ID: 995313481

View in Genome Browser
Species Human (GRCh38)
Location 5:110739393-110739415
Sequence CAGAGCAGTGGTGAGAAGCA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 612
Summary {0: 1, 1: 0, 2: 1, 3: 56, 4: 554}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995313475_995313481 12 Left 995313475 5:110739358-110739380 CCTTTTCCAGTGGCGGCGGCGGC 0: 1
1: 1
2: 0
3: 14
4: 121
Right 995313481 5:110739393-110739415 CAGAGCAGTGGTGAGAAGCATGG 0: 1
1: 0
2: 1
3: 56
4: 554
995313467_995313481 26 Left 995313467 5:110739344-110739366 CCCCACGGAGGAACCCTTTTCCA 0: 1
1: 0
2: 1
3: 4
4: 87
Right 995313481 5:110739393-110739415 CAGAGCAGTGGTGAGAAGCATGG 0: 1
1: 0
2: 1
3: 56
4: 554
995313476_995313481 6 Left 995313476 5:110739364-110739386 CCAGTGGCGGCGGCGGCAGTGTG 0: 1
1: 0
2: 3
3: 22
4: 346
Right 995313481 5:110739393-110739415 CAGAGCAGTGGTGAGAAGCATGG 0: 1
1: 0
2: 1
3: 56
4: 554
995313473_995313481 13 Left 995313473 5:110739357-110739379 CCCTTTTCCAGTGGCGGCGGCGG 0: 1
1: 1
2: 1
3: 6
4: 78
Right 995313481 5:110739393-110739415 CAGAGCAGTGGTGAGAAGCATGG 0: 1
1: 0
2: 1
3: 56
4: 554
995313468_995313481 25 Left 995313468 5:110739345-110739367 CCCACGGAGGAACCCTTTTCCAG 0: 1
1: 0
2: 0
3: 6
4: 71
Right 995313481 5:110739393-110739415 CAGAGCAGTGGTGAGAAGCATGG 0: 1
1: 0
2: 1
3: 56
4: 554
995313469_995313481 24 Left 995313469 5:110739346-110739368 CCACGGAGGAACCCTTTTCCAGT 0: 1
1: 0
2: 0
3: 23
4: 76
Right 995313481 5:110739393-110739415 CAGAGCAGTGGTGAGAAGCATGG 0: 1
1: 0
2: 1
3: 56
4: 554

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995313481 Original CRISPR CAGAGCAGTGGTGAGAAGCA TGG Exonic
900887144 1:5423162-5423184 CAGAGTAGGGGTGAGCAGAAAGG + Intergenic
901336399 1:8452934-8452956 CAAACCAGTGGAGAGTAGCATGG + Intronic
901379970 1:8866507-8866529 GAGAGCAGAGCAGAGAAGCATGG + Intronic
901889519 1:12250662-12250684 AACAGCAGTGGTGAAAATCAAGG - Intronic
902551713 1:17223389-17223411 CAGAGCAGGTGTGAGGAGCAAGG - Intronic
902613342 1:17609931-17609953 CAGAGCAGGGCTGGGACGCACGG - Intronic
903027870 1:20442468-20442490 AAGAGCAGGGGAGAGAAGGAGGG - Intergenic
903654785 1:24942632-24942654 CAGAGGAGTGGGGAGAAGGCAGG - Intronic
903837194 1:26212365-26212387 CAGAGCAGGGGAGCTAAGCAGGG + Intergenic
904235781 1:29116105-29116127 CAGAGCAGTAGAGAGAAGAGAGG - Intronic
904371348 1:30049405-30049427 GAGAGCAGTGGTGAGGACCGTGG + Intergenic
904946071 1:34199663-34199685 CACAGCAGTGGTGGGAAACCTGG - Intronic
905238456 1:36566326-36566348 GAGAGCAGCCCTGAGAAGCAGGG - Intergenic
