ID: 995313478

View in Genome Browser
Species Human (GRCh38)
Location 5:110739369-110739391
Sequence GGCGGCGGCGGCAGTGTGCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 525
Summary {0: 1, 1: 0, 2: 0, 3: 45, 4: 479}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995313466_995313478 13 Left 995313466 5:110739333-110739355 CCGTACGAAGGCCCCACGGAGGA 0: 1
1: 0
2: 0
3: 10
4: 54
Right 995313478 5:110739369-110739391 GGCGGCGGCGGCAGTGTGCAGGG 0: 1
1: 0
2: 0
3: 45
4: 479
995313460_995313478 21 Left 995313460 5:110739325-110739347 CCTCCACCCCGTACGAAGGCCCC 0: 1
1: 0
2: 0
3: 6
4: 115
Right 995313478 5:110739369-110739391 GGCGGCGGCGGCAGTGTGCAGGG 0: 1
1: 0
2: 0
3: 45
4: 479
995313461_995313478 18 Left 995313461 5:110739328-110739350 CCACCCCGTACGAAGGCCCCACG 0: 1
1: 0
2: 0
3: 1
4: 41
Right 995313478 5:110739369-110739391 GGCGGCGGCGGCAGTGTGCAGGG 0: 1
1: 0
2: 0
3: 45
4: 479
995313468_995313478 1 Left 995313468 5:110739345-110739367 CCCACGGAGGAACCCTTTTCCAG 0: 1
1: 0
2: 0
3: 6
4: 71
Right 995313478 5:110739369-110739391 GGCGGCGGCGGCAGTGTGCAGGG 0: 1
1: 0
2: 0
3: 45
4: 479
995313457_995313478 27 Left 995313457 5:110739319-110739341 CCACCACCTCCACCCCGTACGAA 0: 1
1: 0
2: 0
3: 13
4: 390
Right 995313478 5:110739369-110739391 GGCGGCGGCGGCAGTGTGCAGGG 0: 1
1: 0
2: 0
3: 45
4: 479
995313456_995313478 28 Left 995313456 5:110739318-110739340 CCCACCACCTCCACCCCGTACGA 0: 1
1: 0
2: 0
3: 14
4: 251
Right 995313478 5:110739369-110739391 GGCGGCGGCGGCAGTGTGCAGGG 0: 1
1: 0
2: 0
3: 45
4: 479
995313467_995313478 2 Left 995313467 5:110739344-110739366 CCCCACGGAGGAACCCTTTTCCA 0: 1
1: 0
2: 1
3: 4
4: 87
Right 995313478 5:110739369-110739391 GGCGGCGGCGGCAGTGTGCAGGG 0: 1
1: 0
2: 0
3: 45
4: 479
995313469_995313478 0 Left 995313469 5:110739346-110739368 CCACGGAGGAACCCTTTTCCAGT 0: 1
1: 0
2: 0
3: 23
4: 76
Right 995313478 5:110739369-110739391 GGCGGCGGCGGCAGTGTGCAGGG 0: 1
1: 0
2: 0
3: 45
4: 479
995313463_995313478 15 Left 995313463 5:110739331-110739353 CCCCGTACGAAGGCCCCACGGAG 0: 1
1: 0
2: 0
3: 0
4: 23
Right 995313478 5:110739369-110739391 GGCGGCGGCGGCAGTGTGCAGGG 0: 1
1: 0
2: 0
3: 45
4: 479
995313459_995313478 24 Left 995313459 5:110739322-110739344 CCACCTCCACCCCGTACGAAGGC 0: 1
1: 0
2: 1
3: 2
4: 90
Right 995313478 5:110739369-110739391 GGCGGCGGCGGCAGTGTGCAGGG 0: 1
1: 0
2: 0
3: 45
4: 479
995313464_995313478 14 Left 995313464 5:110739332-110739354 CCCGTACGAAGGCCCCACGGAGG 0: 1
1: 0
2: 2
3: 7
4: 72
Right 995313478 5:110739369-110739391 GGCGGCGGCGGCAGTGTGCAGGG 0: 1
1: 0
2: 0
3: 45
4: 479

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995313478 Original CRISPR GGCGGCGGCGGCAGTGTGCA GGG Exonic
900414673 1:2529511-2529533 GGCGGCGGCGGCGGTGGCCTTGG + Exonic
901056024 1:6448968-6448990 GGCGGCGGCGGCGGTGGGGGCGG - Exonic
901541391 1:9919624-9919646 GGCGGAGGCTGCAGTGAGCCGGG - Intergenic
902375071 1:16026726-16026748 GGCAGCGGCGGCAGTGGGCGTGG + Exonic
902380042 1:16048533-16048555 GGCAGCGGCGGCAGTGGGCGTGG + Exonic
902783125 1:18717028-18717050 GGCGGCGGCGGCGGAGCGCGGGG - Intronic
902816333 1:18918656-18918678 GGCTGCGGCGGCACTGGTCAGGG + Intronic
903324745 1:22563458-22563480 GGCGGCGGCGGCGGCGGGCGCGG + Intergenic
903750182 1:25616697-25616719 GGCGGCGGCGGGAGGGGGCGCGG + Intergenic
905449323 1:38046755-38046777 GGCGGCGGCGGCGCGGCGCAGGG - Exonic
906603289 1:47147879-47147901 GGCTGTGGCTTCAGTGTGCAGGG + Intronic
907194113 1:52672649-52672671 GGCGGAGGTTGCAGTGTGCCAGG - Intergenic
907249246 1:53127181-53127203 GGCAGCGGCAGCAGAGTTCAGGG - Intronic
912561651 1:110555602-110555624 GGCGGCCGCCGCGGTGTGGAGGG + Intergenic
912716930 1:111989748-111989770 GGCGGCGGCGGCAGTGGCGGCGG - Intergenic
912927904 1:113929715-113929737 GGCGGCGGCGGCGGCGGGAAGGG + Exonic
915325304 1:155078858-155078880 GGCGGCGGCAGCAGGGAGCTGGG + Exonic
917572871 1:176287711-176287733 AGCAGCTGTGGCAGTGTGCAGGG + Intergenic
918064224 1:181088873-181088895 GGCGCCGACGGCCCTGTGCAGGG + Exonic
919831055 1:201540153-201540175 GGTGGCGGGGGCGGTGTGTAGGG + Intergenic
920541845 1:206784664-206784686 GGGGGCGGCGGGGGTGTGGAAGG + Intergenic
921603985 1:217135533-217135555 GGCGGCGGCGGCGGTGTTGGCGG + Intronic
921862326 1:220052984-220053006 GGCGGAGGTTGCAGTGTGCTGGG - Intergenic
922441314 1:225657325-225657347 GGAGGAGGCTGCAGTGAGCAGGG - Intergenic
922801813 1:228367978-228368000 GGGGGCTGGGGCAGGGTGCATGG - Intronic
924752910 1:246912412-246912434 GGCGGAGGTTGCAGTGAGCAGGG + Intronic
1062843381 10:688148-688170 GGCGGGAGCTGCCGTGTGCAGGG - Intronic
1064443046 10:15370863-15370885 GGCGGCGGCGGGAGGGTCCCGGG - Intronic
1064553117 10:16521724-16521746 AGCGGCGGCGGCGGCGGGCACGG + Exonic
1065103838 10:22359460-22359482 GGTGGAGGCTGCAGTGGGCAAGG - Intronic
1065152161 10:22833087-22833109 GGCGGGGGTTGCAGTGAGCAAGG - Intergenic
1066464556 10:35640918-35640940 GGCGGCGGCGGCAGGCGGCGCGG + Exonic
