ID: 995313479

View in Genome Browser
Species Human (GRCh38)
Location 5:110739370-110739392
Sequence GCGGCGGCGGCAGTGTGCAG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 573
Summary {0: 1, 1: 0, 2: 0, 3: 50, 4: 522}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995313466_995313479 14 Left 995313466 5:110739333-110739355 CCGTACGAAGGCCCCACGGAGGA 0: 1
1: 0
2: 0
3: 10
4: 54
Right 995313479 5:110739370-110739392 GCGGCGGCGGCAGTGTGCAGGGG 0: 1
1: 0
2: 0
3: 50
4: 522
995313469_995313479 1 Left 995313469 5:110739346-110739368 CCACGGAGGAACCCTTTTCCAGT 0: 1
1: 0
2: 0
3: 23
4: 76
Right 995313479 5:110739370-110739392 GCGGCGGCGGCAGTGTGCAGGGG 0: 1
1: 0
2: 0
3: 50
4: 522
995313457_995313479 28 Left 995313457 5:110739319-110739341 CCACCACCTCCACCCCGTACGAA 0: 1
1: 0
2: 0
3: 13
4: 390
Right 995313479 5:110739370-110739392 GCGGCGGCGGCAGTGTGCAGGGG 0: 1
1: 0
2: 0
3: 50
4: 522
995313461_995313479 19 Left 995313461 5:110739328-110739350 CCACCCCGTACGAAGGCCCCACG 0: 1
1: 0
2: 0
3: 1
4: 41
Right 995313479 5:110739370-110739392 GCGGCGGCGGCAGTGTGCAGGGG 0: 1
1: 0
2: 0
3: 50
4: 522
995313464_995313479 15 Left 995313464 5:110739332-110739354 CCCGTACGAAGGCCCCACGGAGG 0: 1
1: 0
2: 2
3: 7
4: 72
Right 995313479 5:110739370-110739392 GCGGCGGCGGCAGTGTGCAGGGG 0: 1
1: 0
2: 0
3: 50
4: 522
995313459_995313479 25 Left 995313459 5:110739322-110739344 CCACCTCCACCCCGTACGAAGGC 0: 1
1: 0
2: 1
3: 2
4: 90
Right 995313479 5:110739370-110739392 GCGGCGGCGGCAGTGTGCAGGGG 0: 1
1: 0
2: 0
3: 50
4: 522
995313456_995313479 29 Left 995313456 5:110739318-110739340 CCCACCACCTCCACCCCGTACGA 0: 1
1: 0
2: 0
3: 14
4: 251
Right 995313479 5:110739370-110739392 GCGGCGGCGGCAGTGTGCAGGGG 0: 1
1: 0
2: 0
3: 50
4: 522
995313467_995313479 3 Left 995313467 5:110739344-110739366 CCCCACGGAGGAACCCTTTTCCA 0: 1
1: 0
2: 1
3: 4
4: 87
Right 995313479 5:110739370-110739392 GCGGCGGCGGCAGTGTGCAGGGG 0: 1
1: 0
2: 0
3: 50
4: 522
995313473_995313479 -10 Left 995313473 5:110739357-110739379 CCCTTTTCCAGTGGCGGCGGCGG 0: 1
1: 1
2: 1
3: 6
4: 78
Right 995313479 5:110739370-110739392 GCGGCGGCGGCAGTGTGCAGGGG 0: 1
1: 0
2: 0
3: 50
4: 522
995313460_995313479 22 Left 995313460 5:110739325-110739347 CCTCCACCCCGTACGAAGGCCCC 0: 1
1: 0
2: 0
3: 6
4: 115
Right 995313479 5:110739370-110739392 GCGGCGGCGGCAGTGTGCAGGGG 0: 1
1: 0
2: 0
3: 50
4: 522
995313463_995313479 16 Left 995313463 5:110739331-110739353 CCCCGTACGAAGGCCCCACGGAG 0: 1
1: 0
2: 0
3: 0
4: 23
Right 995313479 5:110739370-110739392 GCGGCGGCGGCAGTGTGCAGGGG 0: 1
1: 0
2: 0
3: 50
4: 522
995313468_995313479 2 Left 995313468 5:110739345-110739367 CCCACGGAGGAACCCTTTTCCAG 0: 1
1: 0
2: 0
3: 6
4: 71
Right 995313479 5:110739370-110739392 GCGGCGGCGGCAGTGTGCAGGGG 0: 1
1: 0
2: 0
3: 50
4: 522

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995313479 Original CRISPR GCGGCGGCGGCAGTGTGCAG GGG Exonic
900015263 1:144444-144466 GTGGAGGCTGCAGTGAGCAGAGG + Intergenic
900045530 1:503053-503075 GTGGAGGCTGCAGTGAGCAGAGG + Intergenic
900067730 1:744783-744805 GTGGAGGCTGCAGTGAGCAGAGG + Intergenic
900272295 1:1797504-1797526 GCGGAGGTTGCAGTGAGCAGAGG - Intronic
901499812 1:9645091-9645113 GCGGAGGTGGCAGTGAGCCGAGG - Intergenic
901778162 1:11574979-11575001 GTGGCGGTTGCAGTGAGCAGAGG - Intergenic
901988895 1:13096596-13096618 GTGGCGACGGCACAGTGCAGGGG - Intergenic
901992918 1:13130171-13130193 GTGGCGACGGCACAGTGCAGGGG + Intergenic
902785506 1:18730499-18730521 GGGGCCGCAGCAGGGTGCAGAGG - Intronic
905179264 1:36156359-36156381 GCGGCGGCGGCGGCGGCCAGTGG - Exonic
905301553 1:36989465-36989487 GCGGCTGCGGCAGTGTGCGAAGG + Intronic
905803647 1:40861445-40861467 GAGGCGGCGGCTGTGTGCGCAGG - Exonic
905862637 1:41361491-41361513 GCGGCGGCGGCAGCATTCACCGG + Intergenic
906170582 1:43721667-43721689 GCGGAGGTGGCAGTGAGCCGAGG - Intronic
907039235 1:51243504-51243526 GCGGAGGCTGCAGTGAGCTGAGG - Intronic
908555639 1:65254468-65254490 GCGGCGGCGGCGGCGAGCGGTGG + Intronic
910150903 1:84143381-84143403 GCGGAGGTCGCAGTGAGCAGAGG + Intronic
910856202 1:91698574-91698596 GCGGAGGCTGCAGTGAGCTGAGG - Intronic
910999383 1:93146085-93146107 GTGGAGGCTGTAGTGTGCAGAGG + Intergenic
911527567 1:99004846-99004868 GAGGCGCCGGCAGGCTGCAGAGG + Exonic
912927905 1:113929716-113929738 GCGGCGGCGGCGGCGGGAAGGGG + Exonic
913939236 1:125086693-125086715 GCGGCGGCGGCAGGGGGGTGGGG + Intergenic
915358863 1:155273461-155273483 GCGGCGGCGGCGGAGCGGAGAGG - Intronic
916190488 1:162173032-162173054 CAGGGGGCTGCAGTGTGCAGTGG - Intronic
916588310 1:166166634-166166656 GCGGCGGCGGCATGGAGCCGGGG + Exonic
918064225 1:181088874-181088896 GCGCCGACGGCCCTGTGCAGGGG + Exonic
919672569 1:200351000-200351022 GCGGAGGTTGCAGTGAGCAGAGG + Intergenic
919831056 1:201540154-201540176 GTGGCGGGGGCGGTGTGTAGGGG + Intergenic
920852055 1:209634644-209634666 GAGACAGGGGCAGTGTGCAGAGG + Intronic
922103092 1:222490178-222490200 GTGGAGGCTGCAGTGAGCAGAGG + Intergenic
922263412 1:223962666-223962688 GTGGAGGCTGCAGTGAGCAGAGG + Intergenic
922315084 1:224434695-224434717 GCGGCGGCGGCGGGCGGCAGCGG + Intronic
922434118 1:225586184-225586206 GCGGAGGCTGCAGTGAGCCGAGG + Intronic
922598473 1:226832261-226832283 GCAGAGGCTGCAGTGAGCAGTGG - Intergenic
924294916 1:242576985-242577007 GCTTAGGAGGCAGTGTGCAGAGG + Intergenic
924345253 1:243067680-243067702 GTGGAGGCTGCAGTGAGCAGAGG + Intergenic