905277915 1:36830941-36830963 CAGAAGACTGGAGAGAAGCATGG + Intronic
905657244 1:39692579-39692601 AAGAGCAGCGGTGAGAGGCGGGG + Intronic
905691278 1:39944902-39944924 AAGTGCAGTAGTAAGAAGCAGGG + Intergenic
906191905 1:43904394-43904416 CAGAGGCTTGGTGAGAAGCCTGG - Intronic
907675523 1:56514423-56514445 GTGAGCAGTGGTGAGAAATAGGG + Intronic
907818117 1:57939850-57939872 CAGAGCAGTGGTAAGAATACAGG - Intronic
908111039 1:60897537-60897559 TATAGCAGTGGTGAGGAGCAGGG + Intronic
908542623 1:65136111-65136133 CAGAGGAATAGAGAGAAGCATGG - Intergenic
908650316 1:66325792-66325814 CAGAGAAGTGGTGGGAAGGAGGG + Intronic
909075270 1:71045643-71045665 CAGAGCAATGCAGAGGAGCAAGG - Intronic
909158810 1:72117878-72117900 AAGAGAAGTGGTGAAAAGTATGG + Intronic
910425534 1:87116819-87116841 GAGAGCTGTGGTGATAAACAAGG - Intronic
910593604 1:88954204-88954226 CTGAGCATGGGTAAGAAGCAGGG - Intronic
910768274 1:90804543-90804565 CAGTGCAATGTTGGGAAGCAGGG + Intergenic
910812715 1:91254169-91254191 CAGAGCTGTGGTGGGCAGCCTGG + Intergenic
911688931 1:100809113-100809135 CAGAGCAGTGGGAAGAAGTGAGG + Intergenic
912510343 1:110185405-110185427 CACAGCAGTGCTGAGAAGCAAGG + Intronic
912661267 1:111532950-111532972 CAGAGCAGTGTGGATAAACAGGG - Intronic
914044469 1:144079019-144079041 CAAGGCAGCGGTGAGAGGCAAGG - Intergenic
914133641 1:144881667-144881689 CAAGGCAGCGGTGAGAGGCAAGG + Intergenic
914990877 1:152498588-152498610 CAGAGCAGTGGAGAGGGACATGG + Intergenic
915074939 1:153300143-153300165 GAGAGGAGTGGTGAGTAGTAAGG - Intronic
915250975 1:154588249-154588271 CGGAGCAGTGCTGAAAAACAGGG + Exonic
915587296 1:156851211-156851233 CAGAACAGTGGTGAAGAGAATGG - Intronic
916909067 1:169325170-169325192 CAGAGTGGTGGAGAGATGCAAGG + Intronic
917283272 1:173399201-173399223 TAGAGCAGGGGTGAGGACCATGG - Intergenic
917328157 1:173854636-173854658 CAGGGTAGTGGTTAGGAGCATGG - Intronic
918802029 1:188984871-188984893 GAGGGCAGTGGTGTGAGGCAGGG + Intergenic
918873811 1:190011991-190012013 AAGAGGAGTGGTGAGAAGGGGGG - Intergenic
919765788 1:201126723-201126745 CAGAGCAGTGGTGAAGGGCCTGG - Intronic
921995488 1:221413485-221413507 CAGAGCAGTGGTAAGTGTCATGG - Intergenic
922745523 1:228041254-228041276 CAGTGCAGTTGTCAGATGCAGGG - Intronic
922779678 1:228241407-228241429 GAGAGCAGGGGTAAGATGCAGGG + Intronic
922908942 1:229199452-229199474 CATAGCAGTAGTGCCAAGCAAGG + Intergenic
924313797 1:242774652-242774674 CAGTGCAGTGGTGAGCTGAAGGG + Intergenic
924601090 1:245490039-245490061 CAGTGCAGTGGTTACAAGTATGG - Intronic
924813264 1:247421681-247421703 CAGAGCTGGGGTAAAAAGCAGGG + Intronic