1067111484 10:43404230-43404252 GGCGGAGGCTGCAGTGAGCCTGG + Intronic
1067694299 10:48524008-48524030 GGCGGCGGCCGCAGGGAGCGGGG + Intronic
1068931660 10:62596540-62596562 GGTGGCGGTGGGAGTGTGCCCGG - Intronic
1069386176 10:67884931-67884953 GGCGGCGGCGGCGCTGTGGCGGG + Exonic
1069819404 10:71218105-71218127 GGCGGAGGTGGGAGTTTGCAGGG + Intronic
1070079322 10:73169524-73169546 GGTGGAGGCTGCAGTGAGCAAGG - Intronic
1070844674 10:79512548-79512570 GGCGGCGGCGGCGGCGGGCTCGG + Intergenic
1070929130 10:80247763-80247785 GGCGGCGGCGGCGGCGGGCTCGG - Intergenic
1071507324 10:86240588-86240610 GGCGGGGGCGGGGGTGGGCAGGG + Intronic
1072014452 10:91333160-91333182 GGCGGCTGAGGCAGTGAGCCAGG - Intergenic
1072190600 10:93073896-93073918 GGCGGCGGCGGCAGGTGGCGCGG + Exonic
1072429197 10:95356136-95356158 GGCAGTGGCGGCAGTGTTCATGG - Intronic
1072567796 10:96631812-96631834 GGCGGAGGCTGCAGTGAGCTGGG + Intronic
1072731496 10:97849964-97849986 GGCGGCGGCGGCGGCGGGGATGG - Intergenic
1073324584 10:102634920-102634942 GGAGGCAGCAGCAGGGTGCAAGG + Intergenic
1073432169 10:103493917-103493939 GGCCGCGGCGGCGATGTGCGTGG - Intergenic
1074503352 10:114044998-114045020 GGCGGCGGCGGCGGGGCGCGGGG - Exonic
1074843285 10:117375441-117375463 GGCGGCGGCGGCAGCGGGGCCGG + Exonic
1075433336 10:122409847-122409869 GGCGGAGGCTGCAGTGAGCTGGG - Intronic
1075748424 10:124743972-124743994 GGCGGCGGCGGCGGTGGCCGGGG - Intronic
1076409937 10:130241427-130241449 GGTGGAGGCTGCAGTGTGCCAGG - Intergenic
1076727707 10:132421246-132421268 GGCCGGGGCCGCAGGGTGCAGGG - Intergenic
1076817485 10:132921999-132922021 GGGGGCGGTGGCAGGGAGCATGG + Intronic
1076878910 10:133230618-133230640 AGCGGCGGCGGCACTGCGCGGGG - Exonic
1077234239 11:1472252-1472274 GGGGGCGGCCGCTGTGGGCATGG - Intronic
1077437510 11:2549904-2549926 GGTGGCGGGGGCGGTGGGCAAGG - Intronic
1078057405 11:8019249-8019271 GGCGGCGGCGGCGCTGGGCTTGG - Intronic
1078190839 11:9091607-9091629 GGTGGCAGCGGCAGCGGGCAGGG - Intronic
1078227787 11:9408778-9408800 GGCGGAGGCTGCAGTGAGCAAGG - Intronic
1078659823 11:13277853-13277875 GGCGGCGGCGGCGGTGAGTCCGG - Exonic
1083209930 11:61176937-61176959 GGCGGAGGCTGCAGTGAGCCGGG - Intergenic
1083239196 11:61373910-61373932 GGCGGAGGCTGCAGTGAGCCAGG - Intergenic
1083268044 11:61556043-61556065 GGGAGGGGGGGCAGTGTGCAGGG + Intronic
1084151353 11:67289313-67289335 GGCGGCGGCGGCAGCGCGGGCGG - Exonic
1084547015 11:69819544-69819566 GGCGGCGGCCCCATTGTGCAGGG - Intergenic
1085054178 11:73394469-73394491 GGCGCTGGCGGCAGCCTGCAGGG - Exonic
1085214412 11:74815485-74815507 GGCGGAGGTTGCAGTGTGCCGGG + Intronic
1087045071 11:93837997-93838019 GGTGGGGGTGGGAGTGTGCAGGG + Intronic
1087785670 11:102351544-102351566 GGCGGAGGCTGCAGTGAGCCAGG + Intronic
1088522177 11:110712083-110712105 GGCTGCGGCGGCGGAGGGCACGG + Intronic
1088710871 11:112507408-112507430 GGAGGCAGAGGCAGAGTGCAGGG - Intergenic
1089025360 11:115264060-115264082 GGTGGAGGCAGCAGTCTGCAGGG - Intronic
1089492739 11:118894009-118894031 GGCGGCGGTGGCGGTAGGCATGG - Exonic
1089494870 11:118902814-118902836 GGCGGCGGCGGCAGTGGAGGTGG + Exonic
1089534051 11:119149805-119149827 GGGGGCGGGGGCAGAGTGCGGGG + Intronic
1090832356 11:130428266-130428288 GGCGGCGGGGGCGGGGAGCATGG + Exonic
1091178104 11:133579672-133579694 GGCGGCGCTGGCGGTGTGCGTGG - Intergenic
1092999376 12:13980966-13980988 GGCGGCAGCGTGAGTGTGCGCGG - Intergenic
1094496785 12:30993831-30993853 GGGGGAGGCGGCAGTGGGCAGGG + Exonic
1095957249 12:47813786-47813808 GGCAGCCTTGGCAGTGTGCAGGG + Intronic
1096372853 12:51083378-51083400 GGCGGCGGCGGCAGCGGGGGCGG - Exonic
1096606323 12:52768951-52768973 GGCGGCAGCGGCAGTGGCTATGG - Exonic
1097929632 12:65169842-65169864 GGCGGCGGCGGCCGCGGGGATGG + Exonic
1098564976 12:71924422-71924444 GGCGGAGGCTGCAGTGAGCCAGG - Exonic
1100187981 12:92158246-92158268 GGCGGTGGGGGCAGGGGGCAAGG - Intergenic
1101878035 12:108608311-108608333 GGGGGCGGGGGCAGTGAGGATGG - Intergenic
1102136886 12:110583022-110583044 GGCGGCGGCGGCGATGTTCTCGG - Exonic
1103118825 12:118362948-118362970 GGCGGAGGTGGCAGTGAGCCAGG + Intronic
1103393415 12:120590345-120590367 GGCGGAGGTTGCAGTGAGCAGGG - Intergenic
1103400643 12:120640907-120640929 GGCGGCGGCGGCGGCGAGCGGGG + Exonic
1103764639 12:123271574-123271596 GGCGGCGGCGGGCATGTGCGCGG + Exonic
1103800358 12:123533739-123533761 GGCGGCGGCGGCAGCGGGGAGGG + Intergenic
1104552842 12:129773253-129773275 GAGGGCGGCGGCAGTGAGCAAGG + Intronic
1104642547 12:130476616-130476638 GGCTGGGGCAGGAGTGTGCAAGG - Intronic
1104748354 12:131223516-131223538 GGTGGCGGTGGCAGTGGGGACGG + Intergenic
1104892063 12:132144824-132144846 AGAGGCGGCGGCAGGGTGCCCGG - Intronic
1104935996 12:132364778-132364800 GGGGGCGAGGGCAGTGTCCAGGG + Intergenic
1104936016 12:132364848-132364870 GGGGGCGAGGGCAGTGTCCAGGG + Intergenic
1104936027 12:132364883-132364905 GGGGGCGAGGGCAGTGTCCAGGG + Intergenic
1104936037 12:132364918-132364940 GGGGGCGAGGGCAGTGTCCAGGG + Intergenic
