ID: 995310695

View in Genome Browser
Species Human (GRCh38)
Location 5:110707348-110707370
Sequence AGGGAGAGTGCAGTAACTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 491
Summary {0: 1, 1: 0, 2: 19, 3: 92, 4: 379}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995310688_995310695 25 Left 995310688 5:110707300-110707322 CCAGCCGATGGCACCATGGCACA 0: 1
1: 0
2: 0
3: 5
4: 92
Right 995310695 5:110707348-110707370 AGGGAGAGTGCAGTAACTGCAGG 0: 1
1: 0
2: 19
3: 92
4: 379
995310689_995310695 21 Left 995310689 5:110707304-110707326 CCGATGGCACCATGGCACAGAAA 0: 1
1: 0
2: 0
3: 14
4: 175
Right 995310695 5:110707348-110707370 AGGGAGAGTGCAGTAACTGCAGG 0: 1
1: 0
2: 19
3: 92
4: 379
995310690_995310695 12 Left 995310690 5:110707313-110707335 CCATGGCACAGAAAAAGAATGTG 0: 1
1: 0
2: 4
3: 34
4: 382
Right 995310695 5:110707348-110707370 AGGGAGAGTGCAGTAACTGCAGG 0: 1
1: 0
2: 19
3: 92
4: 379
995310687_995310695 26 Left 995310687 5:110707299-110707321 CCCAGCCGATGGCACCATGGCAC 0: 1
1: 0
2: 1
3: 5
4: 91
Right 995310695 5:110707348-110707370 AGGGAGAGTGCAGTAACTGCAGG 0: 1
1: 0
2: 19
3: 92
4: 379
995310686_995310695 27 Left 995310686 5:110707298-110707320 CCCCAGCCGATGGCACCATGGCA 0: 1
1: 0
2: 1
3: 14
4: 133
Right 995310695 5:110707348-110707370 AGGGAGAGTGCAGTAACTGCAGG 0: 1
1: 0
2: 19
3: 92
4: 379

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995310695 Original CRISPR AGGGAGAGTGCAGTAACTGC AGG Intronic
900750569 1:4394547-4394569 GGGGAGAGTGAAGGAACAGCGGG + Intergenic
900787834 1:4659874-4659896 ATGGAAAGGGCAGTAACTACTGG - Intronic
901468360 1:9438230-9438252 AGGCTGAGTGCGGTTACTGCTGG + Intergenic
903454863 1:23480494-23480516 AGGGAGAGAGCAGTAAGGACTGG - Intronic
904902251 1:33866682-33866704 AGGGAGAGGGCAGGAAGAGCAGG - Intronic
905187049 1:36204208-36204230 AGGGAGGGTTCAGTAGCTACAGG + Intergenic
905740222 1:40363792-40363814 AAGGAGAGTGCAGTGATTGTGGG + Intronic
906827172 1:48993804-48993826 AGGGAGAGTGCAGTGATTGTGGG - Intronic
908002746 1:59696688-59696710 AGGAAAAGTGCAGCAAGTGCAGG + Intronic
908093020 1:60706648-60706670 AGGGAAAGTGAAGTGACTGTGGG + Intergenic
908363273 1:63390800-63390822 AGGGAGAGTGCAGTGACTATGGG - Intronic
909582462 1:77253467-77253489 AGGGAGAGTGAAGTGATTGTGGG + Intergenic
910470525 1:87547745-87547767 AGGGAGAGGACAGTGACTGTGGG - Intergenic
910724845 1:90327793-90327815 AGGGAGAATGCAGTGATTGTGGG + Intergenic
911942859 1:104069513-104069535 AGAGAGAGTGCAATGACTGGGGG - Intergenic
911960846 1:104300915-104300937 AGGGAGGGTGCAGTGACTGAAGG + Intergenic
912018548 1:105072980-105073002 AGGAAGAGTGCAGTGACTGAGGG - Intergenic
912601013 1:110933545-110933567 AGGGAGAGCACAGCAATTGCGGG + Intergenic
912873241 1:113328863-113328885 AGGGAGAATGCAGTAATTGTGGG - Intergenic
913336740 1:117715863-117715885 TGGGTGAGTGCTGTAACTGCTGG + Intergenic
913694126 1:121307826-121307848 AGAGAGAGTGAAGGAACTGAAGG + Intronic
914143437 1:144972240-144972262 AGAGAGAGTGAAGGAACTGAAGG - Intronic
915307787 1:154990570-154990592 AGCTAGGGTGCAGTGACTGCTGG - Intronic
915752662 1:158226761-158226783 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
917306127 1:173627467-173627489 AGGGAGAGCACAGTGACTGTGGG + Intronic
917720791 1:177784767-177784789 AGGAAGAGGGCAGCTACTGCAGG + Intergenic
918357892 1:183723505-183723527 AGGGAGAGTACAGTGACTGTGGG + Intronic
918689782 1:187466150-187466172 AGGGAGAGTGCAGTTCATGAAGG - Intergenic
919147336 1:193651935-193651957 AGGGAGAGCACAGTAACTGTGGG - Intergenic
919169705 1:193938553-193938575 GGGGAGAGTGCAGCAATTGTGGG + Intergenic
919568829 1:199221267-199221289 AGGCAGGGTGCAGTAGCAGCTGG + Intergenic
919767779 1:201138489-201138511 AGGGAGAGGGGAGGAACTGGTGG - Intronic
920481453 1:206326213-206326235 AGAGAGAGTGAAGGAACTGAAGG + Intronic
920596827 1:207280192-207280214 AGGGAGAGCACAGTTACTGTGGG - Intergenic
921375692 1:214471158-214471180 AGGGAAAGTGCAGTAAACCCTGG + Intronic
921746123 1:218742679-218742701 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
922319824 1:224476960-224476982 AGGGTGAGGCCTGTAACTGCCGG - Intronic
922377032 1:224979326-224979348 AGGGAGAGTGCAGTGCTTGTGGG + Intronic
923751304 1:236748657-236748679 ATGGAGAGAGAAGGAACTGCAGG - Intronic
924516319 1:244769011-244769033 AGGGAGAGCGCAGTGACTGGGGG - Intergenic
1063017965 10:2096841-2096863 AGGGAGGCAGCAGTACCTGCTGG + Intergenic
1063887629 10:10595634-10595656 AGGGAAAGTGTAGTCACTTCTGG - Intergenic
1064446466 10:15398348-15398370 AGGGAGAGTGAAGCAATTGGAGG + Intergenic
1064537576 10:16373749-16373771 AGAGAAAGTGCAGTAACAGAGGG + Intergenic