924622948 1:245678212-245678234 GAGGCGGCTGCAGAGTGAAGAGG - Intronic
924801117 1:247330483-247330505 GTGGCAGCTGCAGTGTCCAGGGG - Intronic
1062817749 10:513451-513473 GCGCGGGCCGCAGTGTGCTGTGG - Intronic
1062898557 10:1124072-1124094 GAGGCGGGAGCAGTTTGCAGAGG + Intronic
1063972687 10:11392445-11392467 GCGGAGGTTGCAGTGAGCAGAGG + Intergenic
1064185496 10:13158538-13158560 GCGGCGGCGGCGGTGGGAGGAGG - Intergenic
1064662175 10:17617302-17617324 GAAGCGGCGGCAGCGGGCAGCGG - Exonic
1064704943 10:18061802-18061824 GCGGCGGTTGCAGTGAGCTGAGG + Intergenic
1065338137 10:24676078-24676100 GCGGAGGCTGCAGTGAGCTGAGG + Intronic
1065712822 10:28533488-28533510 GCGGCGGCGGCGGCGGGCGGCGG - Exonic
1066015160 10:31233631-31233653 GTGGTGGCGGCAGTGTGCCCTGG - Intergenic
1066298988 10:34080231-34080253 GCGGAGGTTGCAGTGAGCAGAGG + Intergenic
1066492636 10:35908124-35908146 GGGGCAGGGGCAGTTTGCAGAGG + Intergenic
1066731085 10:38437129-38437151 GTGGAGGCTGCAGTGAGCAGAGG - Intergenic
1068879368 10:62032277-62032299 GCTGAGGCTGGAGTGTGCAGTGG - Intronic
1068921232 10:62486463-62486485 GAGGCGGAGGCAGTGAGCTGAGG - Intronic
1068955661 10:62817328-62817350 GCGGGGGCGGGAGTGTGTAGCGG - Intronic
1070120439 10:73571068-73571090 GCGGAGGCTGCAGTGAGCTGAGG + Intronic
1072218100 10:93304984-93305006 GCGGAGGCTGCAGTGAGCCGAGG + Intergenic
1072655396 10:97326603-97326625 GCGGAGGCGGCCGGGTGCGGTGG + Intergenic
1072891534 10:99329484-99329506 GCGGCGGCGGCCGGGGGCCGAGG - Exonic
1074503351 10:114044997-114045019 GCGGCGGCGGCGGGGCGCGGGGG - Exonic
1074758791 10:116648415-116648437 GCGGAGGCTGCAGTGAGCCGAGG + Intergenic
1074829914 10:117241095-117241117 GCGGCGGCGGCGGGGCGCTGGGG + Exonic
1074865674 10:117543201-117543223 GCGGCGGAGGCAGCGTGCGGCGG + Exonic
1075128427 10:119719758-119719780 GCGGAGGTGGCAGTGAGCCGAGG - Intergenic
1075748423 10:124743971-124743993 GCGGCGGCGGCGGTGGCCGGGGG - Intronic
1075889736 10:125936997-125937019 GCGGAGGTTGCAGTGAGCAGAGG + Intronic
1076353347 10:129833569-129833591 GCGGCGGCGGCAGTGATTTGTGG - Intergenic
1076704870 10:132295813-132295835 GCGGAGGCTGCAGTGAGCCGAGG + Intronic
1076711958 10:132341301-132341323 GCGGAGGTTGCAGTGAGCAGAGG + Intronic
1076730259 10:132435795-132435817 GAGGCTGTGGCAGTGGGCAGAGG - Intergenic
1076759226 10:132592481-132592503 GCGGAGGCTGCAGTGAGCTGAGG - Intronic
1076878909 10:133230617-133230639 GCGGCGGCGGCACTGCGCGGGGG - Exonic
1076971857 11:139544-139566 GTGGAGGCTGCAGTGAGCAGAGG + Intergenic
1077055588 11:591095-591117 GTGGGGGCGGCATTGTGCACAGG - Intronic
1077313512 11:1904459-1904481 GCGGAGGTTGCAGTGAGCAGAGG + Intergenic
1077383918 11:2260169-2260191 GGGGCGAAGGCAGTGTGAAGTGG + Intergenic
1077471840 11:2767098-2767120 GCGGAGGCTGCAGTGAGCCGAGG + Intronic
1078229434 11:9425976-9425998 GCGGAGGCTGCAGTGAGCCGAGG + Intronic
1078552121 11:12288206-12288228 GCGGCGACAGCAGAGGGCAGAGG + Intronic
1078673970 11:13391874-13391896 GCGGAGGCTGCAGTGAGCTGAGG + Intronic
1080219340 11:29882205-29882227 GCTGAGGCTGCAGTGAGCAGAGG - Intergenic
1081512491 11:43789930-43789952 GGGGGGGAGGCAGTGGGCAGTGG - Intronic
1081617290 11:44598478-44598500 GCGGCGGTGGCAGTGAGCCAAGG - Intronic
1083107001 11:60368047-60368069 GCGACGGCGGCAAACTGCAGTGG - Intronic
1083463714 11:62831958-62831980 GCGGCGGCGGCAGGCGGCAGAGG - Exonic
1083849011 11:65354710-65354732 GCTGCGGCGGGTGGGTGCAGAGG + Intergenic
1084122975 11:67080267-67080289 GCGCAGGAGGCAGGGTGCAGAGG + Intergenic
1084393048 11:68891076-68891098 GTGGCGGCGGCAGGGCCCAGGGG - Intergenic
1084547014 11:69819543-69819565 GCGGCGGCCCCATTGTGCAGGGG - Intergenic
1084575754 11:69986867-69986889 AAGGGGGCCGCAGTGTGCAGTGG + Intergenic
1084707022 11:70821491-70821513 GCGGAGGCTGCAGTGAGCCGAGG - Intronic
1085054177 11:73394468-73394490 GCGCTGGCGGCAGCCTGCAGGGG - Exonic
1086149924 11:83597715-83597737 GCGGAGGCTGCAGTGAGCTGAGG + Intronic
1086440158 11:86821785-86821807 GCGGAGGGGGCAGCGTGCTGAGG - Intronic
1086958453 11:92958021-92958043 GCGGAGGCTGCAGTGAGCAGAGG + Intergenic
1088240314 11:107767339-107767361 GCGGAGGTTGCAGTGAGCAGAGG + Intergenic
1088812238 11:113399656-113399678 CTGGCAGCTGCAGTGTGCAGTGG - Exonic
1089386265 11:118070242-118070264 GCGGAGGCTGCAGTGAGCCGAGG - Intergenic
1089432716 11:118436702-118436724 GCGGCGGCGGCGGGAAGCAGCGG + Exonic
1090461509 11:126895405-126895427 GCTGAGGCTGCAGTGTACAGTGG - Intronic
1090699176 11:129279234-129279256 GCGGCGGCGGCGGCGGGCGGAGG - Intronic
1091558682 12:1594456-1594478 GCGGCGGCGGCAGGAGGCGGAGG - Intronic
1094487598 12:30937431-30937453 GGGGGGGCGGCAGGGGGCAGTGG + Intronic
1094496786 12:30993832-30993854 GGGGAGGCGGCAGTGGGCAGGGG + Exonic
1095349045 12:41188340-41188362 GCGGCGGCGGCAGTGGAGGGAGG - Intergenic
1095617021 12:44202854-44202876 GCAGAGGCTGCAGTGAGCAGAGG - Intronic
1095957250 12:47813787-47813809 GCAGCCTTGGCAGTGTGCAGGGG + Intronic
1096386426 12:51197852-51197874 GCGGTGGCAGCAGTGGGCTGCGG + Exonic
1096666766 12:53171346-53171368 CCAGGGGCGGCAGTGTGCGGAGG + Exonic
1096975871 12:55699033-55699055 GGGGAGGGGGCAGGGTGCAGGGG - Intronic
1097091412 12:56508300-56508322 GCGGAGGCTGCAGTGAGCTGAGG - Intergenic
1097855772 12:64460546-64460568 CCGGCTGCGGCTGGGTGCAGTGG + Intronic
1098252664 12:68585945-68585967 GCGGAGGTTGCAGTGAGCAGAGG + Intergenic
1099133522 12:78864807-78864829 GCGGCAGCAGCAGTTAGCAGCGG + Exonic