1104936047 12:132364953-132364975 GGGGGCGAGGGCAGTGTCCAGGG + Intergenic
1104936057 12:132364988-132365010 GGGGGCGAGGGCAGTGTCCAGGG + Intergenic
1104936067 12:132365023-132365045 GGGGGCGAGGGCAGTGTCCAGGG + Intergenic
1104936077 12:132365058-132365080 GGGGGCGAGGGCAGTGTCCAGGG + Intergenic
1104936088 12:132365093-132365115 GGGGGCGAGGGCAGTGTCCAGGG + Intergenic
1104957058 12:132472072-132472094 GGCGGGGGCAGCACTCTGCAAGG + Intergenic
1104983305 12:132583360-132583382 GGCGGGGGCGGCAGCGGGGAAGG - Exonic
1105512409 13:21061470-21061492 GGCGGCGGCGGTGGCGTGGACGG + Exonic
1106100587 13:26692412-26692434 GGCGGAGGTTGCAGTGAGCACGG + Intergenic
1107495810 13:40924533-40924555 GGCGGAGGTTGCAGTGAGCAAGG + Intergenic
1107719791 13:43236007-43236029 GGATGTGCCGGCAGTGTGCATGG - Intronic
1107770893 13:43786809-43786831 GGCGGCGGCAGCAGAGGGAACGG - Exonic
1108689271 13:52847309-52847331 GGCGGCGGCGGCAGCGGCGAAGG + Exonic
1108727782 13:53201087-53201109 GGCGGCGGCGGCAGCGGCGAAGG - Intergenic
1109873231 13:68364932-68364954 GGCGGAGCCTGCAGTGAGCAGGG - Intergenic
1110558509 13:76886250-76886272 GGCGGCGGCGGCGGGGCGCAGGG - Exonic
1112091796 13:96090805-96090827 GGCGGCGGCGGCAGGGCGGACGG - Intergenic
1112216257 13:97434109-97434131 GGCGGCGGCGGCGGCGGGCGGGG + Intergenic
1112507821 13:99985481-99985503 GGCGGCGGCCGCGGTGTCCGCGG + Exonic
1113655656 13:112066827-112066849 GGCGGCGGCGGTGATTTGCATGG - Intergenic
1113976964 13:114234978-114235000 GGCGGCGGCGGCTGCAGGCACGG + Exonic
1113983901 13:114298469-114298491 GGCGGAGGCTGCAGTGAGCCGGG + Intronic
1114073455 14:19132955-19132977 GGCGGCGGCGGCAGCGAGTTCGG - Intergenic
1114088810 14:19267028-19267050 GGCGGCGGCGGCAGCGAGTTCGG + Intergenic
1114826746 14:26090118-26090140 AGGGGCAGCGGCAGTGGGCAGGG - Intergenic
1114886976 14:26864790-26864812 GGCAGAGGCTGCAGTGTGCGGGG + Intergenic
1115976654 14:39004215-39004237 GGCGGCAGGGGTGGTGTGCAGGG + Intergenic
1116657972 14:47674992-47675014 GGCGGCGGCGGCGGCGCGCTGGG + Intergenic
1118323090 14:64764738-64764760 GCAGGCGGGGGCAGGGTGCAGGG + Intronic
1119390244 14:74286851-74286873 AGCAGCGGCGGCAGAGGGCAGGG - Intronic
1119393786 14:74310604-74310626 GGCGGAGGCTGCAGTGAGCCGGG - Intronic
1121320483 14:92988959-92988981 GGTGGCGGTGGCAATGGGCAGGG + Intronic
1121835636 14:97089785-97089807 GGCGGAGGCTGCAGTGAGCTGGG - Intergenic
1122736668 14:103847508-103847530 GGCGGCGGCGGCCGGGTGCCCGG - Exonic
1123074883 14:105663098-105663120 GGAGGCGGGGGGCGTGTGCAGGG + Intergenic
1123486139 15:20740882-20740904 GGTGGCGGTTGCAGTGAGCAGGG + Intergenic
1123542632 15:21309951-21309973 GGTGGCGGTTGCAGTGAGCAGGG + Intergenic
1124995811 15:34722067-34722089 GCCGGCGGAGGCAGCGTGCAGGG + Intergenic
1125533608 15:40429611-40429633 GGGGGCGGGGGCAGGCTGCAGGG + Intronic
1125814658 15:42574715-42574737 GGCGGAGGCTGCAGTGAGCCTGG - Intergenic
1125829418 15:42703430-42703452 GGCGGAGGCTGCAGTGGGCAGGG - Intronic
1126045919 15:44639631-44639653 GGCGGAGGCTGCAGTGAGCCAGG + Intronic
1127117575 15:55743155-55743177 GGCGGCGGCTGCAGAGGGCGGGG + Intergenic
1127144086 15:56007199-56007221 GGCGGCGGCGGCGGTGGCGATGG + Intergenic
1128280017 15:66386952-66386974 GGCGGCGGCGGCACTTTCCCCGG + Exonic
1128737738 15:70062811-70062833 GGCAGAGGCAGCAGTGGGCAGGG - Intronic
1129070453 15:72946290-72946312 GGCAGCAGCAGCAGTGGGCAGGG - Intergenic
1130115304 15:81000960-81000982 GGCGGCGGCGGCGGCGAGCCCGG + Exonic
1130520558 15:84658078-84658100 GGCGACGCCGGCAGCGAGCAGGG + Exonic
1130564492 15:84981959-84981981 GGCGGCGGCTGCGGTGGGAAGGG - Exonic
1131098630 15:89671432-89671454 GGCGGTGACGACAGAGTGCAGGG + Intronic
1131263747 15:90903449-90903471 GGCGGTGGCGGCGGGGGGCACGG + Intronic
1131367723 15:91853894-91853916 GGCGGCGGGGGAAGGATGCAGGG + Exonic
1132368656 15:101277414-101277436 GGCGGCGGCGGCGGCGGTCATGG - Exonic
1202950948 15_KI270727v1_random:37092-37114 GGTGGCGGTTGCAGTGAGCAGGG + Intergenic
1132641882 16:981793-981815 GGCGGCGGCGGCAGGGGCGAGGG + Exonic
1132802948 16:1763149-1763171 GGAGGGGCAGGCAGTGTGCAGGG - Intronic
1132812486 16:1808066-1808088 GGCGGCTGCAGCATTGTGAATGG + Exonic
1132975062 16:2706900-2706922 GGTGGGGGCTGCAGTGGGCATGG + Intronic
1133229677 16:4360620-4360642 GGCGGCGCCAGCAGTGAGGAGGG - Intronic
1133397654 16:5461307-5461329 GGCAGAGGCGGCAGAGTGCGGGG - Intergenic
1134441533 16:14302129-14302151 GGCGGCGGCGGCAGCGGCCCAGG - Intergenic
1134869513 16:17639032-17639054 GGCGGAGGCTGCAGTGAGCCGGG - Intergenic
1136533971 16:30888403-30888425 GGCGGAGGCTGCAGTGAGCCAGG - Intronic
1137426571 16:48385376-48385398 GGCGGCGGCGGCGGCGGCCAGGG - Intronic
1137531526 16:49281562-49281584 GGCGGCGGCGGAGCTGCGCACGG - Exonic
1137617791 16:49857313-49857335 GGCGGCGGCGGCGGCAGGCACGG + Intronic
1138288017 16:55824643-55824665 GCCGGCGCCTGCAGTGTGCTGGG - Intronic
1138379425 16:56589950-56589972 GGGGGCGGCGGCAGAGGGGAAGG - Intronic