1064615031 10:17144512-17144534 AGGGAGACTTCAGTAAGTGCTGG + Intronic
1065431559 10:25662055-25662077 AAGGAGAGTGTAGTGACTGTGGG - Intergenic
1065921716 10:30398959-30398981 AGGGAGAGTGCAGCAATTGTGGG + Intergenic
1066248174 10:33605197-33605219 AGGGAGTGGGCAGGAACTTCAGG + Intergenic
1066708133 10:38203221-38203243 AGGGAGAGCACAGCAACTGTGGG + Intergenic
1067487501 10:46664758-46664780 AAGGAGACTGTAGTAACTTCTGG - Intergenic
1067607304 10:47677251-47677273 AAGGAGACTGTAGTAACTTCTGG + Intergenic
1069050571 10:63788305-63788327 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1069076441 10:64042319-64042341 AGGGAGAGTGGAGTGAGTGCAGG - Intergenic
1069286448 10:66721131-66721153 AGTGAGAGTTCAGATACTGCAGG + Intronic
1069403701 10:68075856-68075878 AGGGAGAGTGTAGAAAGTGATGG - Intergenic
1070059556 10:72968675-72968697 AGGGAAAGTACAGTAACTGGGGG - Intergenic
1071622862 10:87138630-87138652 AAGGAGACTGTAGTAACTTCTGG + Intronic
1072158409 10:92744393-92744415 AGAGAGACTGCAGTAAATGGTGG - Intergenic
1072990185 10:100185688-100185710 AGGGAGAGGGTAGAAACTGGAGG - Exonic
1074099789 10:110345756-110345778 GGGGAGAGTGGAGTGACTCCTGG + Intergenic
1074992544 10:118722911-118722933 AGGGAGAGGGTGGTAACTTCTGG - Intronic
1075496261 10:122922166-122922188 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1076353760 10:129837972-129837994 AAGGACAGAGCAGTTACTGCAGG + Intronic
1076913239 10:133402771-133402793 TGGGTGAGTGCAGTGAATGCAGG + Exonic
1077790853 11:5438255-5438277 AGAGAGAGGGCAGTATCTCCAGG - Intronic
1077851773 11:6079882-6079904 AGGGAAAGTGTAGTAACTTCTGG - Intergenic
1078690783 11:13578735-13578757 AGGGAGAGTGCAGGGATTGCGGG + Intergenic
1080489963 11:32751588-32751610 AAGGAGAGTGCAGCAATTGTGGG - Intronic
1080549660 11:33361518-33361540 ATGGAGTGTGCAGTAGTTGCTGG - Intergenic
1080618630 11:33967953-33967975 AGGGAGAATGAAGAAAATGCTGG - Intergenic
1080938394 11:36886064-36886086 AGGGAGAGTCCAGTGGCAGCAGG - Intergenic
1081721773 11:45294623-45294645 AGGGAGAGTCCAGAAACCCCTGG + Intergenic
1085194851 11:74662957-74662979 AGGGAGAGTGCAGCAACTGTGGG - Intronic
1085572244 11:77569531-77569553 AGGGAGAGTGCAGTGATTATGGG - Intronic
1085716254 11:78876180-78876202 ATAGAGAGTGCATTGACTGCTGG + Intronic
1086032990 11:82383213-82383235 AGGGAGAGCACAGCAACTGAGGG + Intergenic
1086948465 11:92867251-92867273 GGGGAGAGTGAATGAACTGCAGG + Intronic
1087029126 11:93684715-93684737 AGGGAGAGTCCAGTGGCAGCAGG - Intronic
1087104412 11:94395838-94395860 AAGGAGAGAGGAGTAATTGCAGG - Intronic
1087789566 11:102392106-102392128 AGGGTGAGTGAAGGAACTGTGGG - Intergenic
1088009722 11:104985679-104985701 AGGGAGAGTACAGCATCTGAGGG + Intergenic
1089081607 11:115780868-115780890 AGGGAGCCTGCTGTCACTGCAGG - Intergenic
1090210492 11:124917566-124917588 AGGGAGAGTGCAGTCATTGTGGG - Intergenic
1090529440 11:127575530-127575552 AGGGAGAGTGCAGGAGATGGAGG + Intergenic
1090713846 11:129412623-129412645 AGGAAGAGGGCGGTAACTTCTGG + Intronic
1091827205 12:3521763-3521785 AGGGAGACTAAAGTATCTGCTGG + Intronic
1091877132 12:3944664-3944686 GAGGAGAGTGCAGAAAATGCAGG - Intergenic
1092151425 12:6251526-6251548 ATGGAGGGTGCAGTCAGTGCTGG + Intergenic
1093531900 12:20175252-20175274 AGAGAGAGTCCAGTGACTGTGGG - Intergenic
1093727669 12:22533528-22533550 AGAAAGAGGGCAGAAACTGCAGG + Intronic
1094296625 12:28914447-28914469 AGGGTGAGTGAAGAAACTCCAGG + Intergenic
1094419680 12:30257476-30257498 AGGGAGAGCACAGTAACTATAGG + Intergenic
1095860141 12:46907802-46907824 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
1097118657 12:56717202-56717224 AGGGAGACAGGAGTCACTGCTGG + Intronic
1097899388 12:64857899-64857921 TGGGAGAGTGCAGTGACTAGAGG - Intronic
1098405573 12:70122901-70122923 AGAGAGAGTGCAGTGACTAGAGG + Intergenic
1099491305 12:83292060-83292082 AGGGAGAGTGTAGTGATTGTGGG + Intergenic
1099757785 12:86876891-86876913 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1100904808 12:99285756-99285778 AGGAAGAGAGCAGTAATTGTGGG + Intronic
1100909295 12:99339328-99339350 AGGAAGAATGCAGTGATTGCTGG - Intronic
1104948514 12:132428200-132428222 AGGGCGAGAGCAGCAGCTGCTGG + Intergenic
1106350213 13:28922631-28922653 AGGGAGAGCGCAATGACTGGGGG - Intronic
1106814046 13:33387650-33387672 AGGGACAGTGCAGTGGCAGCAGG + Intergenic
1106978156 13:35247073-35247095 TGGGTGAGTCCTGTAACTGCTGG - Intronic
1107753960 13:43599367-43599389 AGGGAGAGTGCAGTGATAGTGGG + Intronic
1107803463 13:44132115-44132137 AGGGATAGGACAGTAACTGCAGG + Intergenic
1107808346 13:44175547-44175569 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1110665874 13:78116770-78116792 AGGGAGAATGCAGTGACTGTGGG - Intergenic