1102197162 12:111033992-111034014 GCGGCGGCGGCGAGGGGCAGCGG + Intergenic
1102846552 12:116191022-116191044 GCGGAGGTTGCAGTGAGCAGAGG + Intronic
1103335759 12:120188364-120188386 GCGGAGGTTGCAGTGAGCAGAGG + Intronic
1103400644 12:120640908-120640930 GCGGCGGCGGCGGCGAGCGGGGG + Exonic
1103528049 12:121580472-121580494 GCGGCGGCGCCTGCGTGCAGAGG - Intronic
1103872343 12:124100835-124100857 GCGACGGCGGCAATCAGCAGTGG + Intronic
1103950203 12:124546474-124546496 GCGGAGGCTGCAGTGAGCTGAGG - Intronic
1104021199 12:124993660-124993682 GCGGCGGCGGCTGTGGGTAAAGG + Intergenic
1105363608 13:19744038-19744060 GCGGAGGCTGCAGTGGGCTGAGG + Intronic
1106415780 13:29544767-29544789 GCGGCGAGGGCAGTGGGGAGAGG + Intronic
1106477226 13:30109040-30109062 GCGGTGGCGGCAGTTGGCAGAGG - Intergenic
1106481868 13:30143058-30143080 GCGGCCGGGGAAGTGTGCAGTGG + Intergenic
1106713626 13:32365446-32365468 GCGGAGGTTGCAGTGAGCAGAGG - Intronic
1107078249 13:36346476-36346498 GCTGCGGCGGCGGCGTGCTGCGG - Exonic
1107943317 13:45394236-45394258 GGGGCGGGGGCGGGGTGCAGTGG - Exonic
1108272417 13:48774621-48774643 GAGGAGGAGGCAGTGAGCAGTGG - Intergenic
1110319834 13:74148880-74148902 GCGGAGGCTGCAGTGAGCCGAGG - Intergenic
1112091795 13:96090804-96090826 GCGGCGGCGGCAGGGCGGACGGG - Intergenic
1112123010 13:96433865-96433887 GCGGAGGCTGCAGTGAGCCGAGG + Intronic
1113887417 13:113668133-113668155 GATGGGGCGGCAGGGTGCAGAGG + Intronic
1114270684 14:21098349-21098371 GCGGCGGCGGCGGCGGGCGGCGG + Exonic
1114318314 14:21526258-21526280 GCGGCGGGGGCAGGGAGCAGCGG + Intronic
1114826745 14:26090117-26090139 GGGGCAGCGGCAGTGGGCAGGGG - Intergenic
1115662533 14:35511431-35511453 GTGGAGGCTGCAGTGAGCAGAGG - Intergenic
1118992427 14:70809035-70809057 GCGGCGGCGGCGGTGGGCCCCGG - Exonic
1119089944 14:71772210-71772232 GCGGCGGCGGCAAACAGCAGTGG + Intergenic
1121368108 14:93332929-93332951 GCGGCGGCGGCGGTGGGAGGAGG - Exonic
1122211659 14:100177897-100177919 GCGGCGGCGGGGGTGGGGAGAGG + Intergenic
1122221239 14:100240070-100240092 GCGGCGGCGGCGGCGGGCGGCGG + Intronic
1122353403 14:101110321-101110343 GTGGTGTCGGCAGAGTGCAGGGG + Intergenic
1122408869 14:101516047-101516069 GGGGCGAAGGCAGAGTGCAGTGG - Intergenic
1122736667 14:103847507-103847529 GCGGCGGCGGCCGGGTGCCCGGG - Exonic
1122843118 14:104476338-104476360 GAGGTGGCTCCAGTGTGCAGTGG - Intronic
1123894016 15:24810028-24810050 GCAGCAGTGGCAGTGTGCTGGGG - Intergenic
1124500726 15:30225033-30225055 GCGGCGGCGGCGGCGGGAAGAGG - Intergenic
1124742843 15:32313634-32313656 GCGGCGGCGGCGGCGGGAAGAGG + Intergenic
1124882611 15:33656374-33656396 GGGGAGGCGGCAGTGAGCACAGG - Intronic
1125485603 15:40108808-40108830 GCGGCGGCGGCGGCGGGCACAGG + Exonic
1125560992 15:40633241-40633263 GCGGAGGCTGCAGTGAGCTGAGG + Intronic
1125575661 15:40754196-40754218 GCGGAGGCCGCAGTGAGCTGAGG - Intronic
1126451765 15:48816149-48816171 GCGGAGGCTGCAGTGAGCTGAGG + Intergenic
1126616140 15:50582244-50582266 TCGGTGGGGGCTGTGTGCAGTGG - Intronic
1126764506 15:51999061-51999083 GTGGAGGCGGCAGTGAGCCGAGG - Intronic
1127116176 15:55730167-55730189 GCGGAGGCTGCAGTGAGCTGAGG - Intronic
1127117576 15:55743156-55743178 GCGGCGGCTGCAGAGGGCGGGGG + Intergenic
1127494533 15:59497376-59497398 GCGGAGGCTGCAGTGAGCCGAGG + Intronic
1128115431 15:65102173-65102195 GCGGGGGCGGCGGGGTGCTGGGG + Exonic
1129108383 15:73323730-73323752 GTGGCAGCGGCAGCCTGCAGTGG + Exonic
1129663375 15:77565743-77565765 GCAGCGGGGTCAGGGTGCAGAGG - Intergenic
1129852879 15:78804660-78804682 GCTGCGGCGGTTGTGAGCAGAGG - Intronic
1130305459 15:82709830-82709852 GCAGAGGCTGCAGTGTGCAGCGG + Intronic
1130404719 15:83588196-83588218 GTGGAGGCTGCAGTGAGCAGAGG - Intronic
1130564491 15:84981958-84981980 GCGGCGGCTGCGGTGGGAAGGGG - Exonic
1130651302 15:85763609-85763631 GCAGAGGCCACAGTGTGCAGGGG + Intronic
1131242185 15:90756169-90756191 GCGGAGGCTGCAGTGAGCTGAGG - Intronic
1131367724 15:91853895-91853917 GCGGCGGGGGAAGGATGCAGGGG + Exonic
1131516309 15:93079750-93079772 GCGGAGGTTGCAGTGAGCAGAGG + Intronic
1132971551 16:2691664-2691686 GGGGCGGCGGGGGTGTGGAGCGG + Intronic
1133156546 16:3880397-3880419 GCGGCGGCGGCGGCGGGCCGCGG - Exonic
1133229676 16:4360619-4360641 GCGGCGCCAGCAGTGAGGAGGGG - Intronic
1133229752 16:4360881-4360903 GCGGGGCCAGCAGTGTGGAGAGG - Intronic
1134133453 16:11665216-11665238 GCGGCTGGGGGAGTGGGCAGAGG + Intergenic
1134817653 16:17219211-17219233 GTGGAGGCTGCAGTGTGCTGAGG + Intronic
1135414909 16:22261620-22261642 GCGGAGGTTGCAGTGAGCAGAGG + Intronic
1136316175 16:29455723-29455745 GCGGCGGCGGCGGGAGGCAGAGG - Exonic
1136430752 16:30195065-30195087 GCGGCGGCGGCGGGAGGCAGAGG - Exonic
1136561733 16:31043020-31043042 GCAGCGGGGGCCATGTGCAGCGG + Intergenic
1136637290 16:31532770-31532792 GCGGAGGCTGCAGTGAGCCGAGG - Intergenic
1136867758 16:33770442-33770464 GCGGCGGCGGCAGAAAGCTGCGG - Intergenic
1136867761 16:33770461-33770483 GCGGCGGCGGCAGAAAGCGGCGG - Intergenic
1136922415 16:34343981-34344003 GAGGAGGAGGGAGTGTGCAGTGG - Intergenic
1136982158 16:35067825-35067847 GAGGAGGAGGGAGTGTGCAGTGG + Intergenic
1137235171 16:46610624-46610646 GCGGAGGCTGCAGTGAGCCGAGG - Intronic
1137426570 16:48385375-48385397 GCGGCGGCGGCGGCGGCCAGGGG - Intronic
1138517448 16:57544121-57544143 TGGGAGGCTGCAGTGTGCAGGGG + Intronic
1139190619 16:64858916-64858938 GCGGAGGCTGCGGTGAGCAGAGG - Intergenic
1139363474 16:66418393-66418415 TCGGAGGCTGCAGTGTGGAGAGG + Intergenic
