ID: 995308729

View in Genome Browser
Species Human (GRCh38)
Location 5:110687101-110687123
Sequence CAGGGGGAAGAAAGGTCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 603
Summary {0: 1, 1: 0, 2: 0, 3: 55, 4: 547}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995308729_995308735 -2 Left 995308729 5:110687101-110687123 CCTTCTGACCTTTCTTCCCCCTG 0: 1
1: 0
2: 0
3: 55
4: 547
Right 995308735 5:110687122-110687144 TGAGAAAAGAAAAATAACTCAGG 0: 1
1: 2
2: 12
3: 104
4: 1184
995308729_995308737 0 Left 995308729 5:110687101-110687123 CCTTCTGACCTTTCTTCCCCCTG 0: 1
1: 0
2: 0
3: 55
4: 547
Right 995308737 5:110687124-110687146 AGAAAAGAAAAATAACTCAGGGG 0: 1
1: 2
2: 16
3: 266
4: 2353
995308729_995308736 -1 Left 995308729 5:110687101-110687123 CCTTCTGACCTTTCTTCCCCCTG 0: 1
1: 0
2: 0
3: 55
4: 547
Right 995308736 5:110687123-110687145 GAGAAAAGAAAAATAACTCAGGG 0: 1
1: 4
2: 29
3: 200
4: 1659

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995308729 Original CRISPR CAGGGGGAAGAAAGGTCAGA AGG (reversed) Intronic
900467505 1:2832978-2833000 CAGGGGTGAGAACGGTCCGAGGG + Intergenic
900486474 1:2925065-2925087 CAGCGGAAACAGAGGTCAGAGGG + Intergenic
900563862 1:3322875-3322897 CAGAAGGTAGAAAGGTAAGAAGG - Intronic
901004398 1:6164900-6164922 CAGGGGGAAGAGAGAAAAGACGG + Intronic
901639542 1:10686428-10686450 CAGGAAGGAGAAAGGTGAGAGGG - Intronic
901813783 1:11782399-11782421 CAGGGGGTGGGAAGCTCAGACGG + Intronic
901828791 1:11879679-11879701 CTGGAGGAAGAACGGTCTGACGG + Intergenic
901988277 1:13092599-13092621 AAGGGGCAAGAAAGCCCAGAAGG - Intergenic
901993535 1:13134168-13134190 AAGGGGCAAGAAAGCCCAGAAGG + Intergenic
902733439 1:18384582-18384604 CAGGGAGAAGGAAAATCAGAGGG + Intergenic
903216420 1:21846029-21846051 CAGGGGGCAGAACTGGCAGAAGG - Intronic
903789997 1:25886243-25886265 CAGTGGGAGGGAAGGGCAGAGGG + Intronic
903834451 1:26193902-26193924 CAGGGGGAAGTAGGGGCAAAGGG - Intronic
904088866 1:27930491-27930513 CAGGGGCAAGAAAAGTCACACGG + Intergenic
905447134 1:38034773-38034795 CAGGGTGAAGAGAGGCAAGATGG - Intergenic
906656203 1:47549996-47550018 TAGGAGGAAATAAGGTCAGAGGG - Intergenic
906702250 1:47868344-47868366 AAGGAGGAAGGAAGGACAGAAGG + Intronic
907357190 1:53886032-53886054 CAGGGGGAAGGAATGCCAGAAGG + Intronic
907722075 1:56981438-56981460 GAGGGAGAAGGAAGGACAGATGG - Intergenic
908870071 1:68600186-68600208 CAGGTGGAGGAAAGAACAGAAGG - Intergenic
909301730 1:74021101-74021123 CAGCAGGAAAAAAAGTCAGAAGG + Intergenic
909428599 1:75558123-75558145 CAGAGGGAAGAGAAATCAGAAGG - Intronic
910027565 1:82675652-82675674 CAGGAGGAATAAAGGTGACATGG + Intergenic
911648616 1:100361901-100361923 GTGGGGAAAGAAAGGCCAGATGG + Intronic
911707045 1:101025934-101025956 CAGGGCGGCGAAAGGTCAGTCGG + Intronic
911857507 1:102898754-102898776 CAGGGGGAAGCAGGTGCAGAAGG - Exonic
912735327 1:112145106-112145128 CAGGGGGAGGATGGGGCAGAAGG + Intergenic
912933897 1:113986353-113986375 CAGGGAGAAGCCAGGGCAGAAGG + Intergenic
913059835 1:115194677-115194699 CATGTGGAAGAAAGATCAAATGG + Intergenic
913483099 1:119308277-119308299 CATGGGGGAGAAAGGTAAGGTGG + Intergenic
913490357 1:119374149-119374171 CATGGGGAAGAGAGGGCAGGGGG - Intronic
914679996 1:149932335-149932357 TAGAGGGTAGAAAGATCAGAAGG + Intronic
915830468 1:159124792-159124814 CAGGAGGAAAACAGGTGAGATGG + Intronic
915949158 1:160176432-160176454 CAGGGGTCACAAAGTTCAGAAGG - Intronic
917235230 1:172884565-172884587 GAGGAGGAAGAGAGGACAGAAGG + Intergenic
918062597 1:181074858-181074880 AAGGAGGAAGAAAGAGCAGAGGG - Intergenic
918729443 1:187972687-187972709 AAGAGGGAAGAAAGGTCGGGGGG - Intergenic
919071703 1:192763940-192763962 CAGAGGGAAGGAAGATGAGATGG - Intergenic
919767251 1:201135408-201135430 GAGGGGGAAGGCAGGCCAGAAGG - Exonic
920112517 1:203597351-203597373 GAGGGGGAAGGAAGGAAAGAGGG - Intergenic
920198804 1:204246646-204246668 CTGGGTGAAGAAAAGGCAGAGGG + Intronic
920280968 1:204843521-204843543 GAGAGGGAAGAAAGGGGAGAAGG - Intronic
920557753 1:206916417-206916439 CAGGGGGAAGATAGCAGAGATGG + Intronic
920702882 1:208231174-208231196 CAGGGGGAAGAATGTGCTGATGG + Intronic
921945307 1:220882123-220882145 CAGAGGGAAGAAAGACAAGAGGG - Intronic
921979516 1:221240660-221240682 CAGGAGAAAGGAAGGTCACATGG + Intergenic
922046292 1:221949207-221949229 GGAGGGGGAGAAAGGTCAGAGGG - Intergenic
922455449 1:225770442-225770464 CAGGGGGAAGAGGGGTGTGATGG - Intergenic
922470328 1:225873122-225873144 CATGGGGAAGAGAGGACAGAAGG + Intronic
922604542 1:226881336-226881358 CAGGAGGAGGGAAGGGCAGAAGG - Intronic
923625032 1:235606792-235606814 CAGGGGGAGCATGGGTCAGAAGG + Intronic
924100250 1:240595578-240595600 CAGGGGGAAGAAAAGTCACTGGG + Intronic
924413107 1:243827422-243827444 AATTGGGAAGAAAGGGCAGAGGG - Intronic
1063904627 10:10768954-10768976 CAGGTAGAAGGAAGGACAGAGGG - Intergenic
1064066615 10:12187672-12187694 GAGGAGGAAGACAGGTCACATGG - Intronic
1064178511 10:13096159-13096181 GAGAAGGAAGAAAGGTAAGAAGG - Intronic
1064389998 10:14933989-14934011 GAGGGGGAGGAAAGGTGAGCTGG + Intronic
1064400433 10:15016517-15016539 GAGGGGGAGGAAAGGTGAGCTGG + Intergenic
1064414472 10:15136473-15136495 AAGGAGGAAGGAAGGACAGATGG + Intronic
1064443739 10:15375271-15375293 CTAGGGGAAGAAAGGGAAGAAGG - Intergenic
1065822998 10:29543660-29543682 GAGGAGGAAGAGAGGTAAGAAGG - Intronic
1066406805 10:35126765-35126787 TAGGGAGAAGGAAGGTCAGGGGG - Intergenic
1070130029 10:73649281-73649303 CAGGGAGAGGAAAGATGAGAAGG + Intronic