1111335459 13:86815765-86815787 AGGGAGAGTGCTGTGATTGTGGG + Intergenic
1112803731 13:103139289-103139311 AGGGAGAGTTCTGGTACTGCGGG + Intergenic
1112944499 13:104910748-104910770 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1113625080 13:111789130-111789152 AGGGAGAGGGCAGCATCTTCAGG - Intergenic
1114985249 14:28218210-28218232 AAGGAGAGTGCAGCAACTGCAGG - Intergenic
1115133883 14:30086206-30086228 AGGGAGAGCACAGTGACTGGGGG + Intronic
1116490920 14:45502193-45502215 AGGGTGACTGCAGTAACTGCAGG + Intergenic
1117384369 14:55195809-55195831 AGGGAGAGCGCAGTGACTGATGG - Intergenic
1118368223 14:65113777-65113799 TGGGAGAGAGAAGTAACTCCAGG + Intergenic
1119071201 14:71586398-71586420 GTGGAGAGTGCAGCAAGTGCAGG + Intronic
1121803556 14:96795559-96795581 AGGGAGGATGCAGTAACTTGTGG + Intergenic
1121915395 14:97833109-97833131 AGGGAGGGGGCAGAAGCTGCTGG + Intergenic
1122115880 14:99526997-99527019 AGGGAGAGTGCAGAGAAAGCAGG + Intronic
1124472134 15:29997265-29997287 ATGGAGAGTGCAGGAAGTGCAGG - Intergenic
1125247083 15:37653008-37653030 AGGGTGAGGCCTGTAACTGCTGG + Intergenic
1125266921 15:37892268-37892290 AGGAAGAGGACAGTAACTGTTGG - Intergenic
1126706749 15:51413490-51413512 AGGGAGAGGACAGTAATTGTGGG + Intergenic
1126979948 15:54229156-54229178 AGAGAGAATGCAGTAATTGCAGG - Intronic
1127971646 15:63966733-63966755 AGGGAGAGTGCAGCAATTGTGGG - Intronic
1128945139 15:71814674-71814696 AGGCAGAGGGCAGCTACTGCAGG + Intronic
1129030751 15:72616017-72616039 AGGGAGAATGCAGCAACTGTGGG - Intergenic
1129477594 15:75796541-75796563 AGGGAGAATACAGCAACTGTGGG - Intergenic
1129556456 15:76515286-76515308 AGGGTGAGTGCAGTAACTGAAGG + Intronic
1129835661 15:78703818-78703840 AGGGAGAATGCAGCAACTGTGGG - Intronic
1130441259 15:83956217-83956239 AGGGAGAGCACAGCAACTGGGGG - Intronic
1130511674 15:84594818-84594840 AGGGAGAATGCAGCAACTGTGGG + Intergenic
1132119846 15:99167275-99167297 TGTGAGAGTGCTGAAACTGCTGG - Intronic
1132404842 15:101535990-101536012 AGAGATAGGGCAGTAACTGGGGG + Intergenic
1132724264 16:1332126-1332148 AGGGAGCTTGCAGGAAATGCAGG - Intergenic
1133407749 16:5539156-5539178 AGGGAAAGTGCAGGAAGTGCTGG + Intergenic
1134348973 16:13418611-13418633 ATGGAGAGAGCAGAAGCTGCTGG + Intergenic
1136569951 16:31090743-31090765 AGGGAGAGTGGAGGGCCTGCTGG - Intronic
1136654284 16:31700679-31700701 AGGGACCGTCCAGTACCTGCAGG - Intergenic
1136679124 16:31945057-31945079 AGGGAGATTGCAGCAACTGGGGG + Intergenic
1137362382 16:47830631-47830653 AGGGAGAGAGAAATAACTCCAGG - Intergenic
1137469038 16:48738123-48738145 AGTGAGGGTTCAGTAAATGCTGG + Intergenic
1137709928 16:50559576-50559598 AGGGAGTGGGCAGTGCCTGCTGG + Intronic
1138890836 16:61142466-61142488 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
1139005041 16:62559487-62559509 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1140317274 16:73911308-73911330 AGGTAGAGTGCAGTCAATGTGGG + Intergenic
1140456848 16:75110777-75110799 AGGGAGAGCGCAGCTGCTGCAGG + Exonic
1140757339 16:78079629-78079651 AGGGAAAGGGTAGTAACTTCTGG - Intergenic
1142908665 17:3067785-3067807 AGGAAGAGTTCTGTAACTGCAGG - Intergenic
1142925899 17:3236460-3236482 AGGAAGAGTTCCGTAACTGCAGG + Intergenic
1143284114 17:5776506-5776528 AGGGAGAAAGCAGAAACAGCAGG + Intronic
1145069085 17:19787910-19787932 AGGGAGAGTGCAGCAATTTGGGG + Intronic
1146098965 17:29960133-29960155 AGGGAGAGCACAGTGACTGTGGG - Intronic
1146262875 17:31433221-31433243 AGAGAGAATGCAGTCACTTCTGG + Intronic
1148546020 17:48519660-48519682 AGAGATAGTGGAGTAACTGGAGG + Intergenic
1148777210 17:50102395-50102417 AGGGAGAGTGCCCCAGCTGCTGG - Intronic
1149249345 17:54750033-54750055 TGGGAGAGTGCAGTGATTGTGGG - Intergenic
1150266512 17:63835488-63835510 GGCGATAGTGCAGGAACTGCAGG - Exonic
1153370271 18:4307645-4307667 GGGCAGAGTGCAGAGACTGCAGG - Intronic
1153765370 18:8369556-8369578 AGGAAGAGCGCAGTGACTGTGGG + Intronic
1154085983 18:11305889-11305911 AGGGAGAGCACAGCAACTGGGGG - Intergenic
1154406374 18:14095748-14095770 AGGGAGAGAGAAGTAAATGCAGG - Intronic
1155767349 18:29652369-29652391 AGGGAGAATGCAGTGAATGTGGG + Intergenic
1155915021 18:31548914-31548936 AGGGAGAGTGCCTTAAAGGCAGG + Exonic
1157879197 18:51304113-51304135 AAGGAGAGTGCAGTGATTGTGGG + Intergenic
1158437359 18:57442821-57442843 AAGGAGAGTGAAGCAGCTGCTGG - Intronic
1158563879 18:58537824-58537846 AGGGTGAGGGCAGTATCTGTGGG + Exonic
1159183565 18:64942588-64942610 AGGAAGGGGGCAGTAACTTCTGG + Intergenic
1159564856 18:70036979-70037001 AGGGAGAGAGCAGCGACTGGGGG + Intronic
1160702397 19:514199-514221 AGTGGGAGTGAAGTAAATGCTGG - Intronic