1139502420 16:67377918-67377940 GCGGCTGAGGCCGGGTGCAGTGG - Intronic
1139615417 16:68085622-68085644 GCGGCGGCGGCAGCGGCAAGCGG - Intronic
1140443266 16:75003019-75003041 GCGGAGACTGCAGTGAGCAGAGG - Intronic
1141615534 16:85207531-85207553 GCCGCTGGGGCAGGGTGCAGGGG - Intergenic
1141680161 16:85539024-85539046 GCGGGGCTGGCACTGTGCAGGGG - Intergenic
1142263341 16:89052511-89052533 GAGGCGGCAGCAGTTGGCAGAGG - Intergenic
1142448390 16:90157978-90158000 GTGGAGGCTGCAGTGAGCAGAGG - Intergenic
1203104399 16_KI270728v1_random:1345742-1345764 GCGGCGGCGGCAGAAAGCGGCGG + Intergenic
1203104402 16_KI270728v1_random:1345761-1345783 GCGGCGGCGGCAGAAAGCTGCGG + Intergenic
1203129112 16_KI270728v1_random:1616607-1616629 GCGGCGGCGGCAGAAAGCTGCGG - Intergenic
1203129115 16_KI270728v1_random:1616626-1616648 GCGGCGGCGGCAGAAAGCGGCGG - Intergenic
1142459096 17:77311-77333 GTGGAGGCTGCAGTGAGCAGAGG + Intergenic
1142479369 17:208710-208732 GGGGCGGCGGCAGTGAGCCCAGG - Intergenic
1142634841 17:1250380-1250402 GCAGCGGCAGCTGTGTGCACTGG - Intergenic
1142662832 17:1443267-1443289 GAGGCTGCGGCCGGGTGCAGTGG - Intronic
1142859854 17:2755090-2755112 GCGGAGGTTGCAGTGAGCAGAGG - Intergenic
1143109479 17:4545258-4545280 GCGGCGGCTGAAGGGTGCAGAGG - Exonic
1143140119 17:4737510-4737532 GCGGAGGCTGCAGTGAGCTGAGG + Intronic
1143590770 17:7885019-7885041 GCGGCGGCGGCGGCGGGAAGAGG - Exonic
1143607523 17:7997857-7997879 ACGGAGGCTGCAGTGAGCAGAGG + Intergenic
1143754417 17:9056122-9056144 GCGGAGGTTGCAGTGAGCAGAGG - Intronic
1144608686 17:16689909-16689931 GCGCCGGCGGCGCTGTGAAGCGG + Intergenic
1144818733 17:18055920-18055942 GCGGAGGTTGCAGTGAGCAGAGG - Intronic
1144932302 17:18869568-18869590 GCGGAGGTGGCAGTGAGCCGAGG - Intronic
1145128461 17:20320824-20320846 GCGCCGGCGGCGCTGTGAAGCGG + Intergenic
1146242355 17:31242381-31242403 GCGGAGGGTGCAGTGAGCAGAGG - Intronic
1147463502 17:40591594-40591616 GCGGAGGCTGCAGTGAGCTGAGG - Intergenic
1147618594 17:41846451-41846473 GCGGAGGCTGCAGTGGGCAGAGG + Intronic
1148054820 17:44787676-44787698 GCGGCAGTGCCAGGGTGCAGTGG - Intergenic
1148770188 17:50061970-50061992 GCGGAGGTGGCAGTGAGCCGAGG + Intronic
1150334750 17:64322316-64322338 GCGGAGGTTGCAGTGAGCAGAGG + Exonic
1151597447 17:75087289-75087311 GCGGAGGCTGCAGTGAGCTGAGG + Intergenic
1152363677 17:79843642-79843664 GCGGCGGCGGCGGCGGGCGGTGG - Intergenic
1154232592 18:12571140-12571162 GCGGAGGTTGCAGTGAGCAGAGG - Intronic
1155912919 18:31525449-31525471 GCGGAGGCTGCAGTGAGCCGTGG + Intronic
1156099637 18:33578384-33578406 GCGGCGGCGGCGGCGCGCGGCGG - Intergenic
1157826873 18:50820117-50820139 ACGGCGGCGGCTTTGTGCAGGGG - Intronic
1159040579 18:63320042-63320064 GCGGCGGCGGCAGCGCGGCGGGG + Exonic
1160044419 18:75373364-75373386 GAGGGGGCGGGAGTGTGCAGTGG - Intergenic
1160648814 19:209824-209846 GTGGAGGCTGCAGTGAGCAGAGG + Intergenic
1160725375 19:615940-615962 GCGGCGGCGGCGGCGGGAAGAGG - Exonic
1160744420 19:704024-704046 GGGGCGGGGCCAATGTGCAGGGG + Intergenic
1160826868 19:1084325-1084347 GCGGCGGCGGACGGGTGCAGAGG + Exonic
1161241154 19:3224696-3224718 GCGGCGGCGGCGGCGGGCGGCGG - Exonic
1161350068 19:3786389-3786411 GCGGCGGCGGCGGCGCGCGGAGG - Intronic
1161537538 19:4829406-4829428 GTGGAGGTGGCAGTGGGCAGGGG - Intronic
1161684488 19:5696174-5696196 GGGGCGGCGGCAAGGTGCTGGGG + Intronic
1161939864 19:7395440-7395462 GCGGCGATTGCAGGGTGCAGAGG + Intronic
1162036632 19:7943626-7943648 GCGGCGGCGGCCCTGCGGAGTGG - Exonic
1162352531 19:10159281-10159303 GCGGAGGCTGCAGTGAGCCGAGG - Intronic
1162516653 19:11152275-11152297 GTGGCGGCTGCAGTGAGCTGAGG - Intronic
1162751752 19:12833838-12833860 GCGGCGGCGGCTGAGGGGAGGGG - Intronic
1162954497 19:14090774-14090796 GCGGCGGCGGCGGCGGGGAGGGG - Intronic
1163032729 19:14554844-14554866 GCGGAGGTTGCAGTGAGCAGAGG - Intronic
1163329639 19:16628165-16628187 GAGGCGGCGGCAGCGAGCGGCGG - Exonic
1163617923 19:18340740-18340762 GCGGCAGCGGCCGGGGGCAGAGG + Intronic
1163636014 19:18437523-18437545 GCGGGGGCGGGAGCCTGCAGGGG - Intronic
1165494573 19:36144310-36144332 GCGGAGGTTGCAGTGAGCAGAGG + Intronic
1165495105 19:36148002-36148024 GCGGAGGTTGCAGTGAGCAGAGG + Intronic
1165826838 19:38710377-38710399 GCAGCGGCGGCATTGCGCGGTGG - Intronic
1165850856 19:38849694-38849716 GCGGCGGCGGCGGTGGGGTGAGG - Exonic
1166313799 19:41977629-41977651 GCGGAGGCTGCAGTGAGCTGAGG + Intronic
1166786556 19:45370542-45370564 GCGCCGGCCGGACTGTGCAGCGG + Exonic
1167199570 19:48055014-48055036 GTGGCGGCGGCAGTAGTCAGTGG + Exonic
1167311244 19:48739127-48739149 GCGGCGGCGGGCGTGGGAAGCGG - Exonic
1168279793 19:55299086-55299108 GCGGAGGCTGCAGTGAGCCGAGG + Intronic
925081324 2:1070024-1070046 GCAGTGACGTCAGTGTGCAGGGG + Intronic
926130965 2:10302910-10302932 GCCGCGGCGGCGGCGGGCAGCGG + Intronic
926289663 2:11518503-11518525 GCTGCTGCTGCAGTGGGCAGGGG + Intergenic
926320642 2:11746561-11746583 GGGGCGGGGGCAGAGGGCAGGGG - Intronic
927492373 2:23529147-23529169 ACGCAGGCTGCAGTGTGCAGTGG + Intronic
927540482 2:23906271-23906293 GCGGAGGCTGCAGTGAGCCGAGG + Intronic
927708448 2:25311140-25311162 GGGGGGGCGGCGGTGGGCAGAGG + Intronic
928633536 2:33218462-33218484 GCGGAGGCTGCAGTGAGCCGAGG - Intronic
928923625 2:36553606-36553628 GCAGTGGCGGCAGGCTGCAGTGG + Intronic
929057480 2:37890979-37891001 GCTGAGGCAGCAGTGTCCAGGGG + Intergenic
929209971 2:39345273-39345295 GAGGCTGAGGCAGGGTGCAGGGG + Intronic