1070775692 10:79108535-79108557 GATGGGGAAGAAAGGCCTGAGGG + Intronic
1071154145 10:82670167-82670189 GAGTGGGAAGAAATGACAGAGGG - Intronic
1072794808 10:98346586-98346608 AAGGGGGAGGAAAGGGAAGAGGG + Intergenic
1074348557 10:112712548-112712570 GAGGGGGAAGAAAGGTAAAAGGG + Intronic
1074437194 10:113444254-113444276 CAGTGGGAAAGAAGGACAGAGGG - Intergenic
1075453156 10:122567474-122567496 CAGAGGGAGGAAAGGCCAGCTGG - Intronic
1076001486 10:126916652-126916674 GGGGAGGAAGAAAGGACAGAAGG - Intronic
1076337968 10:129721861-129721883 AAGGGGGAACAAAGAACAGATGG + Intronic
1077359348 11:2133833-2133855 CAGGAAGAAGAGAGGTGAGAGGG + Intronic
1077548069 11:3185083-3185105 CAGGAGGAAGAGAGGCCAGAGGG + Intergenic
1077654543 11:4006218-4006240 CAGGAGGAAGAAAGAGCAAAGGG - Intronic
1078224213 11:9377733-9377755 TAGGGAGAAGGAAGGTAAGAGGG - Intergenic
1078349590 11:10581674-10581696 CAGGAGGAAGCAGGGTCAGAGGG - Intronic
1079145508 11:17847670-17847692 CAGGGGGAGCAAGGGACAGAAGG + Intronic
1080231306 11:30019421-30019443 CAGGGAGATGAAAAGTGAGATGG + Intergenic
1080808977 11:35683398-35683420 GAGAGGCAAGAGAGGTCAGAGGG + Intronic
1081419058 11:42850749-42850771 CATGGGGAAGAATCATCAGAAGG + Intergenic
1081908860 11:46687237-46687259 CAGTGGGAAGAGGGTTCAGAAGG + Intronic
1082053857 11:47796520-47796542 AAGGGGGAAGAAAGGAAAGGAGG + Intronic
1082677986 11:56132602-56132624 CAGGGAGAAAACAGATCAGAAGG + Intergenic
1082829110 11:57602239-57602261 CTGGGGAAAGAAAGGACAGAGGG + Intronic
1083623719 11:64061304-64061326 CAGCGTGAAGGAAGGGCAGACGG - Intronic
1083704615 11:64505447-64505469 CAGGGGGAAGCAGGATCAGGAGG + Intergenic
1084152951 11:67299723-67299745 CTGGGGGAAGAGGGGTCAGACGG - Intronic
1084209516 11:67614576-67614598 GAGGTGGAAGAGAGGACAGATGG - Intergenic
1084215793 11:67646216-67646238 CCAGGGGAAGAGAGGTGAGAGGG - Intronic
1084531477 11:69730372-69730394 CATGGGGGAGAGGGGTCAGACGG + Intergenic
1084972532 11:72779744-72779766 CAGAGGGAAAAACAGTCAGATGG + Intronic
1085204367 11:74721620-74721642 CAGGAGGAAGAACTGCCAGACGG + Intronic
1085212495 11:74793846-74793868 CAGTGGGAAGAAAGGTAAAAAGG - Intronic
1085266507 11:75240857-75240879 CGGGGGCAAGAGGGGTCAGACGG - Intergenic
1089453002 11:118610092-118610114 TCGGGGGAAGAAAGGACAGGCGG - Intronic
1089558516 11:119330429-119330451 GAGGGGGAAGAAGGGAAAGAAGG - Intergenic
1089668094 11:120032991-120033013 CAGAGGGAAGAGATGGCAGAGGG - Intergenic
1089793674 11:120963061-120963083 CAGTGGGAAGAAGGATGAGATGG + Intronic
1090037724 11:123263440-123263462 CAGGGGGAACAGCTGTCAGAGGG - Intergenic
1090188348 11:124752351-124752373 AAGGAGGAAGAAGGGACAGAGGG - Intergenic
1090709394 11:129372472-129372494 CAGAGGCAAGAAATCTCAGAAGG - Intergenic
1090857600 11:130623852-130623874 CAGGGGGAAGGCCTGTCAGATGG + Intergenic
1090964462 11:131585869-131585891 CAGGGAGAAGAAAGGAAAGATGG - Intronic
1092006494 12:5074569-5074591 CAGGTGGGAGTAAGGACAGATGG + Intergenic
1092231959 12:6780926-6780948 CAGAAGGAAGAAAGGGCATATGG + Intergenic
1092233380 12:6790678-6790700 CAGGGGCTGGAAAGGTCTGAGGG - Intronic
1092258133 12:6938103-6938125 CAGAGGGAAGGAAGGAAAGAGGG - Intronic
1093876957 12:24359931-24359953 TATGGGGAATAAAGGTCATAGGG + Intergenic
1094019574 12:25899990-25900012 AAGGGGGAAGAAAGGGTAAAGGG - Intergenic
1094497973 12:31001061-31001083 CAGTGTGAAGAGTGGTCAGAGGG - Intergenic
1094704767 12:32904027-32904049 CTGGAGGATGAAAGGTCACATGG - Intergenic
1095419581 12:42011400-42011422 GAGGAGGAAGAATGGTCAGCAGG - Intergenic
1096209194 12:49750060-49750082 CAGGGGGATGAGATGTCAAACGG - Intronic
1097627321 12:62016540-62016562 CTGTGGGAAGAAGGGTCTGAGGG - Intronic
1099496540 12:83353713-83353735 TAGGGGGCAGAAAGGAAAGAGGG + Intergenic
1099834257 12:87887397-87887419 CAGGTGGAAGAAGGGTTGGAAGG - Intergenic
1100553151 12:95666269-95666291 CAGGGGGAAGAGAGGGGATAAGG + Intronic
1100631686 12:96395858-96395880 CAGGGAGAAGACAGCTGAGAGGG + Intronic
1101428393 12:104606343-104606365 GAGGGAGAAGGAAGGTCGGAAGG + Intronic
1101548656 12:105740963-105740985 CAGGCGGAAGAAAGGATGGAAGG + Intergenic
1101904066 12:108812367-108812389 CAGGCAGAAGCCAGGTCAGATGG + Intronic
1102116903 12:110409749-110409771 CCTGGGGAGGAGAGGTCAGATGG + Intergenic
1102464197 12:113119058-113119080 AAGGGGGAAGAAAGATGAGACGG - Intronic
1102507925 12:113395599-113395621 GATGGGGAAGCAAGGGCAGAAGG - Intronic
1102591791 12:113961788-113961810 CAGGGGGCTGACAGGTCAGCAGG - Intronic
1102650694 12:114440128-114440150 CAGCGGGGACAAAGGCCAGAGGG - Intergenic
1102991960 12:117322178-117322200 GAGAGGGAAGAAAGGAGAGAAGG - Intronic
1103123844 12:118403823-118403845 CAGAGGTAAGAGGGGTCAGAGGG - Intronic
1103206042 12:119129946-119129968 CAGATGGAAGGAAGGACAGATGG + Intronic
1103208773 12:119151297-119151319 CATGGGGGAGAGAAGTCAGACGG + Intronic
1103239781 12:119403590-119403612 CAGGGGGAAGATGGGGCTGAGGG - Intronic
1103307142 12:119973989-119974011 GAAGGGGAAAAAAGGCCAGAAGG + Intergenic
1103397466 12:120619125-120619147 GAGGGGGAAGAGAGGGCTGAAGG - Intergenic
1103463551 12:121123904-121123926 CTGGGGGAAGATACTTCAGATGG - Intergenic
1104075544 12:125386333-125386355 GGGAGGGAAGTAAGGTCAGATGG + Intronic
1104696273 12:130866467-130866489 CAGGGGACTGAAAGGTGAGAAGG + Intergenic
1104705909 12:130947274-130947296 CAGGAAGAACAAAGGTCAAAAGG + Intergenic
1104860981 12:131923374-131923396 CAGGGTGAAGAGAGTCCAGAGGG + Intergenic
1105753261 13:23441323-23441345 CAGGGGGCAGAAAGGTCCCCAGG - Intergenic