1161041401 19:2112509-2112531 AGGGAGTGAGAAGTAACGGCTGG + Intronic
1163798188 19:19349128-19349150 AGGGAGAGTGCAGTATCACATGG - Intronic
1163833318 19:19558316-19558338 AGGGAGAGGGCAGGACCTGCCGG - Intergenic
1166882356 19:45937371-45937393 AGGGAGAGTGAAGTAAGGTCTGG - Exonic
1167091369 19:47346297-47346319 AGGGAAGGGGCAGTAACTTCTGG - Intergenic
925042771 2:746434-746456 AGGGAGCGTGCAGCTGCTGCTGG - Intergenic
925747365 2:7055008-7055030 AGGAAGAGTAAAGCAACTGCAGG - Intronic
925870812 2:8268693-8268715 AGGGAAAGTGCAGGCATTGCTGG - Intergenic
925924901 2:8663133-8663155 GGGGACATTGCAGAAACTGCAGG - Intergenic
926518750 2:13883412-13883434 AGGGAGAGCACAGTGATTGCGGG + Intergenic
927814609 2:26203613-26203635 AGGAAATGGGCAGTAACTGCAGG - Intronic
928409530 2:31043933-31043955 AGGGAGCACGCTGTAACTGCAGG - Intronic
928495741 2:31829723-31829745 AGGGAGAGTGCTGCAATTGGAGG - Intergenic
929281837 2:40088203-40088225 AAGGAAAGTGCAGTGACTGTGGG - Intergenic
930439784 2:51391220-51391242 AGGGAGAGTACAGTGACTGGGGG - Intergenic
930593094 2:53353548-53353570 AGGGTGAGTCCTGTGACTGCTGG + Intergenic
930778157 2:55196028-55196050 AGGAAGAGTGCAGTGATTGTAGG + Intronic
931343690 2:61426722-61426744 AGCCAGAGTGCAGTTACAGCAGG + Intronic
931407012 2:61988945-61988967 AGGGAGAGTGCAGCAATTGTGGG - Intronic
932389408 2:71372450-71372472 AGGGACAGCGCAGTAACTAGGGG - Intronic
932517456 2:72367732-72367754 AGGGAGAGTGCAGCAACTGGGGG + Intronic
933351545 2:81158734-81158756 ATGGAGAGAGCAGTGACTGCGGG + Intergenic
934928862 2:98404045-98404067 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
935120305 2:100178360-100178382 AGGGAGGGGGCAGTAACTTCCGG - Intergenic
935263310 2:101373729-101373751 AGGGAGAAAGAAGTGACTGCAGG + Intronic
935437954 2:103056898-103056920 AGGGAGAGTGCCGTGACTAGGGG - Intergenic
935750840 2:106232568-106232590 AGGGAGAGCACAGCAACTGGAGG + Intergenic
935835671 2:107050630-107050652 ATGGAGAGTGCAGCCACTGGGGG - Intergenic
935924257 2:108050418-108050440 AGGGTGAATGGAGTCACTGCTGG - Intergenic
936349861 2:111704375-111704397 TGGGCGAGTGCAGTCGCTGCAGG - Intergenic
936511403 2:113150406-113150428 AGGGATAGTGCAGTGATTGCCGG - Intergenic
936703805 2:115045580-115045602 AGGGTGAGTGCAGTGATTGCGGG - Intronic
936940504 2:117879297-117879319 AGGGAAAGTGCAGTGATTGTGGG - Intergenic
937318498 2:120947124-120947146 AGGGAGGGGGCAGTACCTGAGGG - Intronic
937613670 2:123893905-123893927 AGGGAGAGTGCAGATACTGGGGG - Intergenic
937929156 2:127191485-127191507 CGGGAGGGTGCAGTGGCTGCGGG + Intronic
938587636 2:132707207-132707229 GGGGAAAGTGCAGTGACTGTGGG + Intronic
939144423 2:138395703-138395725 AGAGAGACTGCAGTGACTGTGGG + Intergenic
940795252 2:158070867-158070889 AGGGAGAGCACAGTGACTGTAGG + Intronic
940901370 2:159129438-159129460 GGGGAGAGTGCTGTACCTTCTGG + Intronic
941047642 2:160694739-160694761 AGGGAGAGTGCAGTGACTGGTGG - Intergenic
941742138 2:169046599-169046621 AGGGAGAGCACAGTGACTGTGGG + Intergenic
942881796 2:180870665-180870687 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
942920409 2:181366206-181366228 AGGGAGAGTGTAGAAAAGGCAGG - Intergenic
943099656 2:183472223-183472245 AGGGAGAGTGCAGTGACTATGGG - Intergenic
943867047 2:192938491-192938513 AGGGAGAGTGCAGTGACTGAGGG - Intergenic
944133379 2:196370828-196370850 AGGGAGAATGCAGTGATTGTGGG - Intronic
944287619 2:197969465-197969487 GGGGAGAGTCAAGTTACTGCTGG - Intronic
944427437 2:199598167-199598189 AGGGCTAGTGCAGTAACTAGGGG - Intergenic
944616548 2:201465909-201465931 AGGGAGAGTGCAGTGATTGTGGG - Intronic
944760240 2:202807310-202807332 AGGGAGAGTGCAGTGATTGTGGG + Intronic
944855209 2:203760514-203760536 AGAAAGAGTGCAGTGATTGCAGG - Intergenic
945294277 2:208155421-208155443 AGGGAGAGAGGAGTAAGGGCTGG - Intergenic
946056789 2:216909873-216909895 AGGGAGAGTGCAATCCCTCCAGG - Intergenic
947505344 2:230704243-230704265 AGGGAGAGCACAGTGATTGCAGG - Intergenic
948407248 2:237731374-237731396 AGGGAGACTGCAGAAGGTGCTGG + Intronic
948774555 2:240277081-240277103 AGGGAGAGAGCAGTGACTGTGGG + Intergenic
1169224161 20:3846214-3846236 AGGCAGATGGCAGGAACTGCGGG + Intergenic
1169353789 20:4891353-4891375 AGGAAGGGTGGAGTAACTGAAGG + Intronic
1169717400 20:8635615-8635637 AGAAAGCGTGGAGTAACTGCTGG - Intronic
1170024264 20:11871986-11872008 AGGGAGTGTGCAGAAGCTGGGGG - Intergenic
1170311409 20:14996693-14996715 AAGGAGAGTGCAGTGATTGTAGG + Intronic
1170668266 20:18405886-18405908 AGGGAGAGCACAGTGACTGGGGG + Intronic
1170864221 20:20138508-20138530 AGAGAAAGTGCAGTGACTGTGGG - Intronic
1171343607 20:24449050-24449072 AGGGTGAGTGCAGGAGCTGGGGG - Intergenic