929991935 2:46797664-46797686 GTGGAGGCTGCAGTGAGCAGAGG - Intergenic
931222181 2:60297719-60297741 CTGGTGGTGGCAGTGTGCAGTGG + Intergenic
931523041 2:63120592-63120614 GCGGAGGCTGCAGTGAGCTGAGG - Intergenic
931657600 2:64524394-64524416 GCGGCGGCGGAAGAGGGCGGAGG + Exonic
931671712 2:64653812-64653834 GCGGCGGCGGCAGGCAGCGGAGG + Exonic
931875165 2:66504299-66504321 GCGGAGGCTGCAGTGAGCTGAGG - Intronic
932412200 2:71554147-71554169 GAGGCAGCCCCAGTGTGCAGTGG + Intronic
933722390 2:85406503-85406525 GCGGCGGGGGCAGGGTGTTGAGG - Intronic
934564590 2:95331182-95331204 GCGGAGGCGGGAGGGAGCAGCGG + Intronic
935266981 2:101403132-101403154 GAAACGGGGGCAGTGTGCAGAGG + Intronic
936518638 2:113198337-113198359 GCGGCGGTTGCAGTGAGCCGAGG - Intronic
936705035 2:115062530-115062552 GGGGTGGGAGCAGTGTGCAGGGG - Intronic
936939639 2:117871062-117871084 GCGGCGGCGGCGGCGGGGAGAGG - Intergenic
938406241 2:131034865-131034887 GCGGCGGCGGCGGGCTGGAGAGG - Intronic
941102123 2:161308203-161308225 GCGGCGGCCGCAGAGCGCAGAGG + Exonic
941686845 2:168456317-168456339 GCGGCGGCGGGCGGGAGCAGCGG + Exonic
942186972 2:173433363-173433385 GCGGAGGCAGCAGTGAGCCGAGG + Intergenic
942418886 2:175787178-175787200 GAGGGGGTGGCAGGGTGCAGGGG + Intergenic
942447548 2:176088125-176088147 GCTGGGGCTGCAGGGTGCAGTGG + Intergenic
942707564 2:178793730-178793752 GCGGAGGCTGCAGTGAGCGGAGG + Intronic
944412446 2:199457731-199457753 GCGGCGGCGGCGGCGAGCCGGGG + Exonic
945474217 2:210262869-210262891 GCGGAGGCTGCAGTGAGCAGAGG - Intergenic
946220544 2:218222197-218222219 GCGGAGGTTGCAGTGAGCAGAGG + Intronic
946340029 2:219060753-219060775 GCGGCGGCGGCGGGGGGCGGCGG + Intergenic
946431028 2:219627551-219627573 GCGGCGGCGGAGGTGCGGAGCGG + Exonic
946954697 2:224916471-224916493 GCGGAGGCTGCTGTGAGCAGAGG + Intronic
947498584 2:230656601-230656623 GCGGAGGTTGCAGTGAGCAGAGG + Intergenic
948046905 2:234952046-234952068 GCGGCGGCGGTAGTGGCGAGGGG - Intronic
949024229 2:241757889-241757911 GCGGAGGTTGCAGTGAGCAGAGG + Intronic
1169448040 20:5688616-5688638 CCGGCAGAGGCAGCGTGCAGAGG + Intergenic
1169467438 20:5853905-5853927 GTGGAGGCTGCAGTGAGCAGTGG - Intronic
1170183860 20:13564936-13564958 GCGGAGGTTGCAGTGAGCAGAGG + Intronic
1170207663 20:13816525-13816547 GCAGCTGCGGCAGTGTACAGAGG + Exonic
1170889967 20:20368414-20368436 GCGGCGGCGGCAGCGGCCCGGGG - Exonic
1170890073 20:20368829-20368851 AGGGCGGCGGCAGGGGGCAGTGG - Exonic
1171473593 20:25390758-25390780 GTGGCGGCGGCTGTGAGCGGCGG - Exonic
1171962458 20:31504556-31504578 GGAGCGGCGGCTGGGTGCAGTGG - Intergenic
1172644520 20:36461522-36461544 GCGGCGGCGGCGGCGGCCAGCGG - Intronic
1172774719 20:37400306-37400328 GCGGCCGGGGCAGGGGGCAGGGG + Intronic
1173293510 20:41734880-41734902 GTGGTGGCGACAGTGAGCAGAGG - Intergenic
1174393104 20:50229979-50230001 GCGGAGGTTGCAGTGAGCAGAGG + Intergenic
1174494737 20:50931321-50931343 GCGGCGGCGGCAACGGGCGGGGG + Intergenic
1174626243 20:51916771-51916793 GCGGAGGCTGCAGTGGGCTGTGG + Intergenic
1174658490 20:52191427-52191449 GCGGCGGGCGCGCTGTGCAGGGG - Intronic
1175440388 20:58986628-58986650 GCGGAGGGGGCTGGGTGCAGTGG - Intronic
1175818289 20:61895186-61895208 GCGGAGGCTGCTGTGTGGAGTGG + Intronic
1175825261 20:61933437-61933459 GCGGATGCTGCTGTGTGCAGAGG + Intronic
1175850187 20:62086324-62086346 GCGGAGGTTGCAGTGGGCAGAGG + Intergenic
1175944499 20:62552402-62552424 GCAGAGCCTGCAGTGTGCAGAGG - Intronic
1176207103 20:63895183-63895205 GCGGCGGCGGCAGAGGGCGCGGG - Exonic
1176219496 20:63963311-63963333 GGGGCCGCGGCAGTGTGGGGTGG - Intronic
1176234561 20:64048420-64048442 GCGGCGGCGACAGCGGGCCGGGG + Exonic
1176517302 21:7795557-7795579 GCGGAGGTTGCAGTGAGCAGAGG + Intergenic
1176550167 21:8217364-8217386 GCGGCGGCGGCGGCGGGCGGCGG + Intergenic
1176569096 21:8400405-8400427 GCGGCGGCGGCAGGCGGCGGAGG + Intergenic
1176577009 21:8444634-8444656 GCGGCGGCGGCGGCGGGCGGCGG + Intergenic
1176666055 21:9688676-9688698 GCCGCTGCAGCAGTGGGCAGAGG - Intergenic
1178518890 21:33270740-33270762 GTGGAGGCTGCAGTGAGCAGAGG - Intronic
1178651330 21:34425569-34425591 GCGGAGGTTGCAGTGAGCAGAGG + Intergenic
1179375463 21:40846773-40846795 GCGGCGGCGGCGGCGGGCGGCGG - Exonic
1179804797 21:43830449-43830471 GCGGCGACGGCAGTGACAAGCGG - Intergenic
1180842226 22:18964759-18964781 GAGGCGGTGGCATTGAGCAGAGG + Intergenic
1180949417 22:19714474-19714496 GCGGCGGCGGCGGCGCGGAGGGG + Exonic
1181059269 22:20274122-20274144 GGGGCGGGGGCATTGAGCAGAGG - Intronic
1181123314 22:20687227-20687249 GCGGAGGTGGCAGTGAGCCGAGG + Intergenic
1181149932 22:20875871-20875893 GGGGGGGCGGCTGGGTGCAGTGG + Intronic
1183264474 22:36816870-36816892 GCGGGGCCGGCGGAGTGCAGGGG + Intronic
1184294483 22:43515140-43515162 GCCGAGGCTGGAGTGTGCAGAGG + Intergenic
1184546909 22:45176808-45176830 GCGGAGGCTGCAGTGAGCAGAGG - Intronic
1184698022 22:46150543-46150565 GCGGCGGGGGCAGCGGGCGGCGG + Intronic
1184773960 22:46613975-46613997 GCGGCTGCAGCAGTGTGAGGAGG + Intronic
1185263062 22:49881307-49881329 GCCCAGGCTGCAGTGTGCAGCGG - Intronic
1185287823 22:50010418-50010440 GCGGCGGAGGCAGCGTGGGGAGG + Intronic
1185348279 22:50320084-50320106 GAGGAGGGGACAGTGTGCAGAGG - Intronic
1203255062 22_KI270733v1_random:133702-133724 GCGGCGGCGGCGGCGGGCGGCGG + Intergenic
1203263118 22_KI270733v1_random:178781-178803 GCGGCGGCGGCGGCGGGCGGCGG + Intergenic
949129376 3:482825-482847 GCGGAGGTCGCAGTGAGCAGAGG + Intergenic