1107212394 13:37873022-37873044 AAGGTGGAAGACAGGTCACATGG - Intergenic
1110436849 13:75485185-75485207 CAGTGGGAAGAAAAGGCAGTTGG - Intergenic
1110975150 13:81823082-81823104 AAGTGGGAAGAAAGATCATATGG + Intergenic
1112322171 13:98417612-98417634 CAGGGGTAAGAGATGTGAGAAGG + Intronic
1112721923 13:102255239-102255261 AAGGGAGAGGAAAGGCCAGAAGG + Intronic
1112834294 13:103494937-103494959 CAAGGTGAAGAAAGTTCTGAGGG - Intergenic
1113177636 13:107583820-107583842 CAGGGGAAAGAAAGGTTACAGGG - Intronic
1113292705 13:108923670-108923692 GAGGGGGAAGAGAGGTCTGCAGG - Intronic
1113758570 13:112831664-112831686 CAGTGGGAGGGATGGTCAGAAGG + Intronic
1113990412 14:16023839-16023861 CAGAGGGAAGGATGGACAGAGGG - Intergenic
1114482524 14:23044534-23044556 GTGGGGGAGGAAAGGTCAGGGGG + Intergenic
1114484047 14:23052669-23052691 CAGAGGGAAGAAAGAAGAGAGGG - Intronic
1114536203 14:23424595-23424617 CAGGAGGAGGAAAGGGCAGAGGG - Intronic
1115398761 14:32936611-32936633 CAAGGGTCAGAAATGTCAGATGG + Intronic
1116333599 14:43627837-43627859 CAGAGGGAAGTAATGTCAGCTGG + Intergenic
1116378877 14:44239748-44239770 CAGGAGGAAGGAAGGGAAGAAGG - Intergenic
1116805381 14:49489436-49489458 GAGGAGGAAGAAAGGAGAGAAGG + Intergenic
1117469098 14:56024171-56024193 CAGGGGAAAGAATGGTCAAGAGG + Intergenic
1117918293 14:60701637-60701659 AAGGGGGAAGGAAGGAAAGAAGG - Intergenic
1118035582 14:61862775-61862797 CAGGGGTTAGAAAGGGTAGAAGG - Intergenic
1119216983 14:72876596-72876618 CTGAGGGAAGGAAGGCCAGATGG - Intronic
1119401469 14:74365497-74365519 CAGAAGGCAGAAAGGTCACAGGG + Intergenic
1119763915 14:77175998-77176020 CAGGGGTAAGAGAGGGCAGAGGG + Intronic
1120205001 14:81578717-81578739 CAGGGGGAAGGAAGGGGAGAAGG + Intergenic
1120288172 14:82532317-82532339 AAGGAGGAAGAAAGGAAAGAAGG - Intergenic
1120524639 14:85563544-85563566 CAGGAGGAAGAAAGAGAAGAGGG + Intronic
1120702707 14:87715374-87715396 TAGAGGGAAGGAAGGTCAGTTGG - Intergenic
1120878183 14:89393658-89393680 CAGAGGGAAAAAAGATCAGTTGG + Intronic
1121497343 14:94402983-94403005 CAGGGGAAAGAAAGGAAGGAAGG - Intergenic
1121966069 14:98306909-98306931 CTGGTGGAAGAAAGATCAGGAGG + Intergenic
1122034085 14:98935004-98935026 CAAGGGGAGGACAGGGCAGAGGG + Intergenic
1122978818 14:105181923-105181945 CAGGGGGAGGGAAGGGCAGCTGG - Intergenic
1125262759 15:37846623-37846645 CAGGGAGAAGAATGGTCAGGAGG - Intergenic
1125831233 15:42718403-42718425 CAGGGATAAGGAAGGTCAGGAGG - Intronic
1126077606 15:44927536-44927558 CAGAAGGAAGAAAGGAAAGAAGG - Intergenic
1126081102 15:44962975-44962997 CAGAAGGAAGAAAGGAAAGAAGG + Intronic
1126414633 15:48404985-48405007 CATGGGGGAGATAGGTTAGAAGG + Intergenic
1126417073 15:48428615-48428637 GAGAGGGAAGGAAGGTGAGAGGG - Intronic
1126644029 15:50856998-50857020 CTGGGGAAAGAAAGAGCAGAGGG + Intergenic
1127240487 15:57108306-57108328 CGGGGAGAAGAAAGGTGATAGGG - Intronic
1127863900 15:63016130-63016152 CAGAGAGTAGAAATGTCAGAGGG - Intergenic
1128095210 15:64949078-64949100 GAGGGGCACGGAAGGTCAGAGGG + Intronic
1128363892 15:66983056-66983078 CAAAGGGAAGACAGGTCAGTGGG - Intergenic
1128656656 15:69467670-69467692 CAGGGGCCAGAGAGGTCAGGGGG - Intergenic
1128701936 15:69811094-69811116 CAGGGGAAGGAAGGGTGAGATGG - Intergenic
1128729158 15:70009155-70009177 CAGGGGGAAGAAGAGGCAGAAGG - Intergenic
1128979834 15:72178176-72178198 CAGGGTGAAGAAGGCTCAGGAGG - Intronic
1130208775 15:81903517-81903539 TCTGGGGAAGAAAGGTAAGATGG - Intergenic
1130414861 15:83683493-83683515 AATGGGGAAGAAAAGTCAAATGG - Intronic
1130624484 15:85499737-85499759 CAGGAGGATGAAAGCTCAGGAGG - Intronic
1130669252 15:85895974-85895996 CAGAGAGAAGAAGGGGCAGAGGG - Intergenic
1131467644 15:92668231-92668253 GAGGGGACAGAGAGGTCAGAGGG - Intronic
1131833234 15:96367356-96367378 AAGGGGGAAAAAAGGCAAGATGG - Intergenic
1132416180 15:101620688-101620710 CAGGGGAAAAGAAGGTGAGAGGG - Intergenic
1132798821 16:1741480-1741502 CAGGGGACAGCAGGGTCAGAGGG - Intronic
1132815520 16:1824546-1824568 CACGGGGAAGAAACCACAGAAGG + Intronic
1133392688 16:5422549-5422571 GAGGGGGAAGAAAGGGGAGGAGG + Intergenic
1133666173 16:7970370-7970392 CAGAGGGAAGAAAGGAGGGAGGG - Intergenic
1134081025 16:11325083-11325105 CAGGGGGAAGAGCAGGCAGAAGG + Intronic
1134667726 16:16031298-16031320 CAGAGGGAAGAGAGGTCACCAGG - Intronic
1135421713 16:22309397-22309419 CAGGGAGAAGCAACGTCACAGGG - Intronic
1135889309 16:26342897-26342919 CAGTCGGAAGCCAGGTCAGAAGG - Intergenic
1136237975 16:28925917-28925939 CAGAGGGAAAAAAGGTTTGAGGG - Intronic
1136616062 16:31399320-31399342 CAGCTGGAAGATGGGTCAGAGGG - Intronic
1136909566 16:34134918-34134940 CAGAGGGAAGGATGGACAGAGGG - Intergenic
1137728781 16:50674621-50674643 CTGGGAGGAGAAAGGGCAGAGGG + Intronic
1137947993 16:52752591-52752613 AAGAGGGAAGAAAGGAAAGAGGG + Intergenic
1137991590 16:53162213-53162235 CAGTGGGAAGAGAGGCCAGAGGG + Intronic
1138235877 16:55382213-55382235 GAGGGTGAAGAAAGGCCAAAGGG - Intergenic
1138562116 16:57807563-57807585 CAGGGAGCAGGAAGGTGAGAGGG - Intronic
1138894822 16:61190803-61190825 GAAGGGGAAGAAAGGGAAGAAGG - Intergenic
1139320416 16:66109719-66109741 AAGGGGGAAGGAAGGGAAGAGGG + Intergenic
1139645232 16:68324555-68324577 CAGGGGCCAGAAAGGCCATAGGG + Intronic
1140766628 16:78165521-78165543 GAGGGTGGAGAAGGGTCAGATGG + Intronic
1141678679 16:85531300-85531322 CCTGGGGCAGAGAGGTCAGATGG + Intergenic
1142302518 16:89266802-89266824 CAGGGGACAGACAGCTCAGAAGG + Intergenic
1143198224 17:5093409-5093431 GAAGGGGAAGGAAGGACAGAGGG - Exonic