1171467634 20:25341907-25341929 AGGGACACAGAAGTAACTGCAGG - Intronic
1171819704 20:29823564-29823586 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1171898116 20:30829615-30829637 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1173804054 20:45912348-45912370 AGGGAGAGGGAAGGAAATGCAGG + Intergenic
1174334508 20:49849394-49849416 CGGGACACTGCAGTAAGTGCGGG + Intronic
1175350650 20:58315635-58315657 AGGAAGTGTGCAGTAAATGGTGG + Intronic
1175632274 20:60551207-60551229 AGAGAGAGTGCAGTGATTGTAGG - Intergenic
1177539734 21:22477109-22477131 AGGGAGAGTGCAGTAATTGTAGG + Intergenic
1178846546 21:36178526-36178548 AGGAAGAGAGCTGAAACTGCTGG + Intronic
1180142198 21:45899442-45899464 AGGGAGAATTCAGAATCTGCTGG - Intronic
1180323704 22:11348255-11348277 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1182770529 22:32792706-32792728 AGGGAGAGAGCTTTATCTGCAGG - Intronic
1182793786 22:32975586-32975608 AGGGAGAGTGCAGGTTCGGCTGG - Intronic
1184421577 22:44385461-44385483 AGGGGGAGTGCAGCCACTGTGGG - Intergenic
949217010 3:1582836-1582858 GGGGTGAGTGAAGGAACTGCAGG + Intergenic
950567996 3:13782607-13782629 GGCCAGAGTGCAGTGACTGCAGG - Intergenic
950801197 3:15552974-15552996 AGGGAGAGTGCCGTAACTGTGGG - Intergenic
951029399 3:17864124-17864146 AGGGAGAGCACAGTGACTGTGGG - Intronic
951279667 3:20732346-20732368 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
952066559 3:29577719-29577741 AGGGAGAATACAGCAACTGGGGG - Intronic
952132930 3:30385222-30385244 AGGGAGAGTACAGCAACTGTGGG - Intergenic
952534801 3:34298087-34298109 GGAGAGAGTGCTGTAGCTGCAGG + Intergenic
952725639 3:36581816-36581838 AGGGAGAGTACAGTAATTGTGGG + Intergenic
953072125 3:39531227-39531249 CGGGAGAGGGCAGCAACAGCAGG - Intergenic
953461925 3:43088455-43088477 AGGAAGAGGGCAGTGGCTGCTGG - Intronic
953717761 3:45330507-45330529 GGAGAGAATGCAGGAACTGCAGG - Intergenic
953918229 3:46934332-46934354 TGGCAGAGTGCAGCAGCTGCTGG - Intronic
954413578 3:50381905-50381927 AGGGAGAATGGGGTAACTGATGG - Intronic
955130163 3:56158005-56158027 AGGGAGAGGGCAGGGACTGCTGG + Intronic
955585332 3:60471512-60471534 AAGGAGAGTGCAGTGATTGTGGG - Intronic
955861118 3:63331712-63331734 TGGGAGAGTGTACTAACAGCAGG - Intronic
957965724 3:87320984-87321006 AGGGAGAGTACAGTGATTGTGGG + Intergenic
958595190 3:96213451-96213473 TGGAAAAGTGCAGTAACTTCTGG - Intergenic
958682691 3:97352489-97352511 AGAGAGAATGCAGTGACTGTGGG + Intronic
959191072 3:103112399-103112421 AGGGAGACTGCAGTGACTGGGGG + Intergenic
959335979 3:105066000-105066022 GGGGAGGGTGCAGGAACTGGAGG + Intergenic
959716769 3:109442442-109442464 AGGGAGACTGCAGCAATTGTGGG + Intergenic
959913841 3:111794297-111794319 AGAGAGGGTGCAGTGACTGCGGG - Intronic
960862915 3:122169500-122169522 AGGGAGAGTGCAGCAATTATGGG - Intergenic
961964544 3:130888635-130888657 AGGGAGAGTGCAGTGGCTAGTGG - Intronic
962449964 3:135504831-135504853 TGGGAGATTGCAGTACATGCTGG - Intergenic
963154023 3:142077043-142077065 AGGGAGAGCTCAGTGACTGTGGG + Intronic
964686664 3:159403487-159403509 AGAGAGAGTGCAGTGATTGAGGG + Intronic
965264052 3:166518184-166518206 AGGGAAAGTGCAGTTACTGTGGG + Intergenic
965844395 3:172945580-172945602 AGGGAGAATACAGTAATTGTGGG + Intronic
969403353 4:6971917-6971939 AGGCAAATTTCAGTAACTGCTGG + Intronic
969661779 4:8534282-8534304 AGGGAGAGTGGAGCATGTGCTGG + Intergenic
970793202 4:19883787-19883809 AGTGAGAAGGCAGTAAGTGCTGG - Intergenic
971635366 4:29049831-29049853 AGGGAGCGGGGAGAAACTGCAGG + Intergenic
972125399 4:35758931-35758953 AGGGAGATTGCAGTGATTGTGGG - Intergenic
972253678 4:37331879-37331901 AGGGAGAGTACAGTGATTGTGGG + Intronic
973227407 4:47802003-47802025 AGGGAGAGCACAGCAACTGGGGG + Intronic
973287945 4:48440428-48440450 AGGGAGAGCACAGTGACTGTGGG - Intergenic
973348443 4:49082258-49082280 AGGGAAAGTGCAGTGATTGTGGG + Intergenic
974292181 4:59947478-59947500 AGAAAGAGTGTAGTAATTGCGGG + Intergenic
975629561 4:76386777-76386799 AGGGAGAGCACAGCAACTGGGGG + Intronic
975837725 4:78442065-78442087 ATGGAGAGTCCATTGACTGCAGG + Intronic
977134168 4:93281402-93281424 AGGGAGAGAACAGTCATTGCAGG + Intronic
977325803 4:95573082-95573104 AAGGAAAGTGCAGTGACTGGAGG - Intergenic
977418316 4:96763962-96763984 AGATAGAGTGCTGGAACTGCAGG + Intergenic
977492596 4:97733673-97733695 GGGGTGAGTGAAGGAACTGCAGG - Intronic
977644389 4:99395645-99395667 AGGGAGAGTGCAGTGATAGTGGG + Intergenic
978934726 4:114360283-114360305 AGGGAGAGCACAGAGACTGCCGG - Intergenic
979565189 4:122146462-122146484 AAGGAGAGTGCAGTGATTGTGGG - Intergenic
979935456 4:126688883-126688905 ACAGAGAGTGCAGTATTTGCAGG + Intergenic