949129437 3:483092-483114 GCGGAGGTCGCAGTGAGCAGAGG + Intergenic
949129458 3:483181-483203 GCGGAGGTCGCAGTGAGCAGAGG + Intergenic
949129478 3:483270-483292 GCGGAGGTCGCAGTGAGCAGAGG + Intergenic
949129499 3:483359-483381 GCGGAGGTCGCAGTGAGCAGAGG + Intergenic
949129520 3:483448-483470 GCGGAGGTCGCAGTGAGCAGAGG + Intergenic
949129541 3:483537-483559 GCGGAGGTCGCAGTGAGCAGAGG + Intergenic
950114920 3:10444579-10444601 GGGGCGGCAGCAGGGTGGAGTGG - Intronic
950124955 3:10505316-10505338 GTGGCGGTGGCAGCGTGGAGGGG - Intronic
950404671 3:12797089-12797111 GAGGCCGAGGCAGGGTGCAGAGG - Intronic
950517842 3:13479439-13479461 GCGGGGGCGGCTGTGTGCCAGGG - Intergenic
951473200 3:23078134-23078156 GGGGCCGGGGCAGGGTGCAGTGG + Intergenic
952594665 3:35001357-35001379 GCGGAGGTTGCAGTGAGCAGAGG + Intergenic
952796157 3:37241386-37241408 GCGGAGGCTGCAGTGAGCTGAGG - Intergenic
952885724 3:38009996-38010018 GCTGCTGCTCCAGTGTGCAGTGG + Exonic
953280417 3:41548791-41548813 GTGGCGGCGGCAGTGACCTGAGG - Intronic
953610693 3:44445162-44445184 GAGGGGCCTGCAGTGTGCAGGGG + Exonic
954097201 3:48338212-48338234 GCAGGGGAGACAGTGTGCAGAGG - Intergenic
954612046 3:51949730-51949752 GCTGAGGCTGCAGTGAGCAGTGG - Intergenic
954669132 3:52278740-52278762 GCGGCCGCGGCGGAGTGTAGTGG + Intronic
955332190 3:58056667-58056689 GCGGCGACTGCAGTGAGCCGAGG - Intronic
955768566 3:62369057-62369079 GCGGCGGCGGCAGCGAGCTCGGG + Intergenic
958478999 3:94622596-94622618 GTGGAGGCTGCAGTGTGCTGAGG + Intergenic
958894816 3:99817851-99817873 GCGGAGGCGACAGTGTCTAGCGG + Exonic
959421598 3:106135714-106135736 GGGGAGGCTGCAGTGTGCGGAGG - Intergenic
959650328 3:108744896-108744918 GAGGTGGCAGCAGTGGGCAGCGG + Intronic
959920088 3:111859833-111859855 GCGGCGGCGCCAGCGTAGAGCGG + Intronic
960747806 3:120908779-120908801 GCGGCGGCGGCTGCGGGCAGAGG + Intronic
961628361 3:128279142-128279164 ACGGCGGCGGCGTTGGGCAGTGG + Intronic
961651180 3:128417393-128417415 GCAGCGGGAGCTGTGTGCAGAGG - Intergenic
961753921 3:129115434-129115456 GCGGAGGTTGCAGTGAGCAGAGG + Intronic
963241708 3:143009528-143009550 GCGGAGGCTGCAGTGAGCCGAGG + Intronic
963827497 3:149970912-149970934 GCGGCGGCGGTAGCGGGCGGCGG + Exonic
965285896 3:166819901-166819923 GCGGAGGTTGCAGTGAGCAGAGG + Intergenic
966994305 3:185265019-185265041 GCGACGGCGGCACTCAGCAGTGG - Intronic
967207491 3:187137440-187137462 GCGGAGGCTGCAGTGAGCCGAGG + Intronic
967590081 3:191262148-191262170 GCGGAGGCTGCAGTGAGCTGAGG + Intronic
968114850 3:196081801-196081823 GGGTCGGCGGCTGTGCGCAGAGG - Intronic
968369036 3:198210291-198210313 GTGGAGGCTGCAGTGAGCAGAGG - Intergenic
968524243 4:1047907-1047929 CCGGCCGCCACAGTGTGCAGTGG + Intergenic
968609006 4:1548572-1548594 GCCGCGGGGGCAGGGTGCCGAGG - Intergenic
968652400 4:1765452-1765474 GCAGGGGTGGCAGTGTGAAGTGG - Intergenic
968732039 4:2273805-2273827 GCGGCGGGGGCAGTGGGGTGGGG - Intronic
970412158 4:15818746-15818768 AGGGCTGCTGCAGTGTGCAGGGG - Intronic
971363941 4:25960876-25960898 GCGGAGGTTGCAGTGAGCAGAGG + Intergenic
972591147 4:40488244-40488266 GCAGAGGCTGCAGTGAGCAGAGG + Intronic
972793395 4:42394092-42394114 GTGGAAGCTGCAGTGTGCAGCGG - Intergenic
975118905 4:70707324-70707346 GCGGAGGTTGCAGTGAGCAGAGG - Intronic
975150077 4:71011422-71011444 GCGGAGGCTGCAGTGGGCTGAGG - Intronic
976181659 4:82405242-82405264 GCGGAGGCTGCAGTGAGCCGAGG - Intergenic
979257462 4:118619999-118620021 GTGGAGGCTGCAGTGAGCAGAGG - Intergenic
980453195 4:133003330-133003352 GCGGAGGTTGCAGTGAGCAGAGG - Intergenic
980461977 4:133126092-133126114 GGGGCGGGGGCAGGGTGGAGGGG + Intergenic
980532151 4:134070305-134070327 GCAGCAGCGGCAGTGTGGTGGGG + Intergenic
980755055 4:137147777-137147799 GCAGCTGTGGCAGGGTGCAGTGG - Intergenic
981436009 4:144722812-144722834 GCCCAGGCTGCAGTGTGCAGTGG - Intronic
983940281 4:173529551-173529573 GCGGCGGCGGCGGCGGCCAGGGG - Exonic
983988328 4:174087894-174087916 GCGGAGGCTGCAGTGAGCTGAGG - Intergenic
984194082 4:176637480-176637502 GCGGAGGCTGCAGTGAGCCGAGG + Intergenic
984588980 4:181595361-181595383 GCGGAGGCTGCAGTGAGCTGAGG + Intergenic
985045320 4:185934714-185934736 GCGGAGGCTGCAGTGAGCTGAGG + Intronic
985180949 4:187262000-187262022 GCGGAGGCTGCAGTGAGCCGAGG - Intergenic
985408965 4:189663663-189663685 GCCGCTGCAGCAGTGGGCAGAGG + Intergenic
985653981 5:1120445-1120467 GCGCCGTCGGCAGTGTGCCGGGG + Intergenic
986174687 5:5341718-5341740 GCTGTGGCTGCAGTGGGCAGTGG + Intergenic
986338880 5:6773883-6773905 GCGGCGGGGGGTGTGTGGAGCGG - Intergenic
987089319 5:14497227-14497249 GCACCTGCGGAAGTGTGCAGGGG - Intronic
988015923 5:25559440-25559462 GCGGAGGTTGCAGTGAGCAGAGG + Intergenic
989510724 5:42284097-42284119 GCGGAGGTTGCAGTGAGCAGAGG + Intergenic
989571612 5:42951174-42951196 GCGGCGGCGGCGCTGGGCTGGGG - Intergenic
990433863 5:55767372-55767394 GCGGAGGTTGCAGTGAGCAGAGG + Intronic
990455176 5:55978655-55978677 GCGGAGGCTGCAGTGAGCCGAGG + Intronic
990955058 5:61332426-61332448 GCGGCGGCGGCGGCGTGCGGGGG + Exonic
992731841 5:79678971-79678993 GCGGAGGTTGCAGTGAGCAGAGG - Intronic
992910720 5:81393916-81393938 GCGGCGGCGGCTGGGGGCTGGGG - Intronic
994072822 5:95620836-95620858 GCGGCGGCGGCAGCGGCGAGGGG - Exonic
995313479 5:110739370-110739392 GCGGCGGCGGCAGTGTGCAGGGG + Exonic
995547641 5:113248909-113248931 GCGGAGGCAGCAATGAGCAGAGG - Intronic
995786871 5:115840363-115840385 GCGGAGGTGGCAGTGGGCGGAGG - Intronic