1062823841 10:554610-554632 CAGGGCAGTGGGGAGGAGAAGGG - Intronic
1062945361 10:1457247-1457269 CAGAGGAGTGGTGAGCATGAGGG + Intronic
1063039288 10:2320292-2320314 CTGAGCAGAGGTGAGAATGAAGG - Intergenic
1063126792 10:3142838-3142860 CAGGGCAGTGGGGAGAAACCAGG - Intronic
1063367079 10:5497252-5497274 CAGAGCAAGGGGGAGAAGGACGG - Intergenic
1064029284 10:11873549-11873571 CTGAGCAGAGGTGATGAGCAAGG + Intergenic
1064253204 10:13722733-13722755 CACAGGAGAGGTGAAAAGCAAGG + Intronic
1064718626 10:18205171-18205193 CTGTCCAGTGGTTAGAAGCATGG + Intronic
1065523010 10:26590089-26590111 CAGAACAGTGGTGCTGAGCATGG + Intergenic
1065945144 10:30599350-30599372 GAGAGCCGTGGGCAGAAGCAGGG - Intergenic
1066020624 10:31297139-31297161 TAGAGCAGGGGTTAGAACCAAGG - Intergenic
1066956601 10:42178706-42178728 CAAGGCAGCGGTGAGAGGCAAGG - Intergenic
1067165596 10:43864252-43864274 CAGAGCAGTGTGGACAGGCAAGG - Intergenic
1067879350 10:50030027-50030049 CAGAGTAGCGGGCAGAAGCAGGG - Intergenic
1067892545 10:50149405-50149427 CAGAGTAGTGGGCAGAAGCAGGG + Intergenic
1067934815 10:50600873-50600895 CAAATCAGAGGAGAGAAGCAGGG + Intronic
1068613442 10:59086123-59086145 CAGAGAAGTTATGAGAAGAAGGG - Intergenic
1068639258 10:59383799-59383821 CAGAACAATGGTGAGAACAATGG - Intergenic
1069553563 10:69381874-69381896 CAGCACAGTGGTCAAAAGCACGG - Intronic
1070195964 10:74156675-74156697 TAGAGCAGTGGTTAAGAGCATGG + Intronic
1070507524 10:77127376-77127398 CAGGGCAGTGGCTAGAAGCTTGG - Intronic
1070758738 10:79009921-79009943 CAGAGCGGTGGTTTGAACCAGGG - Intergenic
1071083269 10:81838363-81838385 CAGAGGAATGGTGAGAGGAAGGG + Intergenic
1071146168 10:82575359-82575381 TAGAGCTGTGGTGACAAGCTTGG + Intronic
1071264407 10:83951791-83951813 CAGAGCTGTGGGGAGCAGCCTGG - Intergenic
1071575882 10:86726043-86726065 CAAATCAGTGGGCAGAAGCAGGG - Intronic
1071930015 10:90458537-90458559 GTGAGTAATGGTGAGAAGCATGG + Intergenic
1072542199 10:96406699-96406721 AAGAGCAGTGGGGAGAAGATAGG - Intronic
1072571112 10:96658247-96658269 GACAGGAGAGGTGAGAAGCAAGG + Intronic
1073036083 10:100565071-100565093 CAGAGAAATGGGGAGAAGGAGGG + Intergenic
1074431829 10:113401000-113401022 CAGCACAGTGCTGGGAAGCAGGG + Intergenic
1074960164 10:118437442-118437464 CAGAGGGATGGTGAGAAGCAAGG - Intergenic
1075136602 10:119791995-119792017 CAGAGCACTGGGGAGAGGGACGG + Exonic
1075373377 10:121956733-121956755 CATAGCCGAGATGAGAAGCATGG + Intergenic
1075539810 10:123302670-123302692 CAGTCCAGTGGGGAAAAGCATGG + Intergenic
1076906214 10:133362834-133362856 CCAAGCAGAGGTGTGAAGCAGGG + Exonic