1138605826 16:58088211-58088233 GGCGGCGGCGGGAGGGGGAAGGG + Intergenic
1140805591 16:78529533-78529555 GGCGGAGGTTGCAGTGAGCAGGG - Intronic
1141079184 16:81035888-81035910 GGCGGCGGCGGCGGGGTCCGCGG + Exonic
1141079303 16:81036302-81036324 AGCGGCAGCGGCAGCGCGCAGGG - Intronic
1141427411 16:83953174-83953196 GGCGGCGCAGGCAGTGGGCGGGG - Intronic
1141557846 16:84847580-84847602 GGCGGAGGCTGCAGTGAGCCAGG + Intronic
1141828981 16:86498978-86499000 GGCGGCGGCGGGAGGGTGCCAGG - Intergenic
1142799712 17:2337554-2337576 GGCGGCGGCGGCGGCGGGCCGGG + Exonic
1142848023 17:2691490-2691512 GGCGGAGGCTGCAGTGAGCCGGG + Intronic
1142958305 17:3535640-3535662 GGCGCCGGCGGCGATGAGCAGGG + Exonic
1142993772 17:3749023-3749045 GGCTGTGGCAGCAGTGTCCAGGG + Intronic
1143494980 17:7307673-7307695 GGCGGCGGCGGCAGCGGGCTCGG + Intronic
1143527219 17:7479591-7479613 GGCGGCGGCGGCAGCGGGGCCGG - Intronic
1144682746 17:17206238-17206260 GGCCGCGGCGGCTGTGGGCCTGG - Exonic
1145218975 17:21073148-21073170 GCTGGAGGTGGCAGTGTGCAGGG - Intergenic
1145307525 17:21683615-21683637 GGCGGCGGCGGCTGGATCCAGGG + Intergenic
1145307756 17:21684780-21684802 GGCGGCGGCGGCTGGATCCAGGG + Intergenic
1146492829 17:33294246-33294268 GGTGGTGGAGGCAGTGTGAAGGG + Intronic
1147110437 17:38257346-38257368 GGTGGCGGCGGCTGCGTGCGCGG + Intergenic
1147350212 17:39836273-39836295 GGCAGCAGCAGCAGTGTCCAGGG - Intronic
1147997387 17:44368223-44368245 GGCGGAGGCTGCAGTGAGCCAGG - Intergenic
1148105214 17:45115158-45115180 GGCGTTGGGGGCAGGGTGCAGGG + Exonic
1148419069 17:47531085-47531107 GGTGGCGGCGGCTGCGTGCGCGG - Exonic
1148514166 17:48200443-48200465 GGCGGAGGTTGCAGTGAGCAGGG - Intronic
1148603070 17:48908644-48908666 GGCGGCGGCGGCAGCGGGCGGGG + Exonic
1148775156 17:50091084-50091106 GGCAGAGGTGGCAGTGTGCAGGG + Intergenic
1149342023 17:55697418-55697440 GGCAGAGGTTGCAGTGTGCAGGG - Intergenic
1150130464 17:62666288-62666310 GGGGGCGGGGGCAGTGTTCCTGG + Intronic
1150326685 17:64263322-64263344 GGCGGCGGCGGCCGCGGGCGCGG - Intergenic
1151755330 17:76072436-76072458 GGCGGCGGCGGCAGTGGCGGCGG - Exonic
1151792640 17:76318379-76318401 GGCGGAGGTGGCAGTGAGCTGGG + Intronic
1152075524 17:78157335-78157357 GGCGGCGGCGGCGGTGGGCTCGG + Intronic
1152145471 17:78565879-78565901 GGCGGAGGTTGCAGTGTGCTGGG + Intronic
1152231669 17:79117065-79117087 GGCGGAGGCGGCAGAGGGAAAGG + Intronic
1152321408 17:79610424-79610446 GGCGGCGGCGGCACAATGCCCGG - Intergenic
1152433106 17:80260513-80260535 GCCGGCGGCGGCGGCGGGCAGGG + Intergenic
1152433120 17:80260543-80260565 GGCGGCGGCGGCGGCGGGCAGGG + Intergenic
1152433133 17:80260573-80260595 GGCGGCGGCGGCGGCGGGCAGGG + Intergenic
1152433146 17:80260603-80260625 GGCGGCGGCGGCGGCGGGCAGGG + Intergenic
1152433159 17:80260633-80260655 GGCGGCGGCGGCGGCGGGCAGGG + Intergenic
1152433172 17:80260663-80260685 GGCGGCGGCGGCGGCGGGCAGGG + Intergenic
1152433185 17:80260693-80260715 GGCGGCGGCGGCGGCGGGCAGGG + Intergenic
1152433198 17:80260723-80260745 GGCGGCGGCGGCGGCGGGCAGGG + Intergenic
1152433211 17:80260753-80260775 GGCGGCGGCGGCGGCGGGCAGGG + Intergenic
1152433224 17:80260783-80260805 GGCGGCGGCGGCGGCGGGCAGGG + Intergenic
1152433237 17:80260813-80260835 GGCGGCGGCGGCGGCGGGCAGGG + Intergenic
1152551979 17:81034709-81034731 GGCGCCGGCGGCAGCGCGCGTGG - Intergenic
1153515264 18:5895708-5895730 GGCGGCGGAGGCAGCCGGCACGG + Intronic
1154192318 18:12241116-12241138 GGCGGAGGCTGCAGTGAGCCTGG - Intergenic
1155392721 18:25352308-25352330 GGCGGCGGCGGCGGCGGGCGGGG - Intergenic
1157359161 18:46962892-46962914 GGCGACGGCGGCAGCGTGAGCGG - Exonic
1157360155 18:46968819-46968841 GGCGACGGCGGCAGCGTGAGCGG - Exonic
1157360756 18:47022411-47022433 GGCGACGGCGGCAGCGTGAGCGG - Exonic
1157361745 18:47028326-47028348 GGCGACGGCGGCAGCGTGAGCGG - Exonic
1157689789 18:49671926-49671948 GGCGGGGGCGGGGGTGGGCATGG + Intergenic
1157826874 18:50820118-50820140 CACGGCGGCGGCTTTGTGCAGGG - Intronic
1159040578 18:63320041-63320063 GGCGGCGGCGGCAGCGCGGCGGG + Exonic
1160690970 19:460628-460650 GGCGGCGGCGGCGGCGTCCCCGG + Exonic
1160744419 19:704023-704045 GGGGGCGGGGCCAATGTGCAGGG + Intergenic
1160788711 19:913077-913099 GGCGGCGGCTGCTGTGAGCGCGG - Exonic
1160877509 19:1303986-1304008 GGCGGAGGCTGCAGTGAGCCGGG - Intergenic
1160880937 19:1319827-1319849 GGCAGAGGTGGCAGTGAGCAGGG - Intergenic
1160908523 19:1463512-1463534 GGCGGAGGTTGCAGTGTGCCAGG + Intronic
1160948030 19:1652412-1652434 GGCGGCGGCGGCGGCGCGCGTGG + Intronic
1161537539 19:4829407-4829429 GGTGGAGGTGGCAGTGGGCAGGG - Intronic
1161566604 19:5006097-5006119 GGTGGCGGCGGCAGGGAGCCAGG + Intronic
1161684487 19:5696173-5696195 GGGGGCGGCGGCAAGGTGCTGGG + Intronic
1161703242 19:5805934-5805956 GGCGGCGGCGGCGGCGAGCAGGG - Intergenic
1162470941 19:10871711-10871733 GGCGGCGGCGGCGGTGGGGCCGG + Exonic
1162751753 19:12833839-12833861 GGCGGCGGCGGCTGAGGGGAGGG - Intronic
1162778629 19:12995509-12995531 GGCGGCGGCGGCGGCGGGCGAGG + Intergenic