997184552 5:131868610-131868632 GCCTAGGCAGCAGTGTGCAGAGG + Intronic
997311300 5:132885839-132885861 GCGGAGGCTGCAGTGAGCCGAGG - Intronic
998120368 5:139571337-139571359 GCGGAGGTTGCAGTGTGCCGAGG + Intronic
998272342 5:140718184-140718206 GCGGAGGCTGCAGTGAGCTGAGG + Intergenic
999188487 5:149730314-149730336 GCCGCGGCTGCAGCGTGCGGCGG - Exonic
999300240 5:150486239-150486261 GCGGCGGCGGCGGCGTGGAGCGG + Intronic
1002209855 5:177592155-177592177 GCGGCGGCGGCAGGGCGACGTGG + Exonic
1002416182 5:179122025-179122047 GGGGCGCGGGCAGGGTGCAGGGG - Intronic
1002459972 5:179368476-179368498 GCGGCCCCGGGTGTGTGCAGAGG + Intergenic
1002531139 5:179846349-179846371 GCGGAGGCTGCAGTGTTCCGAGG - Intronic
1002591066 5:180291961-180291983 GCGGCGGCGGCGGGGCGGAGCGG - Exonic
1002622126 5:180494995-180495017 GCGGCGGCGGCGGCGCGCAGAGG + Intronic
1002728312 5:181315876-181315898 GTGGAGGCTGCAGTGAGCAGAGG - Intergenic
1002897953 6:1390035-1390057 GCGGCGGCGGCGGCGGGCGGCGG - Exonic
1003624087 6:7727043-7727065 GCGGCCGCGGCAGCGGGCAAGGG - Exonic
1004648485 6:17585792-17585814 GCAGCGGTTGCAGTGAGCAGAGG + Intergenic
1006089684 6:31620932-31620954 GCGGCGGCGGTGGTGGGCCGGGG + Intronic
1006180392 6:32150531-32150553 GGGGCGGCGGCAGCGGGCGGCGG + Exonic
1006605621 6:35254789-35254811 GCGGAGGTGGCAGTGAGCCGAGG + Intergenic
1007039884 6:38711950-38711972 GTTGGGGCGGCAGGGTGCAGGGG - Intergenic
1007134308 6:39506900-39506922 GCTGGGAGGGCAGTGTGCAGAGG + Intronic
1007433291 6:41788811-41788833 GCGGAGGCTGCAGTGAGCTGAGG - Intronic
1007644387 6:43369233-43369255 GCGGAGGCGGCGGTGAGCTGCGG + Exonic
1007649517 6:43409720-43409742 GCAGAGGCTGCAGTGAGCAGAGG + Intergenic
1007759874 6:44127549-44127571 GCGGCCGCGGCAGTGTATGGGGG - Intronic
1008160346 6:48068717-48068739 GAGGCGGCGGCGGTGGGGAGGGG - Intergenic
1008351759 6:50499639-50499661 GTGCCTGCAGCAGTGTGCAGAGG - Intergenic
1010141925 6:72622256-72622278 GCGGCGGCGGCGGCGGGCGGGGG + Exonic
1010700789 6:79044076-79044098 GGGGCAGCGGGAGTGTGGAGTGG - Intronic
1012398675 6:98827433-98827455 GCGGCGCGGACAGTGTACAGAGG - Intergenic
1013059589 6:106620170-106620192 GCGGAGGTTGCAGTGAGCAGAGG - Intronic
1013225751 6:108118506-108118528 GCTGCGGGGGCCGTGGGCAGGGG + Intronic
1015394836 6:132721782-132721804 GCGGAGGCTGCAGTGAGCCGAGG + Intergenic
1017672397 6:156779255-156779277 GCGGCGGCGGCGGCGCGCTGGGG - Exonic
1019197432 6:170290658-170290680 GCGGCGGCGGGTGTGCGCGGCGG + Intergenic
1019421930 7:954628-954650 GCGGCGGCGGCGGAGCCCAGAGG - Intronic
1021069044 7:16214564-16214586 GCGGAGGTTGCAGTGAGCAGAGG - Intronic
1024072385 7:45797063-45797085 GTGGAGGCTGCAGTGAGCAGAGG - Intergenic
1025055132 7:55759007-55759029 GTGGAGGCTGCAGTGAGCAGAGG + Intergenic
1025069780 7:55887841-55887863 GCGGCGGCGGCGGCGGGCGGCGG + Intronic
1025069792 7:55887873-55887895 GCGGCGGCGGCGGCGGGCGGCGG + Intronic
1025111244 7:56218151-56218173 GCGGAGGTGGCAGTGAGCCGAGG - Intergenic
1025133207 7:56389233-56389255 GTGGAGGCTGCAGTGAGCAGAGG + Intergenic
1025611444 7:63078342-63078364 GAGGAGGTGGCAGTGAGCAGAGG - Intergenic
1026100117 7:67377827-67377849 GCAGAGGCTGCAGTGAGCAGAGG + Intergenic
1026464089 7:70639152-70639174 GTGGCGGCGGCAGCGGGGAGTGG - Intronic
1026595992 7:71734624-71734646 GCGGAGGCTGCAGTGAGCCGAGG - Intergenic
1026774490 7:73223078-73223100 GCGGAGGCTGCAGTGAGCTGAGG - Intergenic
1026817143 7:73521935-73521957 GCGGCGGCGGCGGTGGGGACTGG + Exonic
1027015348 7:74776467-74776489 GCGGAGGCTGCAGTGAGCTGAGG - Intronic
1027072683 7:75169488-75169510 GCGGAGGCTGCAGTGAGCTGAGG + Intergenic
1027188317 7:75984516-75984538 GCGGGTGCGTTAGTGTGCAGGGG + Intronic
1028561303 7:92179170-92179192 GCGGCCGCGCCAGGGCGCAGCGG - Intronic
1029364672 7:100108953-100108975 GTGGAGGCTGCAGTGAGCAGAGG + Intronic
1031681148 7:124676235-124676257 GCGGAGGCTGCAGTGAGCCGAGG - Intergenic
1032049772 7:128640765-128640787 GTGGAGGCTGCAGTGAGCAGAGG - Intergenic
1032335186 7:131018436-131018458 GGGGCAGCGGGAGTGTGCTGGGG - Intergenic
1032581189 7:133105123-133105145 GTGGAGGGGGCAGTGTGGAGGGG - Intergenic
1033810401 7:145004956-145004978 GAGGGGGCGGCTGTGTGCTGAGG + Intergenic
1034147251 7:148884204-148884226 GCGGCGGCGGCGGCGCGCGGGGG - Exonic
1034441147 7:151086658-151086680 GCGGCGGCGGCAGCGGCGAGCGG - Intronic
1034447831 7:151122495-151122517 GCGGCGGCGGCGGGCGGCAGCGG - Intronic
1034492622 7:151401978-151402000 GCGGAGGCTGCAGTGAGCTGAGG + Intronic
1035581038 8:738984-739006 GCGGCGGCGGCGTCGCGCAGGGG - Intergenic
1036661867 8:10714271-10714293 CCTGCGACGGCTGTGTGCAGTGG + Intergenic
1037289545 8:17336394-17336416 GGGGCGAGGGCAGTGTCCAGTGG - Intronic
1038298182 8:26316070-26316092 GCGGAGGCTGCAGTGAGCCGAGG - Intronic
1039495365 8:37976195-37976217 GTGGAGGCTGCAGTGTGCTGAGG - Intergenic
1040025680 8:42779648-42779670 GCGGAGGTTGCAGTGAGCAGAGG + Intronic
1041054655 8:53971541-53971563 GCGGAGGCTGCAGTGAGCCGAGG + Intronic
1042964767 8:74338619-74338641 GCGGAGGCTGCAGGTTGCAGAGG - Intronic
1045222579 8:100213263-100213285 GCGGCGGCGGCGGCGGGCGGCGG + Exonic
1046456640 8:114473263-114473285 GCGGAGGCTGCAGTAAGCAGAGG + Intergenic
1047143915 8:122175491-122175513 GCGGAGGTTGCAGTGAGCAGGGG - Intergenic
1047956551 8:129980914-129980936 GTGGAGGCTGCAGTGAGCAGAGG + Intronic
1049528385 8:143141299-143141321 GCGGCGGTTGCAGTGAGCCGAGG - Intergenic
1049615287 8:143573193-143573215 GGGGCGGAGCCAGCGTGCAGGGG - Intergenic
