ID: 995313477

View in Genome Browser
Species Human (GRCh38)
Location 5:110739368-110739390
Sequence TGGCGGCGGCGGCAGTGTGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 382
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 346}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995313456_995313477 27 Left 995313456 5:110739318-110739340 CCCACCACCTCCACCCCGTACGA 0: 1
1: 0
2: 0
3: 14
4: 251
Right 995313477 5:110739368-110739390 TGGCGGCGGCGGCAGTGTGCAGG 0: 1
1: 0
2: 2
3: 33
4: 346
995313467_995313477 1 Left 995313467 5:110739344-110739366 CCCCACGGAGGAACCCTTTTCCA 0: 1
1: 0
2: 1
3: 4
4: 87
Right 995313477 5:110739368-110739390 TGGCGGCGGCGGCAGTGTGCAGG 0: 1
1: 0
2: 2
3: 33
4: 346
995313469_995313477 -1 Left 995313469 5:110739346-110739368 CCACGGAGGAACCCTTTTCCAGT 0: 1
1: 0
2: 0
3: 23
4: 76
Right 995313477 5:110739368-110739390 TGGCGGCGGCGGCAGTGTGCAGG 0: 1
1: 0
2: 2
3: 33
4: 346
995313466_995313477 12 Left 995313466 5:110739333-110739355 CCGTACGAAGGCCCCACGGAGGA 0: 1
1: 0
2: 0
3: 10
4: 54
Right 995313477 5:110739368-110739390 TGGCGGCGGCGGCAGTGTGCAGG 0: 1
1: 0
2: 2
3: 33
4: 346
995313464_995313477 13 Left 995313464 5:110739332-110739354 CCCGTACGAAGGCCCCACGGAGG 0: 1
1: 0
2: 2
3: 7
4: 72
Right 995313477 5:110739368-110739390 TGGCGGCGGCGGCAGTGTGCAGG 0: 1
1: 0
2: 2
3: 33
4: 346
995313457_995313477 26 Left 995313457 5:110739319-110739341 CCACCACCTCCACCCCGTACGAA 0: 1
1: 0
2: 0
3: 13
4: 390
Right 995313477 5:110739368-110739390 TGGCGGCGGCGGCAGTGTGCAGG 0: 1
1: 0
2: 2
3: 33
4: 346
995313463_995313477 14 Left 995313463 5:110739331-110739353 CCCCGTACGAAGGCCCCACGGAG 0: 1
1: 0
2: 0
3: 0
4: 23
Right 995313477 5:110739368-110739390 TGGCGGCGGCGGCAGTGTGCAGG 0: 1
1: 0
2: 2
3: 33
4: 346
995313459_995313477 23 Left 995313459 5:110739322-110739344 CCACCTCCACCCCGTACGAAGGC 0: 1
1: 0
2: 1
3: 2
4: 90
Right 995313477 5:110739368-110739390 TGGCGGCGGCGGCAGTGTGCAGG 0: 1
1: 0
2: 2
3: 33
4: 346
995313468_995313477 0 Left 995313468 5:110739345-110739367 CCCACGGAGGAACCCTTTTCCAG 0: 1
1: 0
2: 0
3: 6
4: 71
Right 995313477 5:110739368-110739390 TGGCGGCGGCGGCAGTGTGCAGG 0: 1
1: 0
2: 2
3: 33
4: 346
995313460_995313477 20 Left 995313460 5:110739325-110739347 CCTCCACCCCGTACGAAGGCCCC 0: 1
1: 0
2: 0
3: 6
4: 115
Right 995313477 5:110739368-110739390 TGGCGGCGGCGGCAGTGTGCAGG 0: 1
1: 0
2: 2
3: 33
4: 346
995313461_995313477 17 Left 995313461 5:110739328-110739350 CCACCCCGTACGAAGGCCCCACG 0: 1
1: 0
2: 0
3: 1
4: 41
Right 995313477 5:110739368-110739390 TGGCGGCGGCGGCAGTGTGCAGG 0: 1
1: 0
2: 2
3: 33
4: 346

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995313477 Original CRISPR TGGCGGCGGCGGCAGTGTGC AGG Exonic
900350124 1:2230354-2230376 TGGCGGCTCCAGCACTGTGCTGG + Intronic
900516206 1:3083380-3083402 TGGCGGGGCCTGCTGTGTGCCGG + Intronic
901057399 1:6455096-6455118 GGGCGGCGGCGGCGCTGGGCTGG - Intronic
901086213 1:6613789-6613811 CGGCGGCGGCGGCGGTGAGCGGG - Exonic
901541392 1:9919625-9919647 AGGCGGAGGCTGCAGTGAGCCGG - Intergenic
901859178 1:12063459-12063481 TGGCCGCGGCGGGAGTGTGCTGG + Exonic
902476960 1:16693383-16693405 GGGCGGCGGCGGCGCTGGGCTGG + Intergenic
902783126 1:18717029-18717051 CGGCGGCGGCGGCGGAGCGCGGG - Intronic
903058957 1:20656122-20656144 TGACGGCGGAGGCAGTGTGCTGG - Exonic
903524134 1:23980106-23980128 TGGTGGTGGCGGCACTGGGCCGG - Intronic
904063009 1:27725986-27726008 CGGCGGCGGCTGCAGGCTGCTGG - Intronic
904245093 1:29181832-29181854 CGGCGGCGGCGGCAACGGGCGGG + Exonic
904403844 1:30273704-30273726 TGGTGGCTGCTGCAGTGGGCAGG + Intergenic
905491126 1:38344593-38344615 TGGCTGCAGAGGAAGTGTGCGGG + Intergenic