1143628148 17:8122491-8122513 CAGGGGGAAGAAGGGAGGGACGG + Intronic
1143793923 17:9321035-9321057 GAGGTAGAAGAAAGGTGAGATGG + Intronic
1144134278 17:12278538-12278560 CAGGGGGAGATAAGGTGAGAAGG - Intergenic
1144292799 17:13842597-13842619 CAGGGGGAAGGAAGATCACAGGG + Intergenic
1145065651 17:19759740-19759762 CAGGGGGCAGGGAGGGCAGAGGG - Intergenic
1147250451 17:39150209-39150231 CAGTGGGAAGTATGGGCAGAGGG - Intronic
1147753944 17:42755848-42755870 CAGGGGGAAAAATGGTCACTGGG - Intergenic
1148717323 17:49725045-49725067 CCGTGGGATGAAGGGTCAGATGG - Intronic
1149012905 17:51875825-51875847 CAGGAGTAAGAAGTGTCAGAGGG - Intronic
1149412078 17:56419146-56419168 CATGGAGAAGAAAGGCCAGTGGG - Intronic
1149606926 17:57931679-57931701 CAGGGCCAAGAAAGGCCTGAGGG + Intronic
1149781448 17:59399629-59399651 CAGGGGGAAAAAAAGTCATTAGG + Exonic
1150050253 17:61955103-61955125 CAGTGGGAAGCAAAGTCAAAGGG - Intronic
1151546960 17:74799147-74799169 CAGAGGGAAGCAGTGTCAGAGGG + Intronic
1151983590 17:77528422-77528444 CAGGGGGAGGGAAGGTGAGGAGG - Intergenic
1152191284 17:78889577-78889599 CAGGGGCACCCAAGGTCAGACGG - Intronic
1152358403 17:79817811-79817833 GAGGTGGAGGAAAGGTCAGATGG + Intergenic
1152472090 17:80495215-80495237 CAGGGGGAAGGAAGGAAAGTGGG + Intergenic
1153147332 18:2048135-2048157 CTGGGGAAAGAAATGTCAAAGGG - Intergenic
1153439327 18:5099608-5099630 CAGGAGGAAGAAAGATAAGGGGG - Intergenic
1155222058 18:23694350-23694372 TAGGGGGCAGAATGGTGAGAAGG + Intronic
1155737505 18:29242273-29242295 CTGGGTGAGTAAAGGTCAGAGGG + Intergenic
1156454157 18:37283443-37283465 CATGGAGGAGAGAGGTCAGAGGG - Intronic
1157078669 18:44497347-44497369 CAGCGGAAAGAAATGTCAGGAGG - Intergenic
1157844872 18:50993832-50993854 CTGGGGGGAGAAAGGACAGCAGG + Intronic
1159931399 18:74316021-74316043 CAGGGGGAGGAAAGGGCGGGTGG - Exonic
1160430409 18:78807597-78807619 CAGTGGGAAGTAAGCTCACATGG - Intergenic
1160754495 19:750600-750622 CAGGGCTAAGAGAGGTCAGGTGG + Intergenic
1160777838 19:864448-864470 CAGGTGGGAGAAAGGGCACAGGG - Intergenic
1161260105 19:3332916-3332938 AGGGAGGAAGAAAGGACAGATGG - Intergenic
1162187927 19:8921843-8921865 CAGGGGGAAGAGGGGACAGGGGG - Intronic
1163235803 19:16029753-16029775 CAGAAGGAAGAATGGACAGAAGG - Intergenic
1163426373 19:17243121-17243143 CAGGTGGAAGAAAGGCCACAGGG - Intronic
1164684391 19:30157324-30157346 CAGGGGGAGGAAGGGTGAGTGGG + Intergenic
1165101104 19:33439269-33439291 CAGGGGGCAGGAAGGCCAGGAGG - Intronic
1165113553 19:33515436-33515458 CATTGGGATGAAAGGGCAGAGGG + Intronic
1165509034 19:36255508-36255530 CAGGAGGAAGAAACCTCAGGCGG + Intergenic
1165509512 19:36257873-36257895 CAGGAGGAAGAAACCTCAGACGG + Intergenic
1165511040 19:36266835-36266857 CAGGAGGAAGAAACCTCAGACGG + Intergenic
1165577894 19:36837436-36837458 AGGGAGGAAGAAAGGTCTGAAGG - Intronic
1165631656 19:37306523-37306545 CAGGAGGAAGAAACCTCAGGAGG - Intergenic
1166072434 19:40395011-40395033 CAGGAGGAAGGGAGGGCAGAGGG - Exonic
1166875357 19:45893633-45893655 CTGGGGGAAGACAGGGAAGATGG + Intronic
1166938846 19:46350890-46350912 CAGGGAGAAGAGAGGTCCCAGGG + Intronic
926401992 2:12506697-12506719 AAGACGGAAGAAAGATCAGATGG - Intergenic
926534378 2:14092648-14092670 CAGAAGGAAGAAAGGAAAGAAGG + Intergenic
926731137 2:16036614-16036636 CAGGTGGAAGACATGTCAGAAGG - Intergenic
927031491 2:19124763-19124785 CTGCAGAAAGAAAGGTCAGAGGG - Intergenic
927259253 2:21070288-21070310 CTTGGGGAAGAAAAGTCAGGTGG + Intergenic
927689962 2:25201650-25201672 CATGGGGCAGAAAGGTGGGATGG - Intergenic
927875567 2:26653172-26653194 CAGGAGGAAGGGTGGTCAGATGG - Intergenic
928331381 2:30360394-30360416 CCAGGGGAGGAAAGGACAGATGG + Intergenic
929579660 2:43073875-43073897 CAGATGGAAGAATGGACAGATGG + Intergenic
930238399 2:48909668-48909690 AAGGGGAAAGAAAGATGAGATGG + Intergenic
931012113 2:57929279-57929301 AAGGGGAAAGAAAAGTCAGAAGG - Intronic
931405624 2:61974775-61974797 CAAGGGGGAGGAAGGTGAGAGGG - Intronic
931820506 2:65946794-65946816 TAGTGGGAAGTAAAGTCAGAGGG - Intergenic
932567525 2:72918845-72918867 CTGGGGGAAGCAAGGGCAGCAGG + Intronic
932577573 2:72971244-72971266 CAAGGGGAAGAGAGCTCTGAGGG + Intronic
932692096 2:73921705-73921727 GATGGGGAAGGGAGGTCAGATGG - Intergenic
932704092 2:74010027-74010049 CAGTGGGAGGAAAGGCCACAGGG - Intronic
933312806 2:80681939-80681961 CAGGGTAAAGAGAGGTGAGAAGG + Intergenic
933368149 2:81381061-81381083 GAGGTGGAAGGGAGGTCAGATGG + Intergenic
935121474 2:100186848-100186870 CAGATGTAGGAAAGGTCAGAGGG - Intergenic
935706509 2:105861946-105861968 CAGGTGGAAGAAAGGGAAGGGGG - Intronic
936611505 2:114006271-114006293 CAGGGGGAAAAAGGGTGGGAAGG + Intergenic
937973721 2:127568391-127568413 CTGGGGGAGGAAAGGGCAGGAGG - Intronic
938572368 2:132572227-132572249 CAGACGGAAGAAGGGGCAGAGGG - Intronic
938614058 2:132979442-132979464 CATGGGGCAGCAAGGTCAGTGGG - Intronic
938957115 2:136308906-136308928 AAGGGGGAAGAAATGTGGGATGG + Intergenic
940268912 2:151870352-151870374 GAGAGGAAAGAAAGGGCAGAGGG + Intronic
940274911 2:151929151-151929173 CAGGGGGAAGCAAGGAGAGATGG + Intronic
941728827 2:168893054-168893076 CAGGAGCAAGAGAGGTCAGGAGG + Intronic
941740537 2:169030343-169030365 CAGGGGGAACCAAGGTGAGGGGG + Intronic
941840286 2:170075627-170075649 AAGGGGGAATACAGGTCAAATGG - Intronic
942793176 2:179784316-179784338 TAGGGGGAAGAATGGGAAGAGGG + Intronic
942863789 2:180648036-180648058 GTGGGGGAAGAAAGGAGAGAGGG - Intergenic
942942319 2:181632833-181632855 CAGGAGGCAGAAAGGTCACTAGG + Intronic