1162875024 19:13614759-13614781 GGTGGAGGCTGCAGTGAGCAGGG + Intronic
1162954498 19:14090775-14090797 GGCGGCGGCGGCGGCGGGGAGGG - Intronic
1163320575 19:16572340-16572362 GGCGGCGGCCGCGGTGGGCGCGG - Exonic
1163373611 19:16916302-16916324 GGCAGAGGCTGCAGTGAGCATGG - Intronic
1163636015 19:18437524-18437546 GGCGGGGGCGGGAGCCTGCAGGG - Intronic
1165241306 19:34470589-34470611 GGCGGAGGCTGCAGTGAGCCAGG - Exonic
1166100794 19:40570424-40570446 GGCAGCGACGGCTGTGTGAAGGG - Exonic
1166166259 19:40991267-40991289 GGAGGCTGCAGCAGGGTGCAGGG + Intergenic
1166295001 19:41884559-41884581 GGGGGACGTGGCAGTGTGCACGG - Intronic
1166702656 19:44891234-44891256 GGCGGCGGCGGCAGCGGGTTCGG + Exonic
1167001055 19:46746074-46746096 GGCGGCGGCGGCAGCGGGTGAGG + Exonic
1167457060 19:49601801-49601823 GGAGACGGCGGCAGTGTGTGGGG + Exonic
926131010 2:10303102-10303124 GGCGGCGGCTGCAGCGGGCCCGG - Intronic
926217108 2:10912373-10912395 GGCGGCGGCTGCAGGGGGCGCGG + Exonic
927695610 2:25237694-25237716 GGCGGAGGCTGCAGTGAGCCAGG + Intronic
927939460 2:27094631-27094653 GGCGGCGGCAGCAGCTGGCAAGG - Intronic
928983213 2:37156898-37156920 GGCGGCGGCGCAGGTGAGCAGGG - Exonic
929057479 2:37890978-37891000 GGCTGAGGCAGCAGTGTCCAGGG + Intergenic
929209970 2:39345272-39345294 GGAGGCTGAGGCAGGGTGCAGGG + Intronic
929452309 2:42046334-42046356 GGCCGTGGCTGCAGTCTGCAGGG - Intergenic
929701842 2:44169098-44169120 GGCGGCGGCGGCGGCGTGAGGGG + Exonic
930717463 2:54606292-54606314 GGTGGAGGCGACAGTGTGGATGG - Intronic
931559872 2:63549179-63549201 GGCGGAGGCTGCAGTGAGCCAGG + Intronic
931747259 2:65301086-65301108 GGCGGCGGCAGCAGACAGCAGGG + Intergenic
932152582 2:69386962-69386984 GGCGGAAGCGGGAGTGTGGAGGG - Intronic
932405287 2:71508919-71508941 GGCGGAGGCTGCAGTGAGCCAGG - Intronic
933684719 2:85133715-85133737 GGCGGCGGCGGCAGCGGGGGAGG + Exonic
933898173 2:86830130-86830152 GGCTGAGGCTGCAGTGTGCCAGG - Intronic
935592606 2:104855809-104855831 GGCGGCGGCGGCGTGGGGCAGGG - Exonic
935982263 2:108638972-108638994 GGCGGAGCCTGCAGTGAGCATGG + Intronic
936278667 2:111120580-111120602 GGCGGCGGCCGCGGCGTGCGCGG - Intronic
937238204 2:120443122-120443144 GGCGGGGCCGGCAGTGGGCCTGG - Intergenic
938487391 2:131724344-131724366 GGCGGCGGCGGCAGCGGGTTCGG - Intronic
939629758 2:144517165-144517187 GGCGGCGGCGGCGGCGCCCAGGG - Intronic
940230796 2:151449518-151449540 GGTGGAGGCTGTAGTGTGCATGG - Intronic
940234438 2:151494715-151494737 GGCGGAGGTTGCAGTGAGCAGGG - Intronic
941385879 2:164851490-164851512 GGAGGAGGCTGCAGTGAGCAGGG - Intergenic
941666421 2:168247539-168247561 GGCGGCGGCGGCGGCGGGCGGGG - Exonic
941905992 2:170716451-170716473 TGCGGGGGCGGCAGTGCGCCTGG - Exonic
942418885 2:175787177-175787199 GGAGGGGGTGGCAGGGTGCAGGG + Intergenic
942450904 2:176107590-176107612 GGCGGCGGCGGCAGCGCGGGGGG + Exonic
942454827 2:176130420-176130442 GGCGGCGGCGGCGGCGGGCGAGG + Exonic
942748642 2:179264392-179264414 GGCGGCGGCGGTAGCGGGCCCGG - Intronic
942890496 2:180981015-180981037 GGCGGCGGCGGCGGTGGGGGAGG + Intronic
944219788 2:197291439-197291461 GGCGGAGGCTGCAGTGAGCTGGG + Intronic
944244237 2:197515769-197515791 GACCGCTGCGGCAGTGTGCACGG - Intronic
944412445 2:199457730-199457752 GGCGGCGGCGGCGGCGAGCCGGG + Exonic
945314454 2:208356583-208356605 GGCGGAGGCTGCAGTGAGCTGGG + Exonic
945673760 2:212832129-212832151 GGCGGCGGAGGCAGGGCGCGCGG - Intergenic
946395529 2:219442102-219442124 GGCGGCGCCGGGAGGGGGCAGGG + Intronic
948046906 2:234952047-234952069 GGCGGCGGCGGTAGTGGCGAGGG - Intronic
948140473 2:235669493-235669515 GGCGGCGGCGGCGGCGAGCGCGG - Intronic
948455963 2:238104793-238104815 ACGGGCGGCGGCAGCGTGCAGGG - Exonic
1168883249 20:1225629-1225651 GGCGGCGGCGGCTGGGGGTACGG - Intergenic
1169278452 20:4248785-4248807 GGCGGCGGCGGCGGCGTGGTGGG - Exonic
1170682942 20:18543070-18543092 GGAGGCTGCGGCAGTGTTGATGG + Exonic
1170889968 20:20368415-20368437 GGCGGCGGCGGCAGCGGCCCGGG - Exonic
1171981767 20:31633553-31633575 GGCGGGGGCGGAAGAGGGCAGGG + Intergenic
1172083216 20:32358677-32358699 GGCGGCGGCGGCGGTGGGGGGGG - Exonic
1172774718 20:37400305-37400327 GGCGGCCGGGGCAGGGGGCAGGG + Intronic
1173855865 20:46250538-46250560 GGCAGTGGCAGGAGTGTGCATGG + Intronic
1174352371 20:49977743-49977765 GGCGGTGGTTGCAGTGAGCAGGG + Intergenic
1174494612 20:50930911-50930933 GGCGGTGGCGGCAGCGGGGAGGG + Exonic
1174494736 20:50931320-50931342 GGCGGCGGCGGCAACGGGCGGGG + Intergenic
1174759348 20:53191592-53191614 GGCGGAGGCTGCAGTGAGCTGGG + Intronic
1175508754 20:59506797-59506819 GGCGGAGGCTGCAGTGAGCCAGG - Intergenic
1175517287 20:59577579-59577601 GGCGGCGGCGGCAGCGTCCCGGG - Intronic
1176062253 20:63177609-63177631 GGCGGCGGCGGCGGCGGGCGCGG + Intergenic
1176068933 20:63216057-63216079 GGCGGCAGCGGCGGTGAGCCCGG + Exonic
1176207104 20:63895184-63895206 GGCGGCGGCGGCAGAGGGCGCGG - Exonic
1176234560 20:64048419-64048441 GGCGGCGGCGACAGCGGGCCGGG + Exonic