1078650959 11:13191661-13191683 CAGGGCAGTGCAGAGAAGAAAGG - Intergenic
1078666008 11:13325884-13325906 AAGTGCAGTAGTGAGAAGCGGGG + Intronic
1078689102 11:13561227-13561249 GAGAGCAGGAGTGAGAAGCTTGG + Intergenic
1078717591 11:13854652-13854674 CAGAGCACTGGTGCAAACCATGG + Intergenic
1078827817 11:14947983-14948005 AGGAGCAGTGGAGAGAAGGATGG - Intronic
1078915758 11:15777133-15777155 CAGAGAAGTGGTGGAAAACAGGG - Intergenic
1078919227 11:15812371-15812393 CAGATCAGTGATGAGAAACAAGG - Intergenic
1080972709 11:37298609-37298631 AATTGCAGTGGTGAGGAGCAGGG + Intergenic
1081596162 11:44460953-44460975 CAGAGCAGTGTGGAGAAGGGTGG + Intergenic
1081821451 11:45999884-45999906 CATAGCAGTGGTGAACAGGAAGG + Intronic
1083151983 11:60797740-60797762 TAGTGCAGTAGGGAGAAGCACGG - Intronic
1083319853 11:61838907-61838929 GAGAGCAGTGGAGAGAGCCAAGG - Intronic
1084412721 11:69013630-69013652 CAGAGCAGTGGGGGGCAGCAGGG + Intergenic
1084445141 11:69199288-69199310 TAGAGCAATGGTGAGATGGAGGG - Intergenic
1084938178 11:72598385-72598407 CAGAGGGGTGGTGGGAACCAAGG + Intronic
1085040219 11:73322488-73322510 TGGAGCAATGGTGAGATGCATGG - Intronic
1085098407 11:73779582-73779604 CAGACCAATGGGGAGAGGCAAGG + Intergenic
1085546420 11:77322496-77322518 GAGAGCAGTGTTGAGAAGTCGGG - Intronic
1085783756 11:79433698-79433720 CAGAGCAGTGGTCAGCACCCCGG - Intronic
1086915856 11:92529261-92529283 CAGAGCAGAGCTGAGTAACAGGG + Intronic
1087670751 11:101103407-101103429 CAGCACACTGGTGAGCAGCAGGG + Intronic
1088055661 11:105573304-105573326 CAGAGAAGAGGTTAAAAGCAAGG + Intergenic
1088544790 11:110948275-110948297 CAGAATAGTGGTGAGAAATAGGG + Intergenic
1088623002 11:111706012-111706034 CAGTGTGGTGGTTAGAAGCAGGG + Intronic
1088834540 11:113566856-113566878 CAACGCAGTGGCGAGAAGTACGG - Intergenic
1090629827 11:128636311-128636333 GGGAGCAGTGGTGAGAGGCTAGG + Intergenic
1090714086 11:129414654-129414676 GACAGCACTGGGGAGAAGCAGGG + Intronic
1091723878 12:2832642-2832664 CATAACATTTGTGAGAAGCATGG - Intronic
1092227661 12:6758618-6758640 AAGAGCAGTGGTGAGAGACCAGG + Intronic
1092288408 12:7143287-7143309 GACAGCAGTGGTGAGGCGCAGGG - Exonic
1092441352 12:8508131-8508153 CAGAGCTGTGCTGAGCAGCCTGG - Intergenic
1094236063 12:28168071-28168093 CATAGCAGTGGTGGGAAGTGAGG + Intronic
1096403559 12:51326347-51326369 GGGAGAAGTGGGGAGAAGCATGG + Intergenic
1096438890 12:51621667-51621689 CAGAGCAGTAGTGAGTAAGAAGG + Intronic
1096464688 12:51841783-51841805 CAGAGGAGTGGGGAGGAGAAAGG + Intergenic
1096525913 12:52210298-52210320 GGGAGCAGTGGTGAGAAGGCAGG + Intergenic