905994043 1:42365588-42365610 AGGCGGAGGCTGCAGTGAGCTGG - Intergenic
906051863 1:42880942-42880964 TGGCCGAGGCGGCAGGGGGCTGG + Intergenic
906277054 1:44524238-44524260 CGGTGGCGGCGGCAGTTCGCAGG - Intronic
908534878 1:65067574-65067596 TGGGGGCGGCGGCCGGGCGCGGG - Intergenic
909853220 1:80495904-80495926 TGGAGGCAGCTGCAGTGTCCTGG + Intergenic
910657462 1:89633176-89633198 TGGCCGCGGCCGCAGTGCTCGGG + Exonic
913109348 1:115642911-115642933 TGGTGGCGGCAGCAGTGGGGCGG + Intronic
915325303 1:155078857-155078879 CGGCGGCGGCAGCAGGGAGCTGG + Exonic
917345197 1:174022212-174022234 TGGCGGCGGCAGCCGTGGCCCGG - Exonic
920804083 1:209216735-209216757 TGGCAGTGGCTGCAGTGAGCTGG - Intergenic
921355563 1:214281437-214281459 CGGCGGCGGCGGCGGCGGGCGGG + Intronic
921432798 1:215083015-215083037 CGGCGGCGGCGGCGGCGGGCAGG + Intronic
921604759 1:217139699-217139721 CGGCGGCGGCGGCGGTGCGCGGG + Intergenic
921862327 1:220052985-220053007 AGGCGGAGGTTGCAGTGTGCTGG - Intergenic
921934755 1:220786477-220786499 GGGCGGCGGCAGCAGAGAGCTGG + Intergenic
922117214 1:222625804-222625826 AGGCGGAGGCTGCAGTGAGCTGG - Intronic
923506346 1:234609459-234609481 TGGCGGTGGCGGCCGCGTCCCGG - Exonic
924286533 1:242493552-242493574 TGGCGGCGAGGGCAGGGGGCTGG - Intronic
1064443047 10:15370864-15370886 CGGCGGCGGCGGGAGGGTCCCGG - Intronic
1065099926 10:22321960-22321982 TGGCGGCGGCGGCGCGGCGCGGG - Intronic
1067694298 10:48524007-48524029 TGGCGGCGGCCGCAGGGAGCGGG + Intronic
1069386175 10:67884930-67884952 CGGCGGCGGCGGCGCTGTGGCGG + Exonic
1070579957 10:77711584-77711606 AGGCGGTGGCGCCAGTGTGCAGG - Intergenic
1072567795 10:96631811-96631833 AGGCGGAGGCTGCAGTGAGCTGG + Intronic
1074503353 10:114044999-114045021 CGGCGGCGGCGGCGGGGCGCGGG - Exonic
1074761535 10:116670312-116670334 GGGCGGGGCCGGCAGTGGGCGGG + Intergenic
1075433337 10:122409848-122409870 TGGCGGAGGCTGCAGTGAGCTGG - Intronic
1075748425 10:124743973-124743995 GGGCGGCGGCGGCGGTGGCCGGG - Intronic
1076369349 10:129941610-129941632 TGGCGGCGGTGGAGGTGAGCAGG + Intronic
1076878911 10:133230619-133230641 TAGCGGCGGCGGCACTGCGCGGG - Exonic
1077487464 11:2845706-2845728 TGGTGGGGGCTGCAGTGTGGAGG - Intronic
1078175033 11:8964063-8964085 TGGTGGCGGCGGGGGTCTGCCGG + Intronic
1081831910 11:46121536-46121558 CGGCGGCGGCGGCGGCGGGCCGG - Intergenic
1082026905 11:47579093-47579115 TGGCGGCGGCGGCGGTAGCCAGG + Exonic
1083209931 11:61176938-61176960 AGGCGGAGGCTGCAGTGAGCCGG - Intergenic
1083232733 11:61333299-61333321 TGGCGGATGCGGCCGTGAGCCGG + Exonic
1083659292 11:64244886-64244908 TGGCGGGGGTGGCAGGGTGAGGG - Intronic
1083885783 11:65572864-65572886 TGGCGGCGCCGGCGGCGTGGCGG - Exonic
1084072393 11:66744828-66744850 CGGCGGCGGCGGCGGCGGGCGGG + Intronic
1084547016 11:69819545-69819567 CGGCGGCGGCCCCATTGTGCAGG - Intergenic
1084891722 11:72240016-72240038 AGGCGGCGGCGGCAGCGAGGCGG + Exonic
1084913492 11:72409905-72409927 TGGCGGAGGTTGCAGTGAGCCGG + Intronic
1085214411 11:74815484-74815506 AGGCGGAGGTTGCAGTGTGCCGG + Intronic
1085485668 11:76860958-76860980 CGGCGGCGGCGGCGGCGTGATGG + Exonic
1088254440 11:107889538-107889560 TGGCGGAGGTTGCAGTGAGCTGG + Intronic
1088688433 11:112304543-112304565 TGGCTGCGGGAGCAGTGTGGAGG + Intergenic
1089534050 11:119149804-119149826 GGGGGGCGGGGGCAGAGTGCGGG + Intronic
1089543639 11:119206226-119206248 GGGCGGCGCCGGGAGTGCGCGGG - Exonic
1091106003 11:132920546-132920568 TGGCTTCGGAGGCAGTGGGCTGG - Intronic
1091399725 12:174711-174733 TGGCGGCGGCGGCAGTGGTGGGG - Exonic
1091498310 12:991265-991287 TGGCGGCGGCGGCGGTGCCTGGG + Intronic
1091597878 12:1890940-1890962 TGGCAGTGGCTGCAGTGAGCTGG - Intronic
1094496784 12:30993830-30993852 AGGGGGAGGCGGCAGTGGGCAGG + Exonic