943284565 2:185981271-185981293 GAGGGGTAAGAAAAGTTAGATGG + Intergenic
943821644 2:192330509-192330531 AAGGGGGAAGAAAGGAGGGAAGG + Intergenic
943883300 2:193176609-193176631 CAGGAGGAAGAAAGGAAAAAAGG - Intergenic
944663604 2:201940943-201940965 AGGGTGGAAGAAAGGTAAGAGGG - Intergenic
946340928 2:219067975-219067997 GAGGGGGATGCAAGGTCAGAAGG + Intergenic
946429729 2:219618882-219618904 CAGAGGGCGGAAGGGTCAGAGGG - Intergenic
946446156 2:219741399-219741421 CAGGGGGAAGAATGACAAGAAGG + Intergenic
946704346 2:222443577-222443599 CAGCGAGAAGAAATGGCAGAGGG - Intronic
946774455 2:223123382-223123404 CAGGGGGACTAAAAGTCACATGG - Intronic
946902196 2:224383461-224383483 CAGGAGGAAGGAAGGAGAGAAGG - Intronic
947029915 2:225782522-225782544 CAGAAGGAAGGAAGGACAGAGGG - Intergenic
947068601 2:226259724-226259746 CAGGGGGAAGAAAACTGACAAGG - Intergenic
947186355 2:227458972-227458994 CAGGGGCAACAAAGGTCAGGGGG - Intergenic
948257001 2:236575983-236576005 CAGGGGGAAGGAAGGGGAGGGGG - Intronic
948925829 2:241096675-241096697 CAGGAGGGAGAAGGGGCAGAAGG + Intronic
1171012272 20:21515141-21515163 CGGGTGGAGGAAAGGGCAGACGG + Intergenic
1171085886 20:22238006-22238028 CGGACGGAAGAAAGGACAGAGGG - Intergenic
1171468270 20:25348332-25348354 CAGGGATCAAAAAGGTCAGATGG + Intronic
1171523294 20:25791885-25791907 CAGAAGGAAGAAACCTCAGAAGG - Intronic
1171553532 20:26063998-26064020 CAGAAGGAAGAAACCTCAGAAGG + Intergenic
1171771471 20:29325835-29325857 CAGAGGGAAGGATGGACAGAGGG + Intergenic
1171905037 20:30893643-30893665 CAGAGGGAAGGATGGACAGAGGG - Intergenic
1172080588 20:32337760-32337782 CAGGGGAAATACAGGACAGACGG + Intergenic
1172114805 20:32567317-32567339 CAGGAGGAAGAAAGAAAAGAAGG - Intronic
1172225569 20:33303046-33303068 CAGGGTGAACAAAGGGCGGAGGG - Exonic
1172241005 20:33412457-33412479 GTGGGGGAAGAGAGGGCAGAGGG + Intronic
1172944688 20:38678051-38678073 CCAGTGGAAGAAAGGTCACAAGG - Intergenic
1173220041 20:41125151-41125173 CAGGGAGCAGGAAGGCCAGAAGG + Intergenic
1173305199 20:41841241-41841263 CAGAGGGAGGGAAGGACAGAGGG - Intergenic
1173388822 20:42612975-42612997 TAGGGGGAAAAAAGACCAGATGG + Intronic
1173595057 20:44253669-44253691 CAGGGGGCAGAGATGGCAGATGG + Intronic
1173618005 20:44415417-44415439 TAGGGGGAAGAAAGGGTTGAAGG + Intronic
1173675600 20:44832526-44832548 CAGGGGAAGGAAAGCACAGAAGG - Intergenic
1173705158 20:45104799-45104821 CAGGGTAAAGAAAGGGCAGGAGG - Intergenic
1174015017 20:47480902-47480924 AAGGAGGAAGAAAGGAAAGAAGG - Intergenic
1174114196 20:48215686-48215708 CAGAGGGAAGGAAATTCAGATGG + Intergenic
1175206894 20:57317971-57317993 CAGGGGGCACAAGGGGCAGAAGG - Intergenic
1175365533 20:58452543-58452565 CAGAGTGAAGTAAGGTCAAAGGG + Intergenic
1175369492 20:58478383-58478405 AGGGAGGAAGAAAGGACAGAGGG - Intronic
1175379000 20:58549590-58549612 GATGGGGGAGAAAGATCAGAGGG + Intergenic
1175668107 20:60877569-60877591 CAGGGGGCAGAAAGGTGATGAGG - Intergenic
1175785866 20:61711539-61711561 AGGGAGGAAGGAAGGTCAGAGGG - Intronic
1175948226 20:62568570-62568592 CAGGGAGATGAAAAGACAGATGG - Intronic
1176637091 21:9256521-9256543 CAGGGGGAAAAATGCTCAAAAGG - Intergenic
1177614622 21:23500790-23500812 CAGGAGGAAGAGAGGTCTGGGGG - Intergenic
1178226560 21:30725964-30725986 CAGGTGGAAGAAAAGAAAGATGG + Intergenic
1178370559 21:32023582-32023604 CTGGGGAAAGAAAAGTCAGAGGG - Intronic
1179556209 21:42178640-42178662 CAGGGGACAGAAAAGACAGAGGG - Intergenic
1180316859 22:11283687-11283709 CAGAGGGAAGGATGGACAGAGGG + Intergenic
1180338470 22:11599828-11599850 CAGAGGGAAGGATGGACAGAGGG - Intergenic
1181169107 22:20998343-20998365 CAGGGGCAAGGCAGGGCAGAAGG - Exonic
1181662132 22:24359448-24359470 CAGAGGTAAGAAAGGTGAGGAGG - Intronic
1182779540 22:32856815-32856837 CAGAGGCAAGAAAGGTAATAAGG - Intronic
1182883837 22:33756562-33756584 CAGGGAGAAGAAAGAACAGGTGG + Intronic
1183043151 22:35198381-35198403 CAGGGTGAAGAAGGGGGAGAGGG - Intergenic
1183054447 22:35294829-35294851 CAGGAGGAAGGAAGGAAAGAGGG - Exonic
1183441565 22:37825713-37825735 CAGTTGGAAGAATGGGCAGAGGG - Intergenic
1183969650 22:41467409-41467431 CAAAAGGAGGAAAGGTCAGATGG + Intronic
1184774851 22:46618038-46618060 CAGAGGAAAGAAAGCTCAGCTGG + Intronic
949457096 3:4250274-4250296 AAGGGGGAAGGAAGGGAAGAGGG + Intronic
949964054 3:9340291-9340313 GAGGGGGAAGAGAGCACAGAGGG - Intronic
950975892 3:17244465-17244487 TAGGAGGAAGGAAGGGCAGAAGG - Intronic
951035022 3:17923178-17923200 CAGGGGGATAAAAGCTTAGATGG + Intronic
951708664 3:25568498-25568520 AAGGGGGAAGAAAGGAAAAAAGG - Intronic
951800282 3:26588216-26588238 CAGAGGGAGGAAAGGGCTGAGGG - Intergenic
952221251 3:31326429-31326451 CAGGAGGAAGAGAGAGCAGAGGG + Intergenic
952632718 3:35488992-35489014 CATGGGTAAGAAAGGGCAGATGG + Intergenic
953644499 3:44741670-44741692 CAGGGAGAAGCAAGGGCAAAGGG + Intronic
953886466 3:46717186-46717208 TAGGGGGCAGGAAAGTCAGAGGG - Intronic
954952547 3:54488275-54488297 CAGAGGGAAGCAAGGGTAGAAGG + Intronic
955123750 3:56088465-56088487 AAGGGGGAAAAAATGACAGAGGG + Intronic
955389878 3:58513984-58514006 CAGTGGGAAAAAAGGTCTGGGGG + Intronic
956329309 3:68087630-68087652 CAAAGGGAAGAAAGGAAAGAAGG - Intronic
956754085 3:72368374-72368396 CAGGGGGAAGAGAGGGAAGGTGG - Intergenic
957683423 3:83469681-83469703 GAGGGGGAAGAGAGGAGAGATGG + Intergenic
957794186 3:84981655-84981677 AAGGAGGAAGAAAGGAAAGAAGG - Intronic
959391763 3:105783667-105783689 CAGTGGGAATAAAGCTGAGATGG + Intronic