1176418978 21:6499195-6499217 GGCGTCGGCAGCAGTGTCGACGG - Intergenic
1176549738 21:8216040-8216062 GGCGGCGGCGGGGGTGTGTGGGG + Intergenic
1176557629 21:8260269-8260291 GGCGGCGGCGGGGGTGTGTGGGG + Intergenic
1176568663 21:8399074-8399096 GGCGGCGGCGGGGGTGTGTGGGG + Intergenic
1178085474 21:29107244-29107266 GGCGGAGGTTGCAGTGAGCAGGG + Intronic
1178401168 21:32285969-32285991 GGCGGAGGCTGCAGTGAGCCAGG + Intergenic
1179585643 21:42372489-42372511 AGCGGAGGCTGCAGTGAGCAGGG + Exonic
1179635300 21:42704755-42704777 GGGGGTGGGGGCAGGGTGCAGGG + Intronic
1179694471 21:43107517-43107539 GGCGTCGGCAGCAGTGTCGACGG - Exonic
1180491897 22:15855308-15855330 GGCGGCGGCGGCAGCGAGTTCGG - Intergenic
1180559879 22:16607759-16607781 GGCGGCGGCTGCAGTGAGCCAGG - Intergenic
1180949416 22:19714473-19714495 GGCGGCGGCGGCGGCGCGGAGGG + Exonic
1180961932 22:19766176-19766198 GGCGGCGGCGGCGGCGGGCGGGG - Intronic
1181006744 22:20017041-20017063 GGCGGCGGTGGCAGGGTACGCGG + Intronic
1181092198 22:20481502-20481524 GGCGGAGGTTGCAGTGAGCAGGG + Intronic
1181299184 22:21867413-21867435 GGCGGCGGCGGCGGCGGGCGCGG - Exonic
1182020807 22:27080172-27080194 GGGGGAGGCAGCACTGTGCATGG - Intergenic
1182370995 22:29810797-29810819 GGCGGAGGTTGCAGTGAGCAGGG - Intronic
1182442597 22:30372947-30372969 GGCGGCTGTGACAGTTTGCAAGG - Intronic
1182532305 22:30969635-30969657 GGCGGCGGCGGCAGCGGCCGCGG + Intergenic
1182844420 22:33418710-33418732 GGAGGCGGCTGGAGTGAGCAGGG + Intronic
1183479780 22:38057179-38057201 GGCGGCGGCGGCAGGGCAAAGGG + Exonic
1183856206 22:40636669-40636691 GCCGGCGGCGGCAGTGTCTGTGG - Exonic
1184412232 22:44331882-44331904 GGCGGCGGCGGCGGCGGGCGCGG - Intergenic
1184412245 22:44331925-44331947 GGCGGCGGCGGCGGCGAGCGCGG - Intergenic
1184617594 22:45648583-45648605 GGCGGCGTCGGAAGTGGTCAGGG - Intergenic
1185335797 22:50270387-50270409 GGCGGCGGCGGCGGCGGGCGGGG + Exonic
1185418209 22:50721222-50721244 GTCGGCGTCGGGACTGTGCACGG - Intergenic
950124956 3:10505317-10505339 GGTGGCGGTGGCAGCGTGGAGGG - Intronic
950383085 3:12634213-12634235 GGCGGAGGCTGCAGTGAGCAAGG - Intronic
950517843 3:13479440-13479462 CGCGGGGGCGGCTGTGTGCCAGG - Intergenic
950549762 3:13659071-13659093 GGTGGAGGTGGCAGTGTGGATGG + Intergenic
952230179 3:31421188-31421210 GGCGGAGGCTGCAGTGAGCTGGG + Intergenic
954002184 3:47566401-47566423 GGCGGCTGTAGCAGTGAGCAGGG + Intronic
954088369 3:48265038-48265060 GGCGGAGGTTGCAGTGAGCAGGG - Intronic
954777393 3:53032299-53032321 GGCGGAGGCTGCAGTGAGCCGGG + Intronic
955768565 3:62369056-62369078 GGCGGCGGCGGCAGCGAGCTCGG + Intergenic
955996900 3:64687564-64687586 CGCCGCGGCGGCCGTGCGCAAGG - Exonic
958764045 3:98343414-98343436 GGCGGAGGCTGCAGTGAGCCAGG + Intergenic
959530728 3:107431531-107431553 GGCGGCGGCGGCGGTGACCGTGG - Intergenic
959539401 3:107523236-107523258 GGCGGCGGCGGCAGCCGGTAGGG + Intronic
960328979 3:116333463-116333485 GGCGGAGGTTGCAGTGAGCAAGG + Intronic
961735931 3:129002159-129002181 GGCGGCGGCGGCGGCGCGGACGG - Exonic
961894256 3:130154180-130154202 GGCGGAGGTGGCAGTGAGCCAGG + Intergenic
962564034 3:136638831-136638853 GGCGGAGGCTGCAGTGAGCCAGG + Intronic
962775919 3:138659446-138659468 GGCGGAGGCTGCAGTGAGCCGGG + Intronic
962793996 3:138835022-138835044 GGCGGCGGCGGCAGTTGGGCTGG + Intergenic
963140033 3:141939349-141939371 GGCGGAGGCTGCAGTGAGCCAGG + Intergenic
963256170 3:143147053-143147075 GGCTGCTGTGGCAGGGTGCAAGG + Intergenic
963882192 3:150540702-150540724 GGCGGAGGTTGCAGTGTGCCAGG - Intergenic
967274506 3:187760722-187760744 GGCGGAGGTTGCAGTGAGCAGGG + Intergenic
967930428 3:194686775-194686797 GGCGGCGGCGGCGGAGCGCCGGG - Exonic
968440283 4:620306-620328 AGCGGTGGCCGCAGTTTGCAGGG + Intergenic
968621273 4:1604447-1604469 GGAGGGGGCCTCAGTGTGCAGGG + Intergenic
968659645 4:1793715-1793737 GGCGGCGGCGGCGGCGGGCGGGG + Intronic
968732040 4:2273806-2273828 GGCGGCGGGGGCAGTGGGGTGGG - Intronic
969948273 4:10806990-10807012 GGCTGCTGCTGTAGTGTGCATGG + Intergenic
970456173 4:16226399-16226421 GGCGGCGGTGGCGGCGTGGACGG - Exonic
971402732 4:26291643-26291665 GGCGGAGGTTGCAGTGAGCAGGG - Intronic
971570005 4:28199329-28199351 GGCGGAGGCGGCAGTGAGCTGGG + Intergenic
971815667 4:31485037-31485059 GGCGGAGGTGGCAGTGAGCTGGG - Intergenic
972765940 4:42152272-42152294 GGCGGCGGCGGCGGCGGCCACGG - Exonic
973839855 4:54850269-54850291 GGCGGAGGCTGCAGTGAGCCGGG + Intergenic
975166903 4:71187318-71187340 GGCGGCGGCGGCAGTGGCAGTGG + Exonic
975783380 4:77862851-77862873 GGCGGCGGCCGTAAGGTGCATGG + Exonic
977418392 4:96764317-96764339 GGCTGCAGCGGCAGTTGGCAGGG + Intergenic
978515041 4:109560410-109560432 GGCGGAGGCGGCAGCGGCCACGG - Exonic
979588209 4:122445894-122445916 GGAAGCGGCGGCTGTGGGCACGG - Intergenic
981182688 4:141764175-141764197 GGCGGAGGCTGCAGTGAGCCGGG + Intergenic
983416097 4:167456802-167456824 GGCGGCGGCGGCGGTGGTGATGG + Intergenic
983940282 4:173529552-173529574 GGCGGCGGCGGCGGCGGCCAGGG - Exonic