980562068 4:134490657-134490679 AGGGACATTGCAGTAACTTTGGG - Intergenic
980682802 4:136186554-136186576 AGGGAGAGTGTAATAATTGCAGG + Intergenic
981762388 4:148208667-148208689 AGGCAGAGTGCAGAAACTGCTGG - Intronic
981871197 4:149487737-149487759 AAGGAGAGTGCAGTGACTAGGGG - Intergenic
981996046 4:150976809-150976831 TGGGAGAGTGCAGCGACTGTGGG + Intronic
982683486 4:158459943-158459965 AAGGAGAGTGCAGTGGCTGGGGG - Intronic
983111165 4:163751205-163751227 TTGGAGAGTGCAGTAACTACAGG + Intronic
983338182 4:166422024-166422046 AGGGAGAGCACAGTGACTGTGGG - Intergenic
983380568 4:166986946-166986968 AGGGTGAGGGCAGTAACTCCTGG - Intronic
983657851 4:170101030-170101052 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
984493553 4:180467965-180467987 AGGTAGAATGCAGAAACTGTAGG - Intergenic
985030282 4:185782027-185782049 AGGCAGAATGCAGTACCTGCGGG - Intronic
986085203 5:4437945-4437967 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
986548242 5:8923625-8923647 AGGAAGAGTGCAGGGACTGTGGG + Intergenic
986631304 5:9776246-9776268 AGGGAGAGTGCAGTGACTACAGG - Intergenic
986941960 5:12964363-12964385 AGGGAGAGAGCAGGAACTTAAGG + Intergenic
987616003 5:20275877-20275899 AGGGAGAGTGCAGTGATTTGGGG + Intronic
987645777 5:20671244-20671266 AGGGAGAGTGAAGTGACTGTGGG + Intergenic
989987450 5:50717858-50717880 AGGGAGAGAGAAGTGACTGATGG + Intronic
990166197 5:52995885-52995907 AGGGAGAGAGTAGGAACAGCTGG + Intronic
990302046 5:54459089-54459111 AGAGAGAGTCCAGTAGCGGCAGG - Intergenic
990603376 5:57383404-57383426 ACAGAGACTGCAGTTACTGCTGG - Intergenic
990827817 5:59922044-59922066 AGGGAGAGTGCAGCGACTGGGGG + Intronic
991209249 5:64085212-64085234 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
991395410 5:66199280-66199302 AGGGAGAGTACAGCAATTGTGGG - Intergenic
991722834 5:69509754-69509776 ACGTAGAGTCCAGTAGCTGCAGG - Exonic
992531913 5:77660116-77660138 AGGGAAAGTGCAGTGATTGTGGG - Intergenic
992934418 5:81687191-81687213 AGGGAGAGCACAGTGACTGTGGG + Intronic
993060168 5:83029486-83029508 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
993230273 5:85226568-85226590 AGGGAGAGTGAAGTGAATGTGGG - Intergenic
993279264 5:85904750-85904772 AGGGAAAGTGCAGTGACTGAGGG + Intergenic
993287454 5:86017133-86017155 ATGGAGAGTACAGTGACTGGAGG - Intergenic
993932315 5:93954957-93954979 AGGGAGAGCACAGTGACTGTGGG - Intronic
994217974 5:97159917-97159939 ATGAAGAGTGCAGTGACTGTGGG - Intronic
994533644 5:100999667-100999689 AGGGAGAGTGAAGTGAGTGTGGG + Intergenic
995268742 5:110195729-110195751 AGGAAGAGTGCAGTGATTGTGGG - Intergenic
995290372 5:110444374-110444396 AGGGAGAGCTCAGTGACTGGGGG - Intronic
995310695 5:110707348-110707370 AGGGAGAGTGCAGTAACTGCAGG + Intronic
995573286 5:113503636-113503658 AGGGAGAGTGCAGTGATAGTGGG - Intergenic
996417644 5:123227551-123227573 AGGGAGTGAGCAGTAGCAGCAGG + Intergenic
996459424 5:123724728-123724750 AGGGAGAGTGCAGCGACCGGGGG + Intergenic
997437824 5:133887703-133887725 AGGGACAGTCCAGTGACTGTGGG + Intergenic
999559448 5:152785117-152785139 AGGGAGAGTGCACTGACTGTGGG + Intergenic
1000986081 5:167861905-167861927 AGGGAGAGTGCTGAATATGCTGG + Intronic
1001086300 5:168702095-168702117 AGGGAGAGTGCAGTTTGGGCTGG + Intronic
1001845255 5:174916445-174916467 AGGGAGAATGCAGCAACTGTGGG + Intergenic
1002054130 5:176589171-176589193 TGGGAGCATTCAGTAACTGCGGG + Exonic
1002620848 5:180487165-180487187 AGGAAGAGTCCACTAGCTGCAGG - Intergenic
1002881244 6:1254416-1254438 AGGGAGAAGGCAGCATCTGCAGG + Intergenic
1003522399 6:6869261-6869283 AGGGAGAAAGCAGAAGCTGCTGG - Intergenic
1005016685 6:21381092-21381114 GGGAAAAGTCCAGTAACTGCAGG - Intergenic
1006336848 6:33425453-33425475 AGGGAGAATGGAGGAACTGAAGG + Intronic
1007021743 6:38528117-38528139 AGGCAGAGTGTAGTGACTGTGGG + Intronic
1007267166 6:40605378-40605400 AGGGAGAGTGCAGCTATTGATGG - Intergenic
1007779756 6:44246180-44246202 ACTGAGAGTGGAGTACCTGCGGG - Intronic
1008192267 6:48474838-48474860 AGGAAGAATGCAGTAACTGTGGG + Intergenic
1009781674 6:68279682-68279704 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1010557815 6:77306526-77306548 AGTGAGAGTGCAGGAATTGTGGG - Intergenic
1011195706 6:84777204-84777226 TGGGAGAGAGCAGTGAGTGCTGG + Intergenic
1012047724 6:94300403-94300425 AGGGAAAGTGCAGTTATTGTGGG + Intergenic
1012073796 6:94657774-94657796 AGGGAGAAAGCAGTGACTGATGG - Intergenic
1014275609 6:119384876-119384898 AGGAAGAGTGCAGCGACTGCGGG - Intergenic
1015578934 6:134702470-134702492 AGAGAGAGTGCAGTGACTGTGGG - Intergenic
1015707465 6:136103793-136103815 AGGGACAGAGCAGTAGCTACTGG - Intronic