1049762275 8:144336904-144336926 GCGGCGGCGGCGGCGGGCGGGGG + Intergenic
1049788434 8:144462359-144462381 GCGGCGGCGGCGGCCGGCAGCGG - Intronic
1049819287 8:144624784-144624806 GGGGCTGCCGCAGTGTGCAGTGG - Intergenic
1049819301 8:144624835-144624857 GGGGATGCCGCAGTGTGCAGTGG - Intergenic
1049819315 8:144624886-144624908 GGGGCTGCCGCAGTGTGCAGTGG - Intergenic
1049819329 8:144624937-144624959 GGGGCTGCCGCAGTGTGCAGTGG - Intergenic
1049819343 8:144624988-144625010 GGGGATGCCGCAGTGTGCAGTGG - Intergenic
1049819357 8:144625039-144625061 GGGGCTGCCGCAGTGTGCAGTGG - Intergenic
1049819371 8:144625090-144625112 GGGGCTGCCGCAGTGTGCAGTGG - Intergenic
1049819385 8:144625141-144625163 GGGGCTGCCGCAGTGTGCAGTGG - Intergenic
1049819399 8:144625192-144625214 GGGGCTGCCGCAGTGTGCAGTGG - Intergenic
1049819413 8:144625243-144625265 GGGGCTGCCGCAGTGTGCAGTGG - Intergenic
1049819427 8:144625294-144625316 GGGGCTGCCGCAGTGTGCAGTGG - Intergenic
1049819441 8:144625345-144625367 GGGGCTGCCGCAGTGTGCAGTGG - Intergenic
1049819455 8:144625396-144625418 GGGGCTGCCGCAGTGTGCAGTGG - Intergenic
1049819493 8:144625549-144625571 GGGGCTGCCGCAGTGTGCAGTGG - Intergenic
1049819507 8:144625600-144625622 GGGGCTGCCGCAGTGTGCAGTGG - Intergenic
1049819533 8:144625702-144625724 GGGGCTGCCGCAGTGTGCAGTGG - Intergenic
1049819559 8:144625804-144625826 GGGGCTGCCGCAGTGTGCAGTGG - Intergenic
1049819573 8:144625855-144625877 GGGGATGCCGCAGTGTGCAGTGG - Intergenic
1049819611 8:144626008-144626030 GGGGCTGCCGCAGTGTGCAGTGG - Intergenic
1049819625 8:144626059-144626081 GGGGCTGCCGCAGTGTGCAGTGG - Intergenic
1049819651 8:144626161-144626183 GGGGATGCCGCAGTGTGCAGTGG - Intergenic
1049819665 8:144626212-144626234 GGGGATGCCGCAGTGTGCAGTGG - Intergenic
1049819703 8:144626365-144626387 GGGGCTGCCGCAGTGTGCAGTGG - Intergenic
1049819717 8:144626416-144626438 GGGGCTGCCGCAGTGTGCAGTGG - Intergenic
1049819731 8:144626467-144626489 GGGGCTGCCGCAGTGTGCAGTGG - Intergenic
1049819757 8:144626569-144626591 GGGGATGCCGCAGTGTGCAGTGG - Intergenic
1049999424 9:1060789-1060811 GCGGAGGTGGCAGTGAGCTGAGG - Intergenic
1052970790 9:34376293-34376315 GCGGAGGCGGCAGATTACAGAGG - Intronic
1054767026 9:69050846-69050868 GCGGAGGTTGCAGTGAGCAGAGG - Intronic
1054773906 9:69108453-69108475 GCGGAGGTTGCAGTGAGCAGAGG + Intergenic
1055795973 9:79975260-79975282 GTGGCGGGGGCAGGGGGCAGGGG + Intergenic
1057174631 9:92987143-92987165 GCAGAGGAGGCTGTGTGCAGTGG + Intronic
1057995885 9:99821567-99821589 GCGTCTGCGGGAGGGTGCAGCGG - Intergenic
1058937111 9:109779924-109779946 GGGGCGGAGGCAGAGCGCAGTGG - Intronic
1059000610 9:110344483-110344505 GTGGCGCCGTCATTGTGCAGTGG + Intergenic
1059241359 9:112809152-112809174 GCGGAGGCCGCAGTGAGCTGAGG - Intronic
1059414803 9:114155990-114156012 GCGGCGGCGGCGGCGCGCGGGGG + Exonic
1060599585 9:124869141-124869163 GCGGCGGCGGCTGCGCGCGGAGG + Exonic
1060700604 9:125746947-125746969 GCGGCGGCGGCGGCGGGCGGCGG - Intergenic
1060817540 9:126643037-126643059 GCTGAGGCTGCAGTGGGCAGGGG + Intronic
1061052978 9:128206927-128206949 GAGGCTGCTGCAGTGGGCAGGGG + Intronic
1061272351 9:129550462-129550484 GCAGCGGCGCCAGTGGGGAGAGG - Intergenic
1061366040 9:130172814-130172836 GCGGAGGCGGCAGCGCGGAGCGG - Intronic
1061806224 9:133139198-133139220 GGGGCAGCGGCTGTGTGCTGTGG - Intronic
1061814289 9:133184686-133184708 GCGGAGGCTGCAGTGAGCCGAGG + Intergenic
1062004663 9:134233196-134233218 GCGGCCGTGGCCGTGGGCAGGGG - Intergenic
1062519785 9:136952851-136952873 GCAGGGGCGGCGGTGGGCAGGGG - Intronic
1062753377 9:138272975-138272997 GTGGAGGCTGCAGTGAGCAGAGG - Intergenic
1203471461 Un_GL000220v1:116842-116864 GCGGCGGCGGCAGGCGGCGGAGG + Intergenic
1203479282 Un_GL000220v1:160814-160836 GCGGCGGCGGCAGGCGGCGGAGG + Intergenic
1203575888 Un_KI270745v1:7754-7776 GTGGAGGCTGCAGTGAGCAGAGG - Intergenic
1203660043 Un_KI270753v1:33085-33107 GCCGCTGCAGCAGTGGGCAGAGG + Intergenic
1185463036 X:341075-341097 GTGGGGGCGGCAGGGGGCAGGGG - Intronic
1185627535 X:1493218-1493240 GCGGAGGTTGCAGTGAGCAGAGG + Intronic
1185681296 X:1890601-1890623 GCGGAGGCTGCAGTGAGCCGAGG + Intergenic
1186417367 X:9395387-9395409 GCGGAGGCTGCAGTGAGCTGAGG - Intergenic
1186482055 X:9903609-9903631 GTGGAGGCTGCAGTGAGCAGAGG - Intronic
1187197382 X:17100535-17100557 GCGGTGCAGGCAGTGGGCAGTGG - Intronic
1187511281 X:19921633-19921655 GCGGAGGCTGCAGTGAGCTGAGG + Intronic
1187676261 X:21719448-21719470 GGGGCGGTTGCAGTGAGCAGAGG + Intronic
1188003529 X:25002650-25002672 GCGGCGGCGGCGGCGTGGCGGGG + Intergenic
1189324598 X:40105105-40105127 GCGGCGGCGGCGGCGAGGAGGGG + Intronic
1190841468 X:54148577-54148599 GCGGAGGCTGCAGTGAGCAGAGG + Intronic
1191214225 X:57919155-57919177 GCGGAGGTTGCAGTGAGCAGAGG + Intergenic
1197194527 X:123684673-123684695 GCAGTGGCGGCTGGGTGCAGTGG - Intronic
1197422685 X:126258125-126258147 GTGGCAGTGGCAGTGTGAAGGGG + Intergenic
1198512476 X:137366462-137366484 GCGGCTGCTGGAGTGTGCTGGGG - Intergenic
1198682213 X:139194946-139194968 GCGGCAGCGGCGGTGGGCAGTGG - Intronic
1199699114 X:150363488-150363510 GCGGCGGGGGCAGTGTCCGAGGG - Exonic
1199772767 X:150984514-150984536 GCGGCGGTGGCGGTGCGCGGGGG - Intronic
1200231077 X:154444197-154444219 GCGGCGGCGGCGGCGGGCGGCGG - Exonic
1201970263 Y:19785150-19785172 GCGGAGGTTGCAGTGAGCAGAGG - Intergenic
1202197629 Y:22310446-22310468 GAGGAGGCTGCAGTGAGCAGCGG + Intronic