985653980 5:1120444-1120466 CGCGCCGTCGGCAGTGTGCCGGG + Intergenic
985732440 5:1556725-1556747 GGCGGCGGCGGCAGAGGGAACGG + Intergenic
986036397 5:3944513-3944535 GGCGGAGATGGCAGTGTGCCAGG - Intergenic
989571613 5:42951175-42951197 GGCGGCGGCGGCGCTGGGCTGGG - Intergenic
989576461 5:42992670-42992692 GGCGGCGGCGGCGCTGGGCTAGG + Intergenic
989651186 5:43692390-43692412 GGCGGAGGTGGCAGTGAGCTGGG - Intronic
990955057 5:61332425-61332447 GGCGGCGGCGGCGGCGTGCGGGG + Exonic
992528112 5:77630706-77630728 GGCGTGGGCAGCAGTGTGCCGGG + Exonic
992684277 5:79184533-79184555 GGCAGAGGCTGCAGTGTTCACGG + Intronic
992905860 5:81345097-81345119 GGAGGTGGCAGCGGTGTGCAAGG - Intronic
994072823 5:95620837-95620859 GGCGGCGGCGGCAGCGGCGAGGG - Exonic
995313478 5:110739369-110739391 GGCGGCGGCGGCAGTGTGCAGGG + Exonic
995650566 5:114363058-114363080 GGCGGTGGCGGGAGCGGGCACGG + Exonic
998200483 5:140114296-140114318 GGCGGCGGCGGCAGTGGCGGCGG + Exonic
1002031836 5:176435502-176435524 GGCGGAGGCTGCAGTGAGCTAGG - Intergenic
1002156726 5:177287565-177287587 GGCGGAGGCTGCAGTGAGCCGGG + Intronic
1002524239 5:179806670-179806692 GGCGGCGGCGGCAGGGGCCCCGG + Intronic
1002960187 6:1906929-1906951 GGAGGCTGGGGCTGTGTGCAGGG - Intronic
1003624088 6:7727044-7727066 GGCGGCCGCGGCAGCGGGCAAGG - Exonic
1004690347 6:17987692-17987714 GGCGGCGGCGGCGGCGGGCGGGG + Intergenic
1005826719 6:29636440-29636462 GGAGGCGGCAGCAGTGGACAAGG + Intergenic
1006089683 6:31620931-31620953 GGCGGCGGCGGTGGTGGGCCGGG + Intronic
1006142757 6:31940597-31940619 GGGGGAGGGGGCAGTGTGAATGG - Intronic
1006304109 6:33208612-33208634 GGCGGCGGCGGGAGCGCGAACGG + Exonic
1007039885 6:38711951-38711973 GGTTGGGGCGGCAGGGTGCAGGG - Intergenic
1007226952 6:40321800-40321822 GGCGGCGGCGGGCGTGGGGATGG - Intergenic
1007432877 6:41786633-41786655 GGCGGCGGCGGCGGCGCGCACGG + Intronic
1007557820 6:42782020-42782042 GGCGGCGGCGGCGGCGGGCGCGG - Exonic
1007600141 6:43076281-43076303 GGCGGCGGCGGCGGCGCGCGGGG + Intronic
1007759875 6:44127550-44127572 GGCGGCCGCGGCAGTGTATGGGG - Intronic
1008160347 6:48068718-48068740 GGAGGCGGCGGCGGTGGGGAGGG - Intergenic
1008375636 6:50787902-50787924 GGAGGCTGCGGAAGTGTCCAGGG + Intergenic
1009922481 6:70079433-70079455 GGGTGAGGGGGCAGTGTGCAAGG + Intronic
1011075181 6:83431057-83431079 GGCGGCGGCCGCACTGGGAAAGG + Exonic
1011416252 6:87122770-87122792 GGCGGCGGCGGCGGCGGGCCTGG + Intergenic
1013117564 6:107114738-107114760 GGCGGCGGCGGCGGCGCGGACGG + Intronic
1013225750 6:108118505-108118527 GGCTGCGGGGGCCGTGGGCAGGG + Intronic
1013249998 6:108324627-108324649 GGCGGTGTCGGCAGAATGCAGGG - Intronic
1013391662 6:109691434-109691456 GGGGGCGGCGGCCGTGGGCATGG - Exonic
1013836913 6:114343618-114343640 GGCGGCGGCCGCGGCGTGCTTGG + Intergenic
1014225492 6:118841901-118841923 GGCGGAGGCTGCAGTGAGCTGGG - Intronic
1014246827 6:119078540-119078562 GGCGGCGGCGGCCGGGGGCCGGG + Exonic
1015313845 6:131794783-131794805 GGCGGAGGTTGCAGTGAGCAAGG - Intergenic
1016010761 6:139135528-139135550 GGCGGCGGCGGCCGGTTGCGGGG + Exonic
1016028206 6:139310761-139310783 GGCGGAGGTTGCAGTGTGCTGGG - Intergenic
1017672398 6:156779256-156779278 GGCGGCGGCGGCGGCGCGCTGGG - Exonic
1019524731 7:1475861-1475883 GGCGGAGGCCACAGTGTACATGG - Intronic
1019526612 7:1483262-1483284 GGCTGCGGCCGCAGAGGGCACGG + Intronic
1019987292 7:4666995-4667017 GGCGGAGGCTGCAGTGAGCCAGG - Intergenic
1020727334 7:11832129-11832151 GGCGGCGGCGGCAGCGGCCACGG - Exonic
1021492158 7:21230959-21230981 GGCGGAGGTTGCAGTGAGCAGGG - Intergenic
1022098391 7:27154972-27154994 AGTGGCGGCGGCAGAGGGCACGG + Exonic
1022101086 7:27169588-27169610 GGCGGCGGCGGCGGCGGGCGAGG - Intronic
1023382681 7:39623874-39623896 GGCGGCGGCGGGGGTGTGTCCGG + Intronic
1023638806 7:42237968-42237990 GGCGGCGGCGGCGGAGGGCGGGG - Intergenic
1023773687 7:43583331-43583353 GGCGGCGGCGGCGGCCGGCACGG - Exonic
1026872118 7:73859233-73859255 GGCGGCTCAAGCAGTGTGCATGG - Intergenic
1027762478 7:82297180-82297202 GGCTGAGGCTGCAGTGAGCAAGG + Intronic
1028922342 7:96322040-96322062 GGCGGCGGCGGCGGTGGGGGCGG + Exonic
1029415345 7:100439493-100439515 GGCGGCGGTTGCAGTGAGCCAGG + Intergenic
1029456206 7:100673809-100673831 GGCGGCGGCGGCGGCGCGGATGG - Exonic
1032068787 7:128791475-128791497 GGCGGCGGCGGGAGCGGTCATGG + Intronic
1032205757 7:129863871-129863893 GGCGGAGGTTGCAGTGAGCAAGG - Intronic
1032335187 7:131018437-131018459 GGGGGCAGCGGGAGTGTGCTGGG - Intergenic
1032391233 7:131556579-131556601 GGCGGCGGCGGCTGCGTCCTGGG + Exonic
1032581190 7:133105124-133105146 GGTGGAGGGGGCAGTGTGGAGGG - Intergenic
1033099832 7:138460575-138460597 GGCGGCGGCGGCAGCGGCCTCGG + Exonic
1033159203 7:138981572-138981594 GGCGGCCGGGGCAGCGTGCGCGG + Intergenic
1033210274 7:139455085-139455107 GGCGGAGGCTGCAGTGAGCCAGG - Intronic
1033253184 7:139777799-139777821 GGCGGCGGCGGCGGCGCGCCCGG - Intronic
1033499469 7:141933456-141933478 GGCAGAGGCGGCACTGTGCAAGG + Intronic