959678159 3:109060810-109060832 CAGGGAGAAGAAACAGCAGAAGG + Intronic
960361371 3:116716006-116716028 CCTGTGGAAGAAAGGCCAGAAGG + Intronic
960965752 3:123103614-123103636 GAGGGAGAAGGAAGGGCAGAGGG - Intronic
962265231 3:133939841-133939863 AAGGAGAAAGAGAGGTCAGAAGG - Intronic
962598781 3:136974717-136974739 AAGGGGAAAGAAAGAACAGAAGG - Intronic
962878013 3:139550700-139550722 CAGTTGGAAGGAAGGACAGAAGG - Intergenic
962881971 3:139586856-139586878 GAGGTGGAAGAATGGGCAGAAGG + Intronic
964245846 3:154652402-154652424 CAGGGGGAGGGAAGGTCTGTAGG + Intergenic
964808174 3:160634438-160634460 CAGGGGGATGTCAGGGCAGAGGG - Intergenic
965729583 3:171756548-171756570 CGGGGGGAAGAAAGGATGGAAGG + Intronic
968717221 4:2169324-2169346 CAGGGGCAAGAATGGTTGGAGGG + Intronic
968974750 4:3816189-3816211 CAGAGGGCACAGAGGTCAGAGGG - Intergenic
969346504 4:6573851-6573873 CAGGGGGTGGACAGGACAGAAGG + Intergenic
969715339 4:8865646-8865668 CAGTGGGGAGAGGGGTCAGAAGG + Intronic
970369620 4:15393961-15393983 AAGGGGGAAGTAAGGGCAGAGGG + Intronic
971075172 4:23139751-23139773 CAGGGAAAAGAAAGTTCAGTAGG - Intergenic
971443935 4:26721881-26721903 CCAGGTGAAGAAAGGTTAGATGG - Intronic
971596834 4:28540281-28540303 AAGGGGAAAGAAAGGTAGGAGGG - Intergenic
971704539 4:30023394-30023416 CTGGGGGAAGAAAGAACAGCTGG - Intergenic
971953476 4:33384505-33384527 CAAGAGGTGGAAAGGTCAGAAGG - Intergenic
973291637 4:48477020-48477042 CATCTGGAAGAAAGATCAGAGGG + Intergenic
973587527 4:52408379-52408401 CAGGGGGAAGAGAGGGGACAAGG + Intergenic
973649680 4:52986167-52986189 CAGAGGGAAGAAAGGTGGGGAGG - Intronic
973750789 4:54019724-54019746 CAGGCAGAAGATGGGTCAGATGG - Intronic
973804578 4:54513526-54513548 CAGATGCAAGAAGGGTCAGAGGG + Intergenic
973936746 4:55853923-55853945 ACGGGGAAAGGAAGGTCAGAAGG - Exonic
976369379 4:84269425-84269447 CCGGGGAAAGAAACGACAGAAGG - Intergenic
978070335 4:104459724-104459746 AAGAGGGAAGAAAAGACAGAAGG - Intergenic
978346749 4:107777973-107777995 GAGGGGGAAGAAAGGAAAAAGGG + Intergenic
978592883 4:110345199-110345221 AAGGGGGAAGAAAGGAAAGAAGG - Intergenic
978644723 4:110916102-110916124 GAGTGGGAGGAGAGGTCAGAGGG + Intergenic
979989459 4:127357172-127357194 CAGAGGGAAAAACAGTCAGAAGG - Intergenic
980203289 4:129684233-129684255 GAGAGGGAAGAAAGGAAAGAAGG - Intergenic
980355154 4:131727739-131727761 CAGCAGGAAGAAACGCCAGAAGG + Intergenic
980356777 4:131735205-131735227 CAGGAGGAAGAAACGCCAGAAGG + Intergenic
980357316 4:131737693-131737715 CAGGAGGAAGAAACGCCAGAAGG + Intergenic
980358391 4:131742671-131742693 CTGGAGGAAGAAACGCCAGAAGG + Intergenic
980360010 4:131750109-131750131 CAGGAGGAAGAAACGCCAGAAGG + Intergenic
980616171 4:135228861-135228883 CAGGAGGAAGGAAGGAAAGAAGG - Intergenic
980757104 4:137179136-137179158 CAGGGGGAAAAAAGGACTAAGGG + Intergenic
981081102 4:140640271-140640293 CAGGGGGAAGAAAGGGGAAAGGG + Intronic
981183241 4:141770084-141770106 AAGGAGGAAGAAAGGAAAGAAGG - Intergenic
981755223 4:148135359-148135381 CATGTGGCAGAAAGGACAGAAGG - Intronic
982420038 4:155183996-155184018 CAGGAGGAAGAAGGGTGACATGG - Intergenic
983622564 4:169775583-169775605 CAGGAGGAAGAAAGGAAAAACGG - Intergenic
984842436 4:184080779-184080801 CAAGGGGAAGAAGGGTGTGATGG - Intergenic
985297399 4:188449857-188449879 CAGGGGGAAGAAAGCGCAGGTGG - Intergenic
985358886 4:189151141-189151163 AAGGGGGAACAAAGGAAAGAAGG - Intergenic
1202751982 4_GL000008v2_random:14948-14970 CAGGGGGAAAAATGCTCAAAAGG - Intergenic
986044318 5:4022788-4022810 CAGGGAGAAGGAAGCTCAGAAGG - Intergenic
986142255 5:5041628-5041650 GAGGGGGAAGCCAGGTCACATGG + Intergenic
986580227 5:9258090-9258112 AAGGGGGAAGAACTGTCAAATGG + Intronic
989605160 5:43237218-43237240 CAGAGAGAACAAAGGTGAGATGG + Intronic
991449037 5:66732272-66732294 AAGGTGGAAGAAAGGGCAGTAGG - Intronic
992116242 5:73540890-73540912 AAGAGGGAAGAAAGGAAAGAGGG + Intergenic
994036239 5:95204287-95204309 CAGGTAGAAGAAAGGACAAAGGG + Intronic
995308729 5:110687101-110687123 CAGGGGGAAGAAAGGTCAGAAGG - Intronic
995791669 5:115894750-115894772 GAGGGGGAAGAAAGCTCATTAGG - Intronic
996035653 5:118755926-118755948 CAGGAGGAAGAAAGAGAAGAGGG - Intergenic
996739749 5:126788044-126788066 CAGGTGGAAGAAAGGAGAGAAGG + Intronic
997009433 5:129859359-129859381 GAAGGGGAAGAAAGGCCACATGG + Intergenic
997242198 5:132315615-132315637 CAGGGTGAAGAAGGGTAAGAGGG + Intronic
998238324 5:140419901-140419923 GAGGGGGAAGGAAGGACAGACGG - Intronic
998669631 5:144339385-144339407 CATGGGGAAAAAAGGAGAGAGGG - Intronic
999311355 5:150554020-150554042 CAGGGGGAAGAAAGGGGTGCAGG - Exonic
999495020 5:152088511-152088533 CAGGGGAAAGGAAGGAAAGAGGG - Intergenic
999773849 5:154795348-154795370 CAGGGGAAAGAAAGGTCCTTAGG + Intronic
1000209833 5:159098794-159098816 AAGGGGGGAGAAAGGAAAGAAGG + Intronic
1001415250 5:171541092-171541114 AAGGGGGAAGAAAGAAAAGAAGG + Intergenic
1001536508 5:172501967-172501989 CAAGGGGAAGAAAGCACAGTGGG + Intergenic
1001575273 5:172759236-172759258 CTGGGAAAAGAAAAGTCAGAGGG + Intergenic
1004319652 6:14622378-14622400 CAAGGGAAAGAGAAGTCAGAAGG + Intergenic
1005257667 6:24021467-24021489 AAAGGGGAAGAGAGGCCAGAAGG - Intergenic
1005685158 6:28246795-28246817 GAGGAGAAAGCAAGGTCAGAAGG + Intronic
1005697407 6:28364290-28364312 GAGGAGAAAGCAAGGTCAGAAGG - Intronic
1005752112 6:28893393-28893415 CAGAAGGAAGAAAGGAGAGAAGG + Intergenic
1005898335 6:30196750-30196772 CAGGGGGCAGGAAGGGGAGAAGG + Intronic
1005955291 6:30659463-30659485 CTGGGGCACGAAAGGTCAGTTGG - Exonic
