAGTTGGG + Intergenic
1187901625 X:24031591-24031613 GTACTTAAGAATATGTAGCTTGG - Intergenic
1189045948 X:37591258-37591280 CTACTAAAGCACAAGGATCTTGG + Intronic
1189199089 X:39176386-39176408 CTCCTTAAGAAGCAGAAGCCTGG + Intergenic
1189247187 X:39572332-39572354 CTAGTTAAGAAGAAGAGACTAGG + Intergenic
1189250382 X:39596533-39596555 CTATTTAAGGAAAATGAGCTGGG + Intergenic
1189974700 X:46449131-46449153 CTACCAAAGAAGGAGGAGCCTGG + Intronic
1190447368 X:50540679-50540701 CTATTTAAGAAGTAGTTGCTAGG + Intergenic
1191673118 X:63767530-63767552 CTAATTAAGATGAAGAAGCCTGG + Intronic
1194317068 X:92391496-92391518 CTACTTAAAAATAAGTAGATAGG - Intronic
1194571090 X:95555228-95555250 CTACTTAACAAGTAGGAGTTTGG + Intergenic
1194785595 X:98080279-98080301 GTAATTAAGATGAAGGAGCATGG + Intergenic
1196017322 X:110953796-110953818 CTTCTTAAGAAGAGCGAGTTTGG + Intronic
1196127914 X:112119154-112119176 TTTCTAAAGAAAAAGGAGCTGGG + Intergenic
1196613049 X:117735650-117735672 CTACTTAAGAAGAAGGGACAGGG - Intergenic
1196824300 X:119728828-119728850 CGACCTAAAAAGAAGCAGCTTGG + Intergenic
1197055814 X:122117023-122117045 CTACATAAGCAGTATGAGCTTGG + Intergenic
1198712060 X:139515215-139515237 ATACTTAAGAAGAATGAAGTTGG - Intergenic
1199830686 X:151546343-151546365 CAACTTAGGAGGATGGAGCTTGG + Intergenic
1200625243 Y:5504813-5504835 CTACTTAAAAATAAGTAGATAGG - Intronic
1201921314 Y:19235655-19235677 ATACTTAATAAAAAGGACCTGGG + Intergenic