1033656919 7:143381097-143381119 GGCGGGGGCGGCAGTGAGTGGGG + Exonic
1034147252 7:148884205-148884227 GGCGGCGGCGGCGGCGCGCGGGG - Exonic
1034148242 7:148891404-148891426 GGCGGAGGCTGCAGTGAGCCAGG - Intergenic
1034306279 7:150047658-150047680 GGCGGCGGCGGCGGCGCGGATGG - Intergenic
1034719635 7:153278543-153278565 GGCGGAGGCTGCAGTGAGCCGGG + Intergenic
1035581039 8:738985-739007 GGCGGCGGCGGCGTCGCGCAGGG - Intergenic
1036157854 8:6359099-6359121 GGCAGAGGTGGCAGCGTGCAGGG - Intergenic
1036723752 8:11201194-11201216 GGCGGCGACGGCAGCGAGCCCGG - Exonic
1037801228 8:22037008-22037030 GGCCGCGGGGGCTGGGTGCAGGG - Intergenic
1038883663 8:31640284-31640306 GGCGGCGGCGGCGGCGGGCGAGG + Intronic
1039065835 8:33606782-33606804 GGCGGAGGTGGCAGTGAGCTGGG - Intergenic
1039098317 8:33911598-33911620 GGCGGAGGCTGCAGTGAGCCAGG + Intergenic
1039340340 8:36641902-36641924 GGCGGAGGCAGCAGTGAGCTGGG + Intergenic
1039542298 8:38382220-38382242 GGCGGCGGCGGCGGCCAGCACGG - Exonic
1040078847 8:43267760-43267782 GGCGGAGGCTGCGGTGGGCAGGG - Intergenic
1042040038 8:64580739-64580761 GGCGGCGGCGGCAGCGGGCGCGG + Exonic
1042671005 8:71263272-71263294 GGAGGCAGGGGCAGTGTGAATGG - Intronic
1044645584 8:94439691-94439713 GGCGGCGGGGGCGGTGTTCCAGG + Intronic
1045153882 8:99444165-99444187 GGCGGAGGCTGCAGTGAGCCGGG - Intronic
1046334009 8:112758281-112758303 GGTGGAGGCTGCAGTGAGCAGGG + Intronic
1046960126 8:120102594-120102616 GCCAGCAGTGGCAGTGTGCATGG + Intronic
1047349191 8:124056973-124056995 GGCGGAGGTTGCAGTGAGCAGGG + Intronic
1049615288 8:143573194-143573216 GGGGGCGGAGCCAGCGTGCAGGG - Intergenic
1049762274 8:144336903-144336925 GGCGGCGGCGGCGGCGGGCGGGG + Intergenic
1049788481 8:144462516-144462538 GGCGGCGGCGGCTCTGGGCGAGG - Intronic
1050137314 9:2479923-2479945 GGAGGCGGCGGCAGTGGGGGAGG + Intergenic
1052048535 9:23821703-23821725 GGCGGCGGCGGCGGCGGGAAAGG + Intronic
1053050611 9:34958220-34958242 GGCGGCGGCGGCGGCGCGCGCGG - Intronic
1053239974 9:36487519-36487541 GGCGGCGGCGGCAGCGACCGCGG + Intronic
1055044551 9:71910983-71911005 GGCGGCGGCGGCTGCGACCACGG - Intergenic
1055091120 9:72365291-72365313 GGCGGCGGCGGCGGGGAGCGCGG + Intergenic
1055945714 9:81689501-81689523 GGCGGCGGCGGCGGTGGGAGCGG - Intergenic
1056961892 9:91132538-91132560 GGCGGAGGTTGCAGTGTGCCAGG + Intergenic
1057208193 9:93185367-93185389 GGCGGCGGCGACCGTGAGGAAGG + Exonic
1057463754 9:95292355-95292377 GGTGGCGGCGGCGGGGTCCACGG + Intronic
1058885686 9:109320210-109320232 GCCGGCGGCGGAGATGTGCACGG + Exonic
1059191764 9:112333637-112333659 GGCGGTGGCGGGAGCGTGCCCGG - Intronic
1059414802 9:114155989-114156011 GGCGGCGGCGGCGGCGCGCGGGG + Exonic
1059903856 9:118959658-118959680 GGTGGGGGTGGCAGTGTGGAAGG - Intergenic
1059930534 9:119255884-119255906 GGCGGAGGCTGCAGTGAGCCGGG + Intronic
1060069936 9:120537381-120537403 GGTGGGGGCGGCACTGTGGAGGG - Intronic
1060268559 9:122126240-122126262 GGCGGCAGAGGCAGCGGGCAGGG + Intergenic
1060789758 9:126478262-126478284 GGCGGGGGTAGCAGTGAGCAGGG + Intronic
1060971734 9:127742303-127742325 GGCGGAGGTTGCAGTGAGCAGGG - Intronic
1061052977 9:128206926-128206948 GGAGGCTGCTGCAGTGGGCAGGG + Intronic
1061453495 9:130681599-130681621 GGCGGCGGCGGCGGCGAGCGCGG - Exonic
1062004664 9:134233197-134233219 GGCGGCCGTGGCCGTGGGCAGGG - Intergenic
1062390566 9:136332051-136332073 GGCGGAGAAGGCCGTGTGCAAGG + Intronic
1062519780 9:136952836-136952858 GGCAGGGGTGGCAGTGGGCAGGG - Intronic
1062519786 9:136952852-136952874 GGCAGGGGCGGCGGTGGGCAGGG - Intronic
1062567315 9:137168967-137168989 GGAGGCGGCGGCGGCGCGCACGG + Exonic
1203665426 Un_KI270754v1:18155-18177 CGCGGCGGCGGCTGTGTCCTGGG + Intergenic
1185463037 X:341076-341098 GGTGGGGGCGGCAGGGGGCAGGG - Intronic
1185514503 X:688930-688952 GGCGGAGGTTGCAGTGAGCAGGG + Intergenic
1186426066 X:9465118-9465140 GGCGGCGGCGGCAGCGGGAGAGG - Exonic
1186452928 X:9688145-9688167 GGCGGCGGCGGCTGCGGCCACGG + Exonic
1187225914 X:17375399-17375421 GGCGGCGACGGCAGTGGCCGGGG + Exonic
1187518168 X:19990989-19991011 GGAGGCGGCGGCAGAGTGAGGGG - Intergenic
1188003528 X:25002649-25002671 GGCGGCGGCGGCGGCGTGGCGGG + Intergenic
1189390616 X:40573201-40573223 GGCGGAGGCTGCAGTGAGCCGGG + Intergenic
1190474407 X:50813146-50813168 GGCGGCGGCGGCAGTGGCGGCGG + Intronic
1192317517 X:70064110-70064132 GGCGGAGGCTGCAGTGGGCCGGG + Exonic
1192773869 X:74221773-74221795 GGCGGAGGCTGCAGTGAGCTGGG + Intergenic
1193443137 X:81567494-81567516 GGCAGCAGTGGCAGTGAGCAGGG - Intergenic
1198183168 X:134229730-134229752 GGCGGAGGTTGCAGTGAGCAGGG + Intergenic
1198512477 X:137366463-137366485 GGCGGCTGCTGGAGTGTGCTGGG - Intergenic
1199699115 X:150363489-150363511 GGCGGCGGGGGCAGTGTCCGAGG - Exonic
1199736868 X:150693548-150693570 GGCGGCGGCGGCGGGCTGCGAGG + Exonic
1199772768 X:150984515-150984537 GGCGGCGGTGGCGGTGCGCGGGG - Intronic
1200233653 X:154458295-154458317 GGCGGCGGCGGCTGCGCGCTTGG + Exonic