1016012259 6:139149576-139149598 AGGGAGTTTGCAGTGAATGCCGG + Intronic
1016086684 6:139923444-139923466 AGGGAGATAGCAGTGGCTGCAGG - Intergenic
1018158528 6:161013815-161013837 AGGGAAGGGGTAGTAACTGCTGG + Intronic
1018649860 6:165984782-165984804 AGGGGTATTTCAGTAACTGCAGG - Intronic
1018768668 6:166954083-166954105 AGGCAGAGTGATGTGACTGCAGG + Intronic
1019139313 6:169933666-169933688 AGGAAGAGTGGAGGAGCTGCTGG + Intergenic
1019144679 6:169969116-169969138 AGGGAGAGTGGAGTCTCTGGAGG + Intergenic
1019162322 6:170076832-170076854 AGGGAGATAGCAGCAGCTGCAGG - Intergenic
1019493120 7:1324287-1324309 AGGGAGAGAGAAGAAACTCCTGG - Intergenic
1019922986 7:4174615-4174637 CGGTAGAGTGCAGTCACTGGAGG - Intronic
1020470722 7:8531507-8531529 ATAGAGAGTACAGTAACTGAAGG - Intronic
1020574935 7:9913997-9914019 AGGGAGAGTGTAGTGATTGTGGG - Intergenic
1021842547 7:24732628-24732650 AGGGAGAGCACAGCAACTGTGGG + Intronic
1021884984 7:25129436-25129458 AGGGACAGGGCAGTGATTGCAGG - Intergenic
1023646163 7:42318271-42318293 AGGGAGAGTGCAGTGGTTGTGGG + Intergenic
1024115126 7:46185480-46185502 TGGGAGAGTGAAGTGACTCCAGG - Intergenic
1024705956 7:51959785-51959807 AGGAAGAATGCAGTGACTGGGGG - Intergenic
1024956469 7:54926456-54926478 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1025061536 7:55812848-55812870 AGGGAGAGTGAAGTGATTGTGGG + Intronic
1025921231 7:65915020-65915042 AGGGAGAGTTAAGTATTTGCGGG - Intronic
1027523955 7:79244451-79244473 AGGGAGAGTGCAGTGATTGTGGG + Intronic
1028341616 7:89728732-89728754 AGGGCGACTGCAGTAACTATAGG - Intergenic
1028870844 7:95770470-95770492 AGGGAAAGGGTAGTAACTTCTGG + Intergenic
1028929664 7:96398414-96398436 AGGGAGAATGCAGTGATTGTGGG - Intergenic
1028972468 7:96874792-96874814 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
1029042610 7:97593395-97593417 AGGGAGAGTGCAGTGGCTGTGGG - Intergenic
1030662620 7:112238247-112238269 AGGGAGAGCGCAGTAATTGTGGG + Intronic
1030723488 7:112898002-112898024 AGGGAGTGTGAAATAACTACGGG + Intronic
1031243857 7:119281647-119281669 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1031306148 7:120130320-120130342 AAGGAGAGTGCAGTAATTTTGGG + Intergenic
1031412599 7:121457440-121457462 AGGGAGAATGCTGTGACTGTGGG - Intergenic
1031862198 7:126993674-126993696 AGGGAGAGCACAGTGACTGGGGG + Intronic
1031991055 7:128199483-128199505 AGGGAGATCTCAGTTACTGCTGG + Intergenic
1031991689 7:128202849-128202871 AGGGACAGTGCAGGATCTGGTGG + Intergenic
1032669291 7:134068661-134068683 CTGCAGAGGGCAGTAACTGCTGG - Intergenic
1032819019 7:135507528-135507550 ATGAAGAATTCAGTAACTGCGGG + Intronic
1033004923 7:137551292-137551314 AGAGAGAGAGCAGTAAGTGTTGG + Intronic
1033502514 7:141966088-141966110 AAGGAGAGTGCAGTGATTGAGGG - Intronic
1033542474 7:142369605-142369627 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1033877773 7:145843225-145843247 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1034415544 7:150962644-150962666 AGAGAGAGAGGAGTGACTGCTGG + Intronic
1034491506 7:151395545-151395567 AGGGAGAAGGCAGCATCTGCAGG + Intronic
1034847914 7:154464261-154464283 AGGGAGAATGCAGTGACTGTGGG - Intronic
1035062788 7:156081524-156081546 GGGGGTAGTGCAGTGACTGCCGG + Intergenic
1035170509 7:157014926-157014948 AGGGTCAGAGCAGGAACTGCTGG + Intergenic
1037043199 8:14263870-14263892 AGCGAGAGGGAAGTAATTGCAGG + Intronic
1040300072 8:46183398-46183420 AGTGAGACTGCAGTGAATGCTGG - Intergenic
1040315164 8:46257131-46257153 AGGGAGACTGCAGGGAATGCTGG + Intergenic
1040324752 8:46336038-46336060 AGTGAGACTGCAGGAAATGCTGG + Intergenic
1041081793 8:54221511-54221533 AGGGAGACTGCAGAGTCTGCAGG - Intergenic
1041580013 8:59447673-59447695 AGGGAGAGCACAGCAACTGGGGG - Intergenic
1041965557 8:63670574-63670596 TGGGAGAGTGCAGAAATTCCAGG + Intergenic
1042336460 8:67634760-67634782 AGGGAGACAGCAGTTCCTGCTGG + Intronic
1042915582 8:73872527-73872549 AGAGACATAGCAGTAACTGCTGG + Intronic
1043079972 8:75754838-75754860 AGGGAGAGTGCAGTGACTATGGG + Intergenic
1044497327 8:92902383-92902405 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1044635550 8:94320205-94320227 AGGGAGAGCACAGTGATTGCAGG - Intergenic
1045322387 8:101091848-101091870 GGGGAGAAGGCAGTAACTGATGG - Intergenic
1045599095 8:103693185-103693207 AGGGAGAGTTTAGTAATTGTGGG - Intronic
1048118673 8:131554819-131554841 AGGGAGAGCACAGTGACTGTGGG + Intergenic
1048646563 8:136427639-136427661 AGTGAGGGTGAAGTGACTGCTGG + Intergenic
1049542230 8:143213820-143213842 AGGGAGAGGGCAGACACAGCAGG + Intergenic
1050248062 9:3713005-3713027 TGGAAGAGTGCAGTGACTGGGGG + Intergenic