1097990088 12:65825004-65825026 TGGCGGCGGCGGCGGTGGGTGGG - Exonic
1098596603 12:72279653-72279675 TGGTGGTGGTGGCAGTGTGAGGG + Intronic
1101813627 12:108129303-108129325 TGGCGGCGGCGGCAGCGGCGCGG + Intergenic
1103400642 12:120640906-120640928 CGGCGGCGGCGGCGGCGAGCGGG + Exonic
1103800357 12:123533738-123533760 CGGCGGCGGCGGCAGCGGGGAGG + Intergenic
1106033051 13:26019698-26019720 GGGCCGTGGCGGCCGTGTGCAGG - Intronic
1106735853 13:32586980-32587002 CGGCGGCGGCGGGAGGGCGCGGG - Intronic
1107605047 13:42048661-42048683 TGGCGGCGGCGGCCGGGCACGGG + Intronic
1108844412 13:54660193-54660215 GGGCTGAGGCGGCAGGGTGCTGG + Intergenic
1110558510 13:76886251-76886273 CGGCGGCGGCGGCGGGGCGCAGG - Exonic
1112216256 13:97434108-97434130 CGGCGGCGGCGGCGGCGGGCGGG + Intergenic
1113541769 13:111115139-111115161 CGGCGGCGGCGGCTGGGAGCGGG - Intronic
1113653591 13:112055148-112055170 TGTCGGCAGCTGCAGTTTGCAGG - Intergenic
1113669577 13:112166365-112166387 TGGAGGCGGTGGGAGGGTGCAGG + Intergenic
1113983900 13:114298468-114298490 AGGCGGAGGCTGCAGTGAGCCGG + Intronic
1114265187 14:21069621-21069643 TGGGGAAGGCGGGAGTGTGCGGG - Intronic
1114886975 14:26864789-26864811 AGGCAGAGGCTGCAGTGTGCGGG + Intergenic
1115248433 14:31320433-31320455 TGGCGGCTGTGTCAGTGTCCCGG + Intronic
1116657971 14:47674991-47675013 CGGCGGCGGCGGCGGCGCGCTGG + Intergenic
1117920793 14:60723771-60723793 CGGCGGCGGCGGCGGCGTGGTGG + Exonic
1118734574 14:68692132-68692154 TGGGGGCGGCGGCAGGGGTCTGG - Intronic
1119393787 14:74310605-74310627 AGGCGGAGGCTGCAGTGAGCCGG - Intronic
1119410280 14:74426084-74426106 GGGCGGCGGCGGCGGGCTGCGGG - Exonic
1119959208 14:78835355-78835377 CGGCGGTGGCAGCAGTGGGCTGG + Intronic
1121796661 14:96741638-96741660 TGGAGGCGGCGGCGGCGTGCGGG - Intergenic
1121835637 14:97089786-97089808 AGGCGGAGGCTGCAGTGAGCTGG - Intergenic
1122183493 14:99971981-99972003 CGGCGGCGGCGGCGGGGCGCGGG - Intronic
1122517623 14:102319807-102319829 TGGCGGCGGCGGCGGCGGCCCGG + Exonic
1124507984 15:30295363-30295385 TGGCGGCGGGGACAGTGAGAGGG - Intergenic
1124735571 15:32243294-32243316 TGGCGGCGGGGACAGTGAGAGGG + Intergenic
1124995810 15:34722066-34722088 CGCCGGCGGAGGCAGCGTGCAGG + Intergenic
1125500229 15:40235264-40235286 TGGCTGCTGCTGCAGTGGGCAGG - Intergenic
1125829419 15:42703431-42703453 AGGCGGAGGCTGCAGTGGGCAGG - Intronic
1127117574 15:55743154-55743176 AGGCGGCGGCTGCAGAGGGCGGG + Intergenic
1129070454 15:72946291-72946313 TGGCAGCAGCAGCAGTGGGCAGG - Intergenic
1130653093 15:85773437-85773459 AGGAGGAGGCGGCATTGTGCTGG - Intronic
1130843627 15:87724344-87724366 TGGCGGAGGTTGCAGTGAGCTGG + Intergenic
1132794425 16:1712441-1712463 TGGCGGCGGTGGGAGTGGCCGGG - Intronic
1132877930 16:2148563-2148585 TGGCGGCGGCGGCGGGAGGCCGG + Intronic
1132968570 16:2673492-2673514 GGGCGGCGGCGGCGGTGCGACGG - Intergenic
1133156447 16:3880130-3880152 CGGCGGCGGCGGCCGGGGGCGGG - Exonic
1133272244 16:4615916-4615938 TGTCGGCGCCTACAGTGTGCCGG - Intergenic
1133397655 16:5461308-5461330 AGGCAGAGGCGGCAGAGTGCGGG - Intergenic
1133801928 16:9091705-9091727 CGGCGGCGGCGGCAGTGGGGAGG + Exonic
1134869514 16:17639033-17639055 AGGCGGAGGCTGCAGTGAGCCGG - Intergenic
1135402004 16:22172367-22172389 TGGAGGAGGCAGCAGTGGGCAGG - Intronic
1135537004 16:23302340-23302362 TGGCGGCGGCGGCCGAGTGTTGG - Exonic
1135712505 16:24729706-24729728 CGGCGGCGGCGGCAGCGGGTCGG + Exonic
1136237761 16:28925102-28925124 CGGCGGCGGCGGCCGGGGGCTGG - Exonic
1138288018 16:55824644-55824666 GGCCGGCGCCTGCAGTGTGCTGG - Intronic
1138425958 16:56932223-56932245 TGGCGGCGGCGGCGGTGTCGGGG - Exonic
1138507696 16:57486383-57486405 TGGCGGGGGCGGCAGGGCGGCGG + Exonic
