ID: 995313468

View in Genome Browser
Species Human (GRCh38)
Location 5:110739345-110739367
Sequence CTGGAAAAGGGTTCCTCCGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 71}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995313468_995313478 1 Left 995313468 5:110739345-110739367 CCCACGGAGGAACCCTTTTCCAG 0: 1
1: 0
2: 0
3: 6
4: 71
Right 995313478 5:110739369-110739391 GGCGGCGGCGGCAGTGTGCAGGG 0: 1
1: 0
2: 0
3: 45
4: 479
995313468_995313482 26 Left 995313468 5:110739345-110739367 CCCACGGAGGAACCCTTTTCCAG 0: 1
1: 0
2: 0
3: 6
4: 71
Right 995313482 5:110739394-110739416 AGAGCAGTGGTGAGAAGCATGGG 0: 1
1: 0
2: 1
3: 31
4: 364
995313468_995313480 13 Left 995313468 5:110739345-110739367 CCCACGGAGGAACCCTTTTCCAG 0: 1
1: 0
2: 0
3: 6
4: 71
Right 995313480 5:110739381-110739403 AGTGTGCAGGGGCAGAGCAGTGG 0: 1
1: 0
2: 0
3: 59
4: 578
995313468_995313483 27 Left 995313468 5:110739345-110739367 CCCACGGAGGAACCCTTTTCCAG 0: 1
1: 0
2: 0
3: 6
4: 71
Right 995313483 5:110739395-110739417 GAGCAGTGGTGAGAAGCATGGGG 0: 1
1: 0
2: 3
3: 31
4: 335
995313468_995313479 2 Left 995313468 5:110739345-110739367 CCCACGGAGGAACCCTTTTCCAG 0: 1
1: 0
2: 0
3: 6
4: 71
Right 995313479 5:110739370-110739392 GCGGCGGCGGCAGTGTGCAGGGG 0: 1
1: 0
2: 0
3: 50
4: 522
995313468_995313481 25 Left 995313468 5:110739345-110739367 CCCACGGAGGAACCCTTTTCCAG 0: 1
1: 0
2: 0
3: 6
4: 71
Right 995313481 5:110739393-110739415 CAGAGCAGTGGTGAGAAGCATGG 0: 1
1: 0
2: 1
3: 56
4: 554
995313468_995313477 0 Left 995313468 5:110739345-110739367 CCCACGGAGGAACCCTTTTCCAG 0: 1
1: 0
2: 0
3: 6
4: 71
Right 995313477 5:110739368-110739390 TGGCGGCGGCGGCAGTGTGCAGG 0: 1
1: 0
2: 2
3: 33
4: 346

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995313468 Original CRISPR CTGGAAAAGGGTTCCTCCGT GGG (reversed) Exonic
914319481 1:146545282-146545304 CTAGAAAAAGGTTCCCCCTTTGG + Intergenic
915522032 1:156452058-156452080 GTGAAAAAGAGTTCCTCCTTTGG + Intergenic
917926797 1:179795863-179795885 ATGGAAATGAGTTCCTGCGTTGG + Intronic
921801194 1:219404340-219404362 CTGGAAAAGGATTACTCTTTTGG - Intergenic
921937739 1:220810454-220810476 GTGGAAAAGGGGTTCTCGGTGGG - Intronic
924165568 1:241278631-241278653 GTGGAAAAGGGATACTCAGTGGG - Intronic
1065350796 10:24793987-24794009 CTGGAAATGGCTTCCTTCTTTGG + Intergenic
1067724905 10:48762632-48762654 CTGGCAAAGGGTTCCTAAGCTGG + Intronic
1070396484 10:76015334-76015356 CTTGGAAAGGGATCCTCCCTGGG - Intronic
1082071671 11:47944318-47944340 CTGGACAGTGGTTCCTCCCTAGG + Intergenic
1082888912 11:58117673-58117695 CTGGAAATGGGTTGCTTGGTAGG + Intronic
1087376128 11:97343005-97343027 CTGGTGAAGGGGTCCTCAGTTGG - Intergenic
1087689690 11:101306050-101306072 CTGGAAAAGTGTTCCTGTTTTGG - Intergenic
1089330028 11:117682652-117682674 CTGGAAAAGGATTCTTCCAAGGG + Intronic
1089606003 11:119641664-119641686 CTGGAATGGGGTTCCTCCTCTGG + Intronic
1090456059 11:126850652-126850674 CTGGTAAAGTCTTCCTCTGTTGG - Intronic
1095769240 12:45933842-45933864 CTGTAAAAGGGTTCTTCTTTAGG + Intronic
1103098587 12:118152485-118152507 CTGGAAGAGGTTTCCTCATTTGG + Intronic
1105636001 13:22215965-22215987 ATGCAAAAGGCTTCCTCAGTAGG - Intergenic
1105704660 13:22961552-22961574 CTGGCAAAGCCTTCCTCCCTGGG + Intergenic
1105857616 13:24386600-24386622 CTGGCAAAGGCTTCCTCCCTGGG + Intergenic
1106403010 13:29447717-29447739 CTGGAAAAGGCTTCCCCAGGTGG + Intronic
1119693487 14:76694830-76694852 CTGGAAAAGGCATCCCACGTGGG + Intergenic
1121947408 14:98136391-98136413 GTGAAAGAGGATTCCTCCGTGGG - Intergenic
1131126066 15:89858115-89858137 CTGGAAAAGGGTTCTTAGTTAGG + Intronic
1138014416 16:53415740-53415762 CTGGAAAACGGTTGCTCCAAGGG - Intergenic