1050644410 9:7703295-7703317 AGGGAGAATACAGTCACTGAGGG - Intergenic
1050993070 9:12176086-12176108 AGGGAAAGTGTAGTAACTTCCGG + Intergenic
1051345609 9:16148094-16148116 AGGGAGAGTGCAGTGGGTGGGGG + Intergenic
1051464941 9:17367190-17367212 AGGGAGAATGCAGTGACTGTTGG + Intronic
1052250798 9:26394616-26394638 GGGGTGAGTGAAGTCACTGCAGG - Intergenic
1053750690 9:41251412-41251434 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054256202 9:62815755-62815777 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054335103 9:63799859-63799881 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1056516665 9:87358799-87358821 AGAGAAAGTGCAGTGACTGTGGG + Intergenic
1056522287 9:87412132-87412154 AGAGAGAGTGGAGAAACTGAGGG - Intergenic
1056523829 9:87424411-87424433 GGGGCAAGAGCAGTAACTGCAGG + Intergenic
1056790080 9:89619662-89619684 AGGGAAGGTGCAGTGAATGCTGG + Intergenic
1058285363 9:103170065-103170087 AGGGAGAGGGCAGTGACTGTGGG - Intergenic
1059555600 9:115277131-115277153 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1060328587 9:122643303-122643325 AGGGAGAGCACAGCAACTGAGGG + Intergenic
1060932401 9:127497291-127497313 CCGGAGAGTCCAGGAACTGCTGG + Exonic
1062054370 9:134463365-134463387 AGGGACACTGCAGCAGCTGCAGG - Intergenic
1062199257 9:135292835-135292857 AGGGAGACTGAAGTATCTCCTGG + Intergenic
1062238485 9:135523767-135523789 TGGGAGGGTGCAGGAGCTGCGGG + Intronic
1203371376 Un_KI270442v1:308829-308851 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1185609446 X:1385878-1385900 AGAGAGGGTACAGTAAGTGCAGG + Intergenic
1187075693 X:15932229-15932251 AGGGAGAATGCAGTACCTGAGGG + Intergenic
1187751600 X:22471808-22471830 AGGGAGATGGCATTAAATGCAGG - Intergenic
1188162001 X:26815412-26815434 AGGGAGAGTGCAGTGATTGTAGG - Intergenic
1188715521 X:33455711-33455733 AGGGAGAGTGCAGCAATTCTGGG + Intergenic
1188897346 X:35685821-35685843 AGGGAGATAGCAGTGACTGGGGG + Intergenic
1190374467 X:49775451-49775473 AGGGAGAGTGCAGCAACTGGGGG - Intergenic
1190440129 X:50468992-50469014 AGGGAGAGTGCAGAGAAAGCAGG + Intronic
1190598522 X:52068209-52068231 AGGGAGGGTGAAGCAGCTGCAGG + Exonic
1190610302 X:52185864-52185886 AGGGAGGGTGAAGCAGCTGCAGG - Exonic
1192046107 X:67675597-67675619 AGGAAGATTGCAGTGACTGTGGG - Intronic
1192600607 X:72459693-72459715 AGGGAGGGTGGTGTAAGTGCTGG - Intronic
1192793302 X:74405735-74405757 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1193052535 X:77116265-77116287 AGGGAGAGTGCAGCAATTGTGGG - Intergenic
1193896935 X:87126496-87126518 AGGGAGAGTGCAGTGATTATGGG + Intergenic
1194251820 X:91585354-91585376 AGGGAGAGTGCAGAAATTGTGGG + Intergenic
1194388930 X:93292459-93292481 AGGGAGAATGCAGTGACTGGGGG + Intergenic
1194526369 X:94982843-94982865 TGGGAAAGTGCAGTGACTGTGGG + Intergenic
1194842077 X:98754821-98754843 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1194882685 X:99273459-99273481 AGGGAGAATACAGCAACTGGAGG + Intergenic
1195037259 X:100981373-100981395 AGAGAGAGTGCAGTGATTGTAGG - Intronic
1195199244 X:102532133-102532155 AGGAAGAGTGCAGCAACTGGGGG + Intergenic
1195489469 X:105450215-105450237 AGGGCGAGTGCAGTGACTTGGGG - Intronic
1195595331 X:106682705-106682727 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1195765266 X:108289715-108289737 AGGGAGAGAGAAGTGAGTGCAGG - Intronic
1196182245 X:112704660-112704682 AGGGAGAGCACAGGAACTGAAGG - Intergenic
1196215746 X:113050049-113050071 AGGGAGAATGCAGCAATTGTGGG + Intergenic
1196270183 X:113700451-113700473 AGGGAGAGTGTAGCATCTGGGGG - Intergenic
1196357470 X:114810559-114810581 AGGGAGAATGCAGTGACTGTGGG - Intronic
1196485704 X:116204163-116204185 AGGGAGAGTGCAGCAACTGGGGG - Intergenic
1197078296 X:122379061-122379083 AGGGAGAGCACAGTGACTGAAGG - Intergenic
1197099676 X:122637407-122637429 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1197375882 X:125681738-125681760 AGTGAGAGTGCAATGACTGGAGG + Intergenic
1197457903 X:126700979-126701001 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1197623650 X:128779835-128779857 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1197953034 X:131918400-131918422 AGGGAGAGTGCAGCAACTGTGGG + Intergenic
1198278062 X:135116200-135116222 AGGGAGAGTGCAGCAAGTGGGGG - Intergenic
1198292900 X:135256316-135256338 AGGGAGAGTGCAGCAAGTGGGGG + Intronic
1198770683 X:140126903-140126925 AGGGAGAGTGTAGTGACTAGGGG - Intergenic
1198947674 X:142032232-142032254 AGGGAGAATGCAGTGATTGTAGG - Intergenic
1199325091 X:146489933-146489955 AGGGAGAGTACAGTGACTGAGGG + Intergenic
1200570754 Y:4826585-4826607 AGGGAGAGTGCAGAAATTGTGGG + Intergenic