1141253710 16:82381891-82381913 TGGTGGCGGGGGGAGTGTGGTGG + Intergenic
1141427412 16:83953175-83953197 AGGCGGCGCAGGCAGTGGGCGGG - Intronic
1142266471 16:89066274-89066296 TGGCGGCGGCGGCAGAGCATTGG + Intergenic
1142378908 16:89721039-89721061 TGGCGGGGGCGGCAGAGTCCGGG + Intronic
1142799711 17:2337553-2337575 CGGCGGCGGCGGCGGCGGGCCGG + Exonic
1142848022 17:2691489-2691511 AGGCGGAGGCTGCAGTGAGCCGG + Intronic
1142957128 17:3529777-3529799 TGGTGGCGGGGGCGGTGGGCGGG - Intronic
1144626264 17:16845815-16845837 TGGTGGCGGCGGCAGGAGGCAGG + Intergenic
1144880169 17:18426905-18426927 TGGTGGCGGCGGCAGGAGGCAGG - Intergenic
1145152065 17:20517479-20517501 TGGTGGCGGCGGCAGGAGGCAGG + Intergenic
1146163434 17:30571749-30571771 TGGTGGCGGCGGCAGGAGGCAGG + Intergenic
1146492828 17:33294245-33294267 TGGTGGTGGAGGCAGTGTGAAGG + Intronic
1147580410 17:41624509-41624531 TGGTGGCGGCGGCAGGAGGCAGG + Exonic
1148474014 17:47915361-47915383 TGGTGGAGGCGGCAGGCTGCAGG - Exonic
1148603069 17:48908643-48908665 CGGCGGCGGCGGCAGCGGGCGGG + Exonic
1148677366 17:49453030-49453052 TGCTGGGGGCAGCAGTGTGCTGG - Intronic
1148775155 17:50091083-50091105 AGGCAGAGGTGGCAGTGTGCAGG + Intergenic
1150620029 17:66801279-66801301 TTGGGGCGGGGGCAGTGTCCTGG + Intronic
1151510322 17:74554894-74554916 TGGCGGAGGTTGCAGTGAGCTGG + Intergenic
1151792639 17:76318378-76318400 AGGCGGAGGTGGCAGTGAGCTGG + Intronic
1152030036 17:77836532-77836554 TGGCGGGGGTGGCAGGGTGGGGG - Intergenic
1152145470 17:78565878-78565900 AGGCGGAGGTTGCAGTGTGCTGG + Intronic
1152433119 17:80260542-80260564 CGGCGGCGGCGGCGGCGGGCAGG + Intergenic
1152433132 17:80260572-80260594 CGGCGGCGGCGGCGGCGGGCAGG + Intergenic
1152433145 17:80260602-80260624 CGGCGGCGGCGGCGGCGGGCAGG + Intergenic
1152433158 17:80260632-80260654 CGGCGGCGGCGGCGGCGGGCAGG + Intergenic
1152433171 17:80260662-80260684 CGGCGGCGGCGGCGGCGGGCAGG + Intergenic
1152433184 17:80260692-80260714 CGGCGGCGGCGGCGGCGGGCAGG + Intergenic
1152433197 17:80260722-80260744 CGGCGGCGGCGGCGGCGGGCAGG + Intergenic
1152433210 17:80260752-80260774 CGGCGGCGGCGGCGGCGGGCAGG + Intergenic
1152433223 17:80260782-80260804 CGGCGGCGGCGGCGGCGGGCAGG + Intergenic
1152433236 17:80260812-80260834 CGGCGGCGGCGGCGGCGGGCAGG + Intergenic
1153983532 18:10332869-10332891 TGGCGGGCGGGGCAGTGTCCAGG - Intergenic
1155392722 18:25352309-25352331 CGGCGGCGGCGGCGGCGGGCGGG - Intergenic
1155799341 18:30081578-30081600 TGGCGGTGGCTGCAATGGGCTGG + Intergenic
1156008431 18:32470448-32470470 TGGCGGCGGCGGGGGAGCGCGGG - Intronic
1157205156 18:45691792-45691814 TGGTGGCAGTGGCAGGGTGCTGG - Intergenic
1157279117 18:46334232-46334254 CGGCGGCGGCGGCTGCGCGCGGG - Exonic
1159040577 18:63320040-63320062 CGGCGGCGGCGGCAGCGCGGCGG + Exonic
1160877510 19:1303987-1304009 AGGCGGAGGCTGCAGTGAGCCGG - Intergenic
1160930585 19:1567992-1568014 CGGCGGCGGCGGCGGCGTGGGGG - Exonic
1161684486 19:5696172-5696194 TGGGGGCGGCGGCAAGGTGCTGG + Intronic
1161703243 19:5805935-5805957 CGGCGGCGGCGGCGGCGAGCAGG - Intergenic
1162470876 19:10871496-10871518 TGGCGGCGGCGGCGGCGAGGCGG + Exonic
1163304896 19:16471872-16471894 TGGGGGCGGCGCCGGGGTGCGGG - Intronic
1163620659 19:18357853-18357875 TGGAGGCTGGGGCAGTGTCCAGG - Intronic
1163695070 19:18759937-18759959 TGGCGGCGGGGACAGGGGGCTGG - Intronic
1165242829 19:34481609-34481631 TGGCGGCGGCCGCGCTGCGCCGG - Intergenic
1165331453 19:35142997-35143019 TGGCGGCAGGGGGAGTCTGCGGG - Exonic
1165351689 19:35279266-35279288 GGGCGGCGGCGGCTGCGTGGTGG - Exonic
1165770060 19:38374792-38374814 TGGCGGCCGCGGCGGTGAACGGG + Exonic
1166166258 19:40991266-40991288 TGGAGGCTGCAGCAGGGTGCAGG + Intergenic