1138553964 16:57761625-57761647 CTGGAGAAGGCTTCCTGGGTTGG - Intronic
1139006012 16:62572448-62572470 CTGGAAAAGGATGGCTCCTTCGG - Intergenic
1139480268 16:67226806-67226828 CTGGGTAACGGTTCCTCCTTTGG - Intronic
1140014042 16:71164799-71164821 CTAGAAAAAGGTTCCCCCTTTGG - Intronic
1140869883 16:79096537-79096559 CTAGAGAAGGCTTCCTCCGAAGG - Intronic
1145214629 17:21042583-21042605 CAGGAAAAGGGCCCCTCCGCCGG + Intronic
1146182525 17:30707322-30707344 AGGGAAAAGGGTTCCTGAGTAGG - Intergenic
1148876505 17:50690446-50690468 CTGGAGAAGTGCTCCTCCATGGG - Intronic
1155159396 18:23183365-23183387 AGGGAAAACGGTTCCTCCGTGGG - Intronic
1162976296 19:14208483-14208505 AGGGAAAAGGGTTCCTGAGTAGG + Intergenic
1163663277 19:18591003-18591025 CTGGCAGAGGGTTCCTCTGCTGG - Intronic
1164636129 19:29792691-29792713 ATGGAAAAGCGTTCCTCCCAGGG + Intergenic
1166597901 19:44066790-44066812 ATGGAAAAGGCTTCATTCGTAGG + Exonic
927126539 2:20017004-20017026 CTGGAAAAGACTTCCACCTTGGG - Intergenic
933158937 2:79002995-79003017 CTGGAGAAGCGTTCCTCAGCTGG + Intergenic
941360368 2:164543586-164543608 CTGGAAAATAGTTCATCCTTTGG + Intronic
942199471 2:173556480-173556502 CTTGGAAAGGGGTCCTCCGAAGG - Intergenic
946099351 2:217305902-217305924 CTGGTCAAGGGTTACACCGTAGG - Intronic
946816356 2:223582414-223582436 CAGGACAAGGGTCCCTCAGTTGG - Intergenic
947792055 2:232873976-232873998 CTGGAAAGGGGTTCTGCCTTGGG + Intronic
948998625 2:241598286-241598308 CTGGCAAAGGGTGGCCCCGTGGG - Intronic
1171452666 20:25247409-25247431 CGGGAACAGGGTTTCTCCGAGGG + Intergenic
1177016025 21:15788260-15788282 CTGCATAAGGGTTCCTCCCCTGG - Intronic
1177906026 21:26972304-26972326 CTGGAAGAGGGTTCCTTCCTGGG - Intergenic
1185415550 22:50707507-50707529 CAGGAAAAGGGTTCCTTCTATGG - Intergenic
956617244 3:71184612-71184634 TTGGAAAAGGGTTCCTCTTTTGG - Intronic
961076745 3:123989860-123989882 CTGGGAAAGGTTTCTTCCTTGGG + Intronic
964108169 3:153061030-153061052 CTGAAAAAGTATTACTCCGTAGG - Intergenic
969956213 4:10893598-10893620 CAGGAAAAGGGTGCCTCTGCAGG - Intergenic
974850771 4:67402974-67402996 CAGGAAATGGGTTCCTGGGTAGG + Intergenic
976526260 4:86093227-86093249 CTGGAAAATGTTTCCTCTCTGGG + Intronic
980165601 4:129223054-129223076 CAGGAAAAGGGTTCCTGAGCAGG - Intergenic
981190317 4:141854889-141854911 ATGGAAAAGGATTCTTCCATAGG + Intergenic
984317072 4:178141434-178141456 CTGGAGAAGGGTTCCTTCCCTGG - Intergenic
989799181 5:45514702-45514724 ATTGAAAAGGTTTCCTCTGTAGG - Intronic
995313468 5:110739345-110739367 CTGGAAAAGGGTTCCTCCGTGGG - Exonic
998332755 5:141344148-141344170 CTAGATAAAGGTTCCTTCGTGGG + Exonic
998335061 5:141364445-141364467 CTGGACAAAGGCTCCTTCGTCGG + Exonic
998336150 5:141374198-141374220 CTGGAGAAAGGCTCCTTCGTAGG + Exonic
999330218 5:150668708-150668730 CTGCAAAAGGCTTCCTTTGTTGG + Intronic
1000410794 5:160933865-160933887 CTGGAGAAGGGTTCCTTCCCTGG + Intergenic
1008035641 6:46742302-46742324 CTGGACAAGGGCTCCTTGGTGGG + Intergenic
1013377107 6:109528108-109528130 CTGGAGAAGGGATACTGCGTAGG + Intronic
1018134395 6:160765633-160765655 CTTGATAAGGGTCCCTCCCTAGG - Intergenic
1046166968 8:110449682-110449704 CTGGAAAAGGGCTTGTCTGTGGG - Intergenic
1049193123 8:141299888-141299910 CTGGAAAGGGGATCCTCCATTGG - Intronic
1051889895 9:21930881-21930903 CTGGAAATGGGATCTTCCCTGGG + Intronic
1052975730 9:34408571-34408593 TTGGAAAAGGCTTCCTCCCTTGG + Intronic
1057624099 9:96662095-96662117 CTGGAGAAGGGTGCCACAGTGGG + Intergenic
1060814226 9:126626388-126626410 CCGGAAAGGGTTTCCTCCATCGG - Intronic
1062049957 9:134442163-134442185 CTGGAAAAGGGGTCGGCCCTGGG + Intergenic
1187487195 X:19715833-19715855 CTGGAAATGTGTTCCTGGGTTGG + Intronic