1006067050 6:31469599-31469621 CAGTGGGGAGAAAGGACAAAGGG + Intergenic
1006591132 6:35158585-35158607 AAGGGGGAAGGAAGGAAAGAAGG - Intergenic
1006611419 6:35296582-35296604 CAGGGGGAAGAAGGGATACAGGG + Intergenic
1006727620 6:36211231-36211253 CAGGGAGAAGGGAGGACAGAAGG - Intronic
1006831458 6:36970614-36970636 CAGTGGGAAGGAAGGACAGCTGG + Intronic
1006841897 6:37033822-37033844 TTGGGGGATGACAGGTCAGAGGG - Intergenic
1007056933 6:38895670-38895692 CAGAGGGAAGAGAGGACAAAGGG - Intronic
1007253320 6:40511138-40511160 GAGGGGGCACGAAGGTCAGATGG + Intronic
1007341565 6:41194175-41194197 CAGGGGAAAGGAGGGTCAGTGGG - Intronic
1009395078 6:63190290-63190312 CAGAAGGAAGAAAGGGGAGATGG + Intergenic
1009848511 6:69164994-69165016 CAGGCAGAATAAAGGTCTGAGGG - Intronic
1009871384 6:69456371-69456393 AAGGGTGAAAAAAGCTCAGAGGG + Intergenic
1010101365 6:72112142-72112164 CAGGGGGAGGAAAGGCCAGGAGG - Intronic
1010768521 6:79803046-79803068 CTGGGTAAGGAAAGGTCAGACGG - Intergenic
1011160284 6:84381894-84381916 CAGGGGGAAGAACGGTGAGGGGG - Intergenic
1011409685 6:87055082-87055104 CAGGGAGGAGAATGGGCAGAGGG - Intergenic
1011874148 6:91936086-91936108 GGGGGAGAAGAAAGCTCAGATGG + Intergenic
1012943158 6:105438527-105438549 AAGGGTGAAGAAGGGTGAGAGGG - Intergenic
1013233685 6:108177828-108177850 CAGGGGATAGAAAAGCCAGAGGG + Intronic
1014081269 6:117288667-117288689 CAAGGTGAAGAAAAGTCTGAGGG - Exonic
1014172879 6:118298419-118298441 CAAGGGGAAATAAGGTCACAAGG - Intronic
1014192514 6:118514197-118514219 AAAGGGGAACAAAGATCAGATGG + Intronic
1014495692 6:122119172-122119194 CAAGGGGAAGGAAGGAAAGAAGG + Intergenic
1014828608 6:126075482-126075504 CAGGGGGAAGAGAGATAAGTGGG - Intergenic
1015584671 6:134763350-134763372 CAATGGGTAGAAAGGGCAGATGG + Intergenic
1015712149 6:136153853-136153875 CAGAGGGGAGAAAGGCCAAAAGG - Intronic
1016278285 6:142380638-142380660 CAGGGGTAAGAAAGTAGAGATGG - Intronic
1016403269 6:143703226-143703248 CTGGGGGAATAGAGGTGAGAGGG + Intronic
1016671840 6:146718445-146718467 TAGGGGGAAGAATGGGCACAGGG - Intronic
1016832262 6:148445702-148445724 CAGGGCGAAGAGAGGGAAGAAGG + Intronic
1016997263 6:149969520-149969542 CAGGGGGAAGAAGGGAGAGGAGG - Intronic
1017030115 6:150213781-150213803 AAGAGGGAAGAAGGGCCAGATGG - Intronic
1017542652 6:155418552-155418574 GAGGGGGAAGAATGGGCAGGAGG - Intronic
1017689805 6:156952643-156952665 AAGGTGGATGAATGGTCAGAAGG - Intronic
1018595195 6:165471645-165471667 CAGAGGGAAGAAAGGAAAGGAGG - Intronic
1018631462 6:165826358-165826380 CAGAGGGATGCAAGGACAGAGGG - Intronic
1019146329 6:169977662-169977684 CCGGGAGAAGAAGGGCCAGAGGG + Intergenic
1019340581 7:507134-507156 CTGAGGGGACAAAGGTCAGAGGG - Intronic
1019550219 7:1598515-1598537 CAGAGGGAAGATGTGTCAGAGGG + Intergenic
1019932111 7:4230469-4230491 CAGGGGGAAGGAAGGAGGGAGGG + Intronic
1020000226 7:4751483-4751505 CTGGGGGAAGACAGGTCTGAGGG - Intronic
1020026837 7:4905424-4905446 GAAGGGGAAGAAAGGGAAGAAGG + Intergenic
1020101018 7:5394496-5394518 GAGCGGAAAGACAGGTCAGAGGG + Exonic
1021449986 7:20776286-20776308 TAGGGGCAAGAAAGGTGAGTAGG + Intronic
1021637223 7:22704907-22704929 CATGGAGGAGAGAGGTCAGATGG - Intergenic
1021686406 7:23191300-23191322 GAGGGGGGAGAAAGGTCTGTTGG + Intronic
1021958226 7:25847753-25847775 CAGGGAGAAGAAGGGGTAGAGGG - Intergenic
1023127028 7:36964938-36964960 CAGAGGGAAGCAAGGCCAGTTGG - Intronic
1023602316 7:41892133-41892155 CAGAGGCAAGAAAGCTGAGAAGG + Intergenic
1023921890 7:44636252-44636274 CTGGGGGAAGGGATGTCAGATGG + Intronic
1024316714 7:48026773-48026795 CAGTCAGAAGAAAGGTCACATGG + Intronic
1024555600 7:50600581-50600603 CAGAGGGAAGGAAGGAGAGAGGG + Intronic
1025875497 7:65477047-65477069 CAGGGAGAGGAAAAGTCAGCAGG - Intergenic
1028428762 7:90722133-90722155 AAGGGGGAAGAGGGGTAAGAGGG - Intronic
1029212794 7:98922510-98922532 CAGGGAGCAGAAAAGTCAGCAGG - Intronic
1030006336 7:105124273-105124295 CAGCGGGAAGGAAGGAAAGAGGG - Intronic
1030349534 7:108468657-108468679 CTGGGGGGAAAAAGCTCAGAGGG + Intergenic
1030900566 7:115118441-115118463 AAGAGGGAAGAAATGTCAGATGG - Intergenic
1031049928 7:116934769-116934791 CAGGAGGAAGGAAGGAAAGAAGG - Intergenic
1031340995 7:120601416-120601438 CAGGTGGAAGAAAGATCGAAAGG + Intronic
1031912409 7:127532165-127532187 CAGGAGGAAGAAAGAGAAGAGGG - Intergenic
1031939357 7:127771192-127771214 CAGGGTGAATAATGATCAGAAGG - Intronic
1032328150 7:130951411-130951433 CAGAGGGAAGAGAGTCCAGAAGG - Intergenic
1033198064 7:139344042-139344064 AAGGGGCAGGAAAGGTGAGATGG - Intronic
1033422956 7:141218909-141218931 GAGTGGGAAGAAAGTTCAGAAGG - Intronic
1033478693 7:141716467-141716489 GATGGGGAAGAGAGGGCAGAAGG - Intronic
1033605165 7:142921728-142921750 CAGGGGGATGGGAAGTCAGAAGG - Intronic
1033655644 7:143372127-143372149 CAGGACGTAGAAAGGTCAGATGG + Intergenic
1033969772 7:147025325-147025347 CAGGGAGAAGAAAGGGGGGAGGG + Intronic
1034261005 7:149755493-149755515 CAGGGGGCAGCAATGTCAGCAGG + Intergenic
1035161151 7:156950608-156950630 CAGGGGGAAGAAAAGGAAAAGGG + Exonic
1035412746 7:158658197-158658219 CAGGGAGAGGGAAGGGCAGAAGG + Intronic
1036154166 8:6326242-6326264 CAGGAGGAAGGAAGGGAAGAAGG + Intergenic
1037940437 8:22947188-22947210 AAAGAGGAAGAAAGGTCAGAAGG - Intronic
1039606417 8:38884356-38884378 AAGGGGGAAGAAAAAACAGAAGG + Intergenic
1039758672 8:40550281-40550303 CAGAGGGAAGGATGGTCAGGTGG - Intronic
1040493027 8:47942308-47942330 CAGGGGGAACACAAGTCTGACGG + Intronic