1166869525 19:45863106-45863128 CGGCGGCGGCGGCGGAGTGTAGG - Exonic
1167056142 19:47112549-47112571 TGGCGGCGGCGGGGGGGTCCCGG + Exonic
1167457059 19:49601800-49601822 AGGAGACGGCGGCAGTGTGTGGG + Exonic
1168324950 19:55533790-55533812 TGGCCGTGGCGGCAGTGATCAGG - Intronic
1168408108 19:56121141-56121163 TGGGGGCGGGGGCCGTGCGCTGG - Intronic
1202710976 1_KI270714v1_random:19209-19231 GGGCGGCGGCGGCGCTGGGCTGG + Intergenic
925927205 2:8678994-8679016 TGGCGGCGGCGGCGGCGCGCGGG - Exonic
929701841 2:44169097-44169119 CGGCGGCGGCGGCGGCGTGAGGG + Exonic
931563373 2:63588359-63588381 TGGCGGCGGCGGCGGCGTCCTGG - Exonic
932496599 2:72148663-72148685 CGGCGGCGGCGGCAGCGGGCGGG + Intergenic
932827932 2:74958687-74958709 CGGCGGCGGCGGCAGGAAGCGGG + Exonic
933752477 2:85611848-85611870 TGGCGGCGGCGGCGCAGGGCGGG + Intronic
934567039 2:95346829-95346851 GGGCGGCGGCGGCGGCGAGCGGG - Intronic
934783293 2:96986530-96986552 CGGCGGCGGCGGCTGTGAGCTGG - Exonic
934970669 2:98761634-98761656 TGGCAGCGGCGGCGGGGTGGGGG - Intergenic
935331412 2:101980279-101980301 TGAGGGAGGCGGCAGTGGGCTGG - Intergenic
936412865 2:112275880-112275902 TGTCGGCGGCGGCCGGGAGCAGG + Exonic
937023849 2:118681442-118681464 TTGCCCCGGCGGGAGTGTGCTGG + Intergenic
938228480 2:129637711-129637733 TGGCAGAGGCTGCAGTGAGCCGG - Intergenic
938406242 2:131034870-131034892 GGGCGGCGGCGGCGGCGGGCTGG - Intronic
941666422 2:168247540-168247562 CGGCGGCGGCGGCGGCGGGCGGG - Exonic
942450903 2:176107589-176107611 CGGCGGCGGCGGCAGCGCGGGGG + Exonic
944219787 2:197291438-197291460 AGGCGGAGGCTGCAGTGAGCTGG + Intronic
944412444 2:199457729-199457751 CGGCGGCGGCGGCGGCGAGCCGG + Exonic
944843620 2:203646740-203646762 TGGGGGCGGCCACAGGGTGCTGG + Intergenic
945314453 2:208356582-208356604 AGGCGGAGGCTGCAGTGAGCTGG + Exonic
948103643 2:235395291-235395313 TGGTGGGGGAGGCAGTGTTCTGG - Intergenic
948824678 2:240568498-240568520 CGGCGGCGGCGGCGGGGCGCGGG - Intronic
949040964 2:241849842-241849864 TGGCTGTGGGGGCAGTGGGCAGG - Intergenic
1169278453 20:4248786-4248808 GGGCGGCGGCGGCGGCGTGGTGG - Exonic
1169863095 20:10172424-10172446 TGGCAGCGGTGGCAGATTGCAGG - Intergenic
1170889969 20:20368416-20368438 CGGCGGCGGCGGCAGCGGCCCGG - Exonic
1172083217 20:32358678-32358700 GGGCGGCGGCGGCGGTGGGGGGG - Exonic
1172358888 20:34298596-34298618 TGGCGGCGGCGGGAGGGGGGGGG + Intronic
1172816947 20:37694485-37694507 TGGCGGCGGTGGGAGTGCACTGG + Intronic
1174494735 20:50931319-50931341 AGGCGGCGGCGGCAACGGGCGGG + Intergenic
1174607048 20:51768476-51768498 AGGAGGCGGCGGCAGCGGGCGGG + Exonic
1174759347 20:53191591-53191613 AGGCGGAGGCTGCAGTGAGCTGG + Intronic
1175448530 20:59042968-59042990 TGCCGTCGGCGGCACTGCGCCGG - Intergenic
1175517288 20:59577580-59577602 GGGCGGCGGCGGCAGCGTCCCGG - Intronic
1175715518 20:61252455-61252477 CGGCGGCGGCGGCAGGGAGCGGG + Exonic
1176234559 20:64048418-64048440 GGGCGGCGGCGACAGCGGGCCGG + Exonic
1176380903 21:6111601-6111623 GGGCGGCGGGGGCAGGGTGTGGG + Intronic
1176549737 21:8216039-8216061 CGGCGGCGGCGGGGGTGTGTGGG + Intergenic
1176557628 21:8260268-8260290 CGGCGGCGGCGGGGGTGTGTGGG + Intergenic
1176568662 21:8399073-8399095 CGGCGGCGGCGGGGGTGTGTGGG + Intergenic
1179742569 21:43426639-43426661 GGGCGGCGGGGGCAGGGTGTGGG - Intronic
1179775525 21:43659536-43659558 AGGCGGCGGCGGCGGCGCGCGGG - Exonic
1179796872 21:43789918-43789940 CGGCGGCGGGGGCCGTGGGCCGG - Intronic
1180087704 21:45515487-45515509 TGGCGGTGGCCACAGCGTGCTGG - Exonic
1180155119 21:45973902-45973924 TGGCGGGAGCCGCAGGGTGCTGG - Intergenic
1180908397 22:19431658-19431680 CGGCGGCGGCGGCCGAGCGCGGG - Exonic
1180961933 22:19766177-19766199 GGGCGGCGGCGGCGGCGGGCGGG - Intronic
1181130628 22:20729554-20729576 TGGTGGCCGGGGCAGTGTGTGGG - Intronic
1181963521 22:26640307-26640329 TGGTGGCGGTTGCAGTGAGCCGG - Intergenic
1182374722 22:29838194-29838216 CGGCGGCGGCGGCACAGAGCCGG - Exonic
1183479779 22:38057178-38057200 TGGCGGCGGCGGCAGGGCAAAGG + Exonic
1184265337 22:43343238-43343260 TGGGCGCGGCGGCCGTGCGCTGG - Exonic
1184347748 22:43923890-43923912 TGGCGGCGGCGGCGGGGCGGGGG - Exonic
1184617595 22:45648584-45648606 TGGCGGCGTCGGAAGTGGTCAGG - Intergenic
1184893430 22:47393282-47393304 TGGCTGAGGCCGCAGAGTGCTGG - Intergenic
1185278861 22:49961386-49961408 CGGCGGCGGCGGCGGGGGGCGGG + Intronic
1185310520 22:50151776-50151798 TGGTGGGGACGGCAGCGTGCTGG - Intronic
1185335796 22:50270386-50270408 AGGCGGCGGCGGCGGCGGGCGGG + Exonic
1185349457 22:50326988-50327010 TGGCGGCGGCCGCGGGTTGCCGG + Exonic
1203255013 22_KI270733v1_random:133594-133616 GGGCGGCGGCGGCGGTCGGCGGG + Intergenic
1203263069 22_KI270733v1_random:178673-178695 GGGCGGCGGCGGCGGTCGGCGGG + Intergenic
950124957 3:10505318-10505340 TGGTGGCGGTGGCAGCGTGGAGG - Intronic
950468153 3:13167764-13167786 TGGCGAAGGGGGCAGTCTGCAGG - Intergenic
950473615 3:13202013-13202035 TGGCAGCGGCTGCAGTTGGCTGG - Intergenic
950747070 3:15099103-15099125 TGGCGGCTGCGGCTGAGTGACGG - Exonic
951264911 3:20553259-20553281 AGACGGCGGCTGCAGTGTGGAGG - Intergenic
951611364 3:24495225-24495247 TGGCGGCGGCGGCCAAGAGCAGG + Intronic
952230178 3:31421187-31421209 AGGCGGAGGCTGCAGTGAGCTGG + Intergenic
953390571 3:42531544-42531566 TGGCGGCCGGGGGAGTGTGTGGG - Intronic
953501912 3:43444742-43444764 TGGCGAGGACGGCAGGGTGCAGG + Intronic
954002183 3:47566400-47566422 TGGCGGCTGTAGCAGTGAGCAGG + Intronic
954249616 3:49357955-49357977 TGGGGGCGCCGGCGGTGTGCTGG - Intronic
954777392 3:53032298-53032320 AGGCGGAGGCTGCAGTGAGCCGG + Intronic
955769232 3:62372517-62372539 TGGCGGCGGCGGCGGCGGGGGGG - Exonic
956678076 3:71753865-71753887 TGGCGGCGGCGGCACAGCGGCGG + Intronic
956742948 3:72289235-72289257 TGGCGGCAGCCCCAGTTTGCAGG - Intergenic
962775918 3:138659445-138659467 AGGCGGAGGCTGCAGTGAGCCGG + Intronic
963870237 3:150408513-150408535 GGGCGGCGGCGGCAGACCGCTGG - Exonic
964771287 3:160226115-160226137 TGGCGGCGGCGGCCGGGGCCGGG + Exonic
966217442 3:177518103-177518125 TGGCAGCGGCAGCAGGGAGCGGG + Intergenic
966411849 3:179653142-179653164 CGGCGGCGGCGCCAGCGAGCGGG - Exonic
967930429 3:194686776-194686798 CGGCGGCGGCGGCGGAGCGCCGG - Exonic
968234573 3:197024125-197024147 CGGCGCCGGCGGCAGAGTGGAGG + Intronic
968506484 4:973459-973481 TGGCGGCGGCGGCCGAGCCCGGG - Exonic
968636645 4:1684371-1684393 TCGCGGCGGCGGCGGGGCGCGGG - Intergenic
968659644 4:1793714-1793736 GGGCGGCGGCGGCGGCGGGCGGG + Intronic
968732041 4:2273807-2273829 TGGCGGCGGGGGCAGTGGGGTGG - Intronic
970194631 4:13542427-13542449 CGGCGGGGGCGGCAGCGGGCCGG - Exonic
971570004 4:28199328-28199350 AGGCGGAGGCGGCAGTGAGCTGG + Intergenic
971815668 4:31485038-31485060 AGGCGGAGGTGGCAGTGAGCTGG - Intergenic
972265337 4:37453998-37454020 CGGCGGCGGCGGCGGGGTCCCGG - Intronic
972321592 4:37977443-37977465 GGCCGGCGGCGGGAGTGAGCGGG + Intronic
972960545 4:44447917-44447939 TGGCGGCGGCGGCGGCGCGCAGG - Exonic
973839854 4:54850268-54850290 AGGCGGAGGCTGCAGTGAGCCGG + Intergenic
973853619 4:54987145-54987167 TGGCGGTGTCTGCAGTGTGCTGG - Intergenic
976246470 4:83010793-83010815 TGGCGGCGGCGGCGGCGGCCCGG - Exonic
977418391 4:96764316-96764338 TGGCTGCAGCGGCAGTTGGCAGG + Intergenic
979785643 4:124712693-124712715 CGGCGGCGGCGGCGGTTGGCCGG - Exonic
980939246 4:139257808-139257830 TGGCGGAGGTTGCAGTGAGCTGG - Intergenic
981182687 4:141764174-141764196 TGGCGGAGGCTGCAGTGAGCCGG + Intergenic