1040747277 8:50660476-50660498 CAGAGGGGAGAAAGGAAAGAAGG + Intronic
1042506810 8:69569637-69569659 CAGGTATAAGAAAAGTCAGAGGG - Intronic
1042715035 8:71763283-71763305 ATAGGGGAAGAAAGGTGAGAAGG + Intergenic
1042844378 8:73155753-73155775 AAGGGGGAGGAAAGGCCAGGTGG + Intergenic
1043512924 8:80967237-80967259 AAGGGGGCAGCCAGGTCAGATGG + Intergenic
1044416994 8:91949666-91949688 CAGGGAGGGGAGAGGTCAGATGG - Intergenic
1044691289 8:94882016-94882038 CAGGGGAAAGAAAGTTCTAAGGG - Intronic
1045341089 8:101255101-101255123 CAAGGGGCAGAAAGGACAAAAGG - Intergenic
1045444665 8:102248204-102248226 GAGTGGGCAGTAAGGTCAGAGGG + Intergenic
1045606078 8:103778410-103778432 CAGAGGCCAGAAAGGGCAGAGGG - Intronic
1045798300 8:106071904-106071926 CAGGGGGAAAAAAGGTTCAAAGG + Intergenic
1046373428 8:113343095-113343117 CAGGAGGAAGAAAAGACTGAAGG + Intronic
1046432399 8:114145540-114145562 CAGGGGGAAAAAAAATCTGAAGG - Intergenic
1046710268 8:117503390-117503412 GAGGAGGAAGAAAGTGCAGAAGG + Intergenic
1047693699 8:127382546-127382568 CAGAGGGAAGAAAAGGCAGTAGG + Intergenic
1048007661 8:130432085-130432107 AAGGGGGAGGAAAGGGAAGAGGG + Intronic
1048054032 8:130846748-130846770 GAAGGGGAAGGAAGGACAGAAGG - Intronic
1048364345 8:133725303-133725325 CTGGGGGATGAGAGGCCAGATGG + Intergenic
1049590276 8:143456225-143456247 CAGGGGGAAGAAAACCCACAGGG + Intronic
1049904624 9:204284-204306 CATGGGGAACAGAGCTCAGAAGG - Intergenic
1050265983 9:3890144-3890166 CAGGTGGAAGAAAGGAGAAATGG - Intronic
1050274890 9:3986493-3986515 ACTGGGGAAGAAAGGTCAGAGGG - Intronic
1050996947 9:12232503-12232525 CAGGCTGAAGAAATCTCAGATGG - Intergenic
1052025138 9:23565864-23565886 CATGGGGAAGAATGATTAGAAGG + Intergenic
1052305310 9:27002085-27002107 AAGGAGGAAGAAAGAGCAGAGGG + Intronic
1052391472 9:27883237-27883259 CAGGAGGAAGAAAGAGCAGGCGG - Intergenic
1053833139 9:42105574-42105596 CAGGGGCAAGAAGGCTCTGAGGG - Intronic
1054597412 9:67081835-67081857 CAGGGGCAAGAAGGCTCTGAGGG + Intergenic
1054938619 9:70715740-70715762 AAGGGGAAATACAGGTCAGAGGG - Intronic
1054940310 9:70733733-70733755 AAGGGGAAATACAGGTCAGAGGG - Intronic
1055101202 9:72467489-72467511 CTGTGGGAAGAAAGAACAGAGGG - Intergenic
1055177685 9:73340260-73340282 CAGAGAAAGGAAAGGTCAGAGGG + Intergenic
1055478856 9:76690189-76690211 AAGGGGCGAGAAAGGGCAGAAGG - Intronic
1055500334 9:76896604-76896626 AAAGGGGAAGAAAGGAAAGAAGG - Intronic
1056363604 9:85882308-85882330 CCTGGGGAGGAGAGGTCAGATGG - Intergenic
1057794064 9:98143205-98143227 GAGGGGGAAGACAGGACAGAAGG + Intronic
1058551469 9:106120019-106120041 CAAGGGGGAGGAAGGTGAGAGGG - Intergenic
1058946032 9:109857137-109857159 CAGGAGGAGGAAGGGGCAGAAGG - Intronic
1059672225 9:116502665-116502687 CAGAAGGAAGAAAGGAAAGAAGG + Intronic
1059774968 9:117465420-117465442 GAGGCAGAAGAAGGGTCAGATGG - Intergenic
1060106979 9:120878659-120878681 CAGGGGGATCAAGGGGCAGAAGG - Intronic
1060436554 9:123598065-123598087 CAAAGGGTTGAAAGGTCAGAGGG - Intronic
1060510037 9:124224994-124225016 CAGGAGGAAGAAAGGAAAGAAGG - Intergenic
1060542593 9:124440892-124440914 CAGGGGAAAGACAGTTCAGGCGG + Intergenic
1060606446 9:124918837-124918859 CAGGAGGCAGAAAAGGCAGAAGG - Intronic
1060705094 9:125791552-125791574 CAGGAGGAAGAGAGGGCAGGGGG - Intronic
1061404812 9:130387659-130387681 CAGTGGGAAGAACGGGCTGAGGG + Intronic
1061405059 9:130389062-130389084 CGTGGGGCAGAAAGGTCTGAAGG + Intronic
1061630021 9:131866445-131866467 CAGGGGGAAGAGAGGCGACAGGG - Intronic
1062156202 9:135050057-135050079 CAGGGGGCAGAATGGACAGAAGG + Intergenic
1203365162 Un_KI270442v1:249625-249647 CAGAGGGAAGGATGGACAGAGGG + Intergenic
1203718446 Un_KI270742v1:178585-178607 CAGGGGGAAAAATGCTCAAAAGG + Intergenic
1203652655 Un_KI270751v1:142280-142302 CAGGGGGAAAAATGCTCAAAAGG + Intergenic
1185492537 X:528790-528812 CAGAGGGAAGGAAGGAAAGAAGG - Intergenic
1185669901 X:1799628-1799650 CAAGGGGAAGATAAGTCGGAAGG - Intergenic
1185933312 X:4227722-4227744 AAGGAGGAAGAAAGGAAAGAAGG - Intergenic
1186659769 X:11657813-11657835 GAGTGGGAAGAAAGGTAAGGAGG + Intronic
1187299670 X:18035923-18035945 CAGAGGGAAAAAAGTGCAGAAGG - Intergenic
1188215086 X:27466402-27466424 CATGGGGAGGAAATGTGAGAGGG - Intergenic
1188215484 X:27471450-27471472 GTGCGGGAAGAAAGGTGAGATGG - Intergenic
1189155269 X:38750324-38750346 CAGGCTGAGGAGAGGTCAGAGGG - Intergenic
1189237370 X:39497647-39497669 CTGGGGGAAGAAGGGTCAGGAGG + Intergenic
1189944614 X:46165218-46165240 TACAGGGAAGAAAGGCCAGAGGG + Intergenic
1190005058 X:46727536-46727558 CAGGAGGAAGATACGCCAGAGGG + Intronic
1192386494 X:70677310-70677332 CATTGGGAAGAAAACTCAGAAGG - Intronic
1193125945 X:77870245-77870267 TTGGGGGAAAAAGGGTCAGAGGG + Intronic
1193896863 X:87125914-87125936 TAGGAGGAAGCAAGGTAAGATGG + Intergenic
1194638365 X:96373222-96373244 GAGGGGGAAGGAAGGACAGGTGG + Intergenic
1194828986 X:98597186-98597208 CAGCTGGAAAAAAGGGCAGAGGG + Intergenic
1196864204 X:120056117-120056139 TAGGGGAAAGAATGGTGAGAAGG + Intergenic
1196878895 X:120180213-120180235 TAGGGGAAAGAATGGTGAGAAGG - Intergenic
1197761400 X:130030856-130030878 AGGGGGAAAGGAAGGTCAGAGGG - Intronic
1198204360 X:134452200-134452222 GAGAGGGAAGAAAGGAAAGAGGG + Intergenic
1198520889 X:137451313-137451335 CAGAGGGAAGAAAGGGATGATGG + Intergenic
1199498207 X:148477934-148477956 CAGGGAGAAGAAAAGTAAGAAGG + Intergenic
1201073576 Y:10170801-10170823 CAGAGGGAAGGAGGGACAGAAGG - Intergenic
1201452987 Y:14136206-14136228 CAGAGGGAAGGAAGGAGAGAGGG - Intergenic