984377734 4:178953887-178953909 TGGCGGTGGCGGCACGGTGAAGG - Intergenic
985653979 5:1120443-1120465 GCGCGCCGTCGGCAGTGTGCCGG + Intergenic
986330579 5:6713838-6713860 CGGCGGCGGCGGCGGCGGGCGGG - Intergenic
986809978 5:11346547-11346569 TGGCCGCGGCGGCATTCTGTGGG + Exonic
988609540 5:32711863-32711885 TGGCGGCGGCGGCGGTGGCGCGG + Exonic
989178832 5:38556564-38556586 TGGCGGCGGCGGCGGCCCGCGGG - Intronic
989571614 5:42951176-42951198 GGGCGGCGGCGGCGCTGGGCTGG - Intergenic
989651187 5:43692391-43692413 AGGCGGAGGTGGCAGTGAGCTGG - Intronic
990003877 5:50923265-50923287 TGGCCGCCGGGGCAGGGTGCCGG + Intergenic
990862070 5:60338377-60338399 CGGCGGCAGCAGCAGTGTCCTGG - Intronic
990955056 5:61332424-61332446 CGGCGGCGGCGGCGGCGTGCGGG + Exonic
991676563 5:69094297-69094319 CGGCGGCGGCGGCCTTGGGCCGG + Exonic
992528111 5:77630705-77630727 TGGCGTGGGCAGCAGTGTGCCGG + Exonic
993726944 5:91380209-91380231 CGGCGGCGGCGGCGGCGCGCGGG - Intronic
994185137 5:96807877-96807899 TGGCGGCGGCGCAAGGGTGAGGG - Exonic
995313477 5:110739368-110739390 TGGCGGCGGCGGCAGTGTGCAGG + Exonic
997830175 5:137142842-137142864 TGGCGTGGGCGGCAGTGCACTGG - Intronic
997897036 5:137728230-137728252 TAGAGGGGGCAGCAGTGTGCTGG - Intronic
1002156725 5:177287564-177287586 AGGCGGAGGCTGCAGTGAGCCGG + Intronic
1002534303 5:179867722-179867744 CGGCGGTGGCTGCAGAGTGCTGG + Intronic
1002897857 6:1389746-1389768 CGGCGGCGGCGGCGGCGGGCGGG - Intergenic
1004361430 6:14974564-14974586 TGGAGGAGGCAGCAGAGTGCTGG + Intergenic
1004690346 6:17987691-17987713 CGGCGGCGGCGGCGGCGGGCGGG + Intergenic
1004976899 6:20977806-20977828 AGGCGGAGGCTGCAGTGAGCTGG + Intronic
1005512374 6:26522057-26522079 TGGCGGCGGGAGTAGCGTGCCGG + Intergenic
1006089682 6:31620930-31620952 CGGCGGCGGCGGTGGTGGGCCGG + Intronic
1006434474 6:34019078-34019100 TGGAGGCTGAGGCAGTGTGGGGG + Intronic
1007039886 6:38711952-38711974 TGGTTGGGGCGGCAGGGTGCAGG - Intergenic
1007600140 6:43076280-43076302 CGGCGGCGGCGGCGGCGCGCGGG + Intronic
1007759876 6:44127551-44127573 CGGCGGCCGCGGCAGTGTATGGG - Intronic
1007784067 6:44270457-44270479 AGGCGGCGGCGGGAGCGGGCGGG + Exonic
1011734368 6:90296696-90296718 GGGCGGCGGCGGGAGTGGGCAGG + Exonic
1014225493 6:118841902-118841924 AGGCGGAGGCTGCAGTGAGCTGG - Intronic
1014246826 6:119078539-119078561 GGGCGGCGGCGGCCGGGGGCCGG + Exonic
1016010760 6:139135527-139135549 TGGCGGCGGCGGCCGGTTGCGGG + Exonic
1016028207 6:139310762-139310784 AGGCGGAGGTTGCAGTGTGCTGG - Intergenic
1016965846 6:149718036-149718058 CGGCGGCGGCGGCGGTGGCCTGG - Exonic
1017672399 6:156779257-156779279 CGGCGGCGGCGGCGGCGCGCTGG - Exonic
1018263141 6:161990086-161990108 TGGCAGTGGTGGCAGTGGGCTGG - Intronic
1018400379 6:163414795-163414817 AGGCGGCGGCGGCGCTGAGCGGG + Exonic
1019111894 6:169723908-169723930 TGGCGGCGGCGGCCGGGCCCGGG - Exonic
1019279298 7:192232-192254 TGGCGGCGGCGGCCCCGGGCGGG + Intergenic
1019989613 7:4682457-4682479 TGGCGGCGGCGGCGGCGGCCCGG - Exonic
1020248343 7:6447903-6447925 TGGCGGCGTCCGGAGGGTGCTGG - Exonic
1022666483 7:32416043-32416065 TGGGGGAGGCGGGCGTGTGCTGG - Intergenic
1023638807 7:42237969-42237991 CGGCGGCGGCGGCGGAGGGCGGG - Intergenic
1024663296 7:51520302-51520324 TGGCTGAGTCGGCAGTGTGGAGG - Intergenic
1025730290 7:64102005-64102027 TGGTGGCTGCGGCAGTTTGTTGG + Intronic
1026360539 7:69598394-69598416 CGGCGGCGGCGGCGGTGGGCTGG + Intergenic
1026776813 7:73235609-73235631 TGTGGGCGGGGCCAGTGTGCGGG + Intergenic
1027017662 7:74788979-74789001 TGTGGGCGGGGCCAGTGTGCGGG + Intronic
1027070360 7:75156953-75156975 TGTGGGCGGGGCCAGTGTGCGGG - Intergenic
1029321999 7:99770435-99770457 GGGGGGTGGCGGCAGTGTTCAGG + Intronic
1032174406 7:129611917-129611939 AGCCGGGGGCGGCAGGGTGCCGG - Intronic
1032335188 7:131018438-131018460 TGGGGGCAGCGGGAGTGTGCTGG - Intergenic
1032391232 7:131556578-131556600 CGGCGGCGGCGGCTGCGTCCTGG + Exonic
1033656918 7:143381096-143381118 CGGCGGGGGCGGCAGTGAGTGGG + Exonic
1034147253 7:148884206-148884228 CGGCGGCGGCGGCGGCGCGCGGG - Exonic
1034469718 7:151248750-151248772 CGGCGGCGGCGGCGGCGGGCGGG - Exonic
1034719634 7:153278542-153278564 AGGCGGAGGCTGCAGTGAGCCGG + Intergenic
1036561933 8:9905671-9905693 TGGCGGCGGCGGCCGGGGGAAGG + Intergenic
1039065836 8:33606783-33606805 AGGCGGAGGTGGCAGTGAGCTGG - Intergenic
1039340339 8:36641901-36641923 AGGCGGAGGCAGCAGTGAGCTGG + Intergenic
1039879435 8:41615280-41615302 TGGTGGCGGCAGCAGCATGCAGG - Intronic
1040477030 8:47787755-47787777 TGGCTGAGGTAGCAGTGTGCTGG + Intronic
1045153883 8:99444166-99444188 AGGCGGAGGCTGCAGTGAGCCGG - Intronic
1046395336 8:113633016-113633038 TGGCTGAGGCGGCAGGGGGCTGG + Intergenic
1048968413 8:139630381-139630403 CGGCGGCGGCGGCAGAGCCCAGG - Intronic
1049473820 8:142787844-142787866 TGGCAGCGGCGGCAGGAGGCTGG - Intergenic
1049762273 8:144336902-144336924 CGGCGGCGGCGGCGGCGGGCGGG + Intergenic
1049790975 8:144472600-144472622 TGGCGGTGGCGGCGGTGGCCCGG - Exonic
1052049616 9:23830341-23830363 TGCCAGGGGCGGCAGTGAGCGGG + Intergenic
1055447427 9:76396766-76396788 TGGCGGCAGTTGCAGTGAGCTGG + Intergenic
1055514669 9:77022973-77022995 ATGCGGCAGCGGCAGTGTCCCGG - Intergenic
1055757601 9:79572602-79572624 GCGCGGCGGCGGCTGGGTGCCGG - Exonic
1056803892 9:89713157-89713179 TGGCTGAGGGGTCAGTGTGCAGG + Intergenic
1057869710 9:98708687-98708709 TGGCGGCGGCGGCGGCGGCCCGG + Exonic
1058363358 9:104177082-104177104 TGACTGTGGCAGCAGTGTGCTGG - Intergenic
1059414801 9:114155988-114156010 CGGCGGCGGCGGCGGCGCGCGGG + Exonic
1059930533 9:119255883-119255905 AGGCGGAGGCTGCAGTGAGCCGG + Intronic
1060069937 9:120537382-120537404 TGGTGGGGGCGGCACTGTGGAGG - Intronic
1060228883 9:121812730-121812752 TGGGGGCGGGGGCACTGTGGCGG + Intergenic
1060405894 9:123372979-123373001 TGGGGGCGGCTGCAGTTTCCAGG + Intronic
1060841144 9:126793940-126793962 TGGTGGTGGCAGCAGTGTTCTGG + Intergenic
1061084949 9:128393197-128393219 TGGCGGTGGCGGCGGTGGCCCGG + Intergenic
1061541084 9:131278045-131278067 CGGCGGCGGCGGCGGCGGGCGGG + Intergenic
1061631039 9:131872323-131872345 TGGCCTCGGGGGCTGTGTGCTGG - Intronic
1062162472 9:135087834-135087856 GGGCGGCGGCGGCGGCGGGCGGG + Exonic
1062305762 9:135906702-135906724 TGGCGGCGGCGGCGGCGGGAAGG - Intronic
1062574569 9:137200226-137200248 CGGCGGCGGCGGCGGGGGGCGGG + Exonic
1203665425 Un_KI270754v1:18154-18176 CCGCGGCGGCGGCTGTGTCCTGG + Intergenic
1187225913 X:17375398-17375420 CGGCGGCGACGGCAGTGGCCGGG + Exonic
1187518169 X:19990990-19991012 GGGAGGCGGCGGCAGAGTGAGGG - Intergenic
1188003527 X:25002648-25002670 CGGCGGCGGCGGCGGCGTGGCGG + Intergenic
1189137115 X:38561503-38561525 CGGCGGCGGCGGCAGGCGGCGGG - Exonic
1189390615 X:40573200-40573222 AGGCGGAGGCTGCAGTGAGCCGG + Intergenic
1189888784 X:45577342-45577364 TGGAGGCAGTGGCAGTGTGGGGG + Intergenic
1189961281 X:46327085-46327107 TGGCGGCGGGGGCGGGGTGGGGG + Intergenic
1192317516 X:70064109-70064131 AGGCGGAGGCTGCAGTGGGCCGG + Exonic
1192773868 X:74221772-74221794 AGGCGGAGGCTGCAGTGAGCTGG + Intergenic
1193443138 X:81567495-81567517 TGGCAGCAGTGGCAGTGAGCAGG - Intergenic
1194097927 X:89666177-89666199 TGGAGGCAGTGGCAGTGTGTGGG + Intergenic
1198512478 X:137366464-137366486 AGGCGGCTGCTGGAGTGTGCTGG - Intergenic
1199772769 X:150984516-150984538 CGGCGGCGGTGGCGGTGCGCGGG - Intronic
1200450949 Y:3327566-3327588 TGGAGGCAGTGGCAGTGTGTGGG + Intergenic