1096597598 12:52706633-52706655 CAGAGCAGGGGGAAGAAGTAGGG + Intergenic
1096766037 12:53890640-53890662 TAGATCTGTGGAGAGAAGCAAGG - Intergenic
1097125010 12:56767070-56767092 TAGTGCAGTGGTTAGATGCAAGG + Intronic
1097263847 12:57734853-57734875 CAGAGCAGTTGGGAGGATCAGGG + Intronic
1097502809 12:60427322-60427344 CAGAGCAGAGATGAGAGCCATGG - Intergenic
1098685641 12:73416419-73416441 CAGAGACATGGTGAGAAGGACGG + Intergenic
1098986459 12:77017718-77017740 CAGAGGAGTGGGGAGAAGAAGGG + Intergenic
1100234128 12:92640971-92640993 CAGAGCAGTGGTCACAGGGAGGG + Intergenic
1100745003 12:97635868-97635890 CAGTGTAGTGATGAAAAGCATGG + Intergenic
1100915217 12:99412638-99412660 CATAGCAGTGATGAAAAACAGGG - Intronic
1101334436 12:103783950-103783972 TAGAGCAGTGCTCTGAAGCATGG + Intronic
1101737165 12:107471754-107471776 CAGAGCCGTGGTGAGGCTCAGGG + Intronic
1101750036 12:107576035-107576057 CAGTGCTGTGGTTAGGAGCACGG - Intronic
1101825167 12:108214685-108214707 CAGTGCAGTGGTCAGCACCATGG - Intronic
1101979517 12:109393507-109393529 CAGATGCGTGGTGAGAAGGAAGG - Intronic
1103066223 12:117899912-117899934 CCGAACAGTGGTAAGAAGCTGGG + Intronic
1103175105 12:118856116-118856138 AAGAGCAGAGGTGAGAATCCAGG + Intergenic
1103500843 12:121400436-121400458 CCGAGCGGTGGGGAGAAGCCGGG + Intronic
1104676805 12:130716703-130716725 CAGAGCTGTGGTGAAAAGCTCGG + Intergenic
1104701368 12:130906915-130906937 AAGTGCAGTAGTGAGAAGGAGGG - Intergenic
1104726126 12:131076731-131076753 CACATCAGTGCTGAGAACCAGGG + Intronic
1105582871 13:21717434-21717456 CTGAGCAGTGTTTAAAAGCATGG + Intergenic
1105603705 13:21909789-21909811 CAGGGCAGTGGTAAGAAGAGTGG + Intergenic
1105898040 13:24734356-24734378 CAGGGCCTTGGTGAGCAGCACGG - Intergenic
1106255625 13:28019820-28019842 CAGAGCAGTGGGGAGAAAGCAGG - Intronic
1107386098 13:39911172-39911194 CAGAGCTGAGGAGAAAAGCAGGG + Intergenic
1107864704 13:44692444-44692466 CACAGCAGTGGAAAGCAGCAGGG - Intergenic
1108718851 13:53109283-53109305 CATAGCAGTGGTGAGTAAAATGG + Intergenic
1109272370 13:60268709-60268731 CAGTGCAGTGGTGAGAGGAGGGG - Intergenic
1110357326 13:74582324-74582346 CAGAGCAGTGTGGAAAAGGATGG + Intergenic
1111054181 13:82926192-82926214 CAGAGTACTAGTGGGAAGCATGG - Intergenic
1111420064 13:88000043-88000065 CAGAGCCCTGAGGAGAAGCATGG - Intergenic
1112039618 13:95533815-95533837 CAGAGTGGAGGGGAGAAGCAGGG - Intronic
1112741529 13:102478842-102478864 CAGAGAAGTGGAGAGTAGAATGG - Intergenic
1113053499 13:106240693-106240715 CAGAGCAGTGCTGAGTTGAATGG + Intergenic
1113462437 13:110491534-110491556 CTGAGAATTGGAGAGAAGCATGG + Intronic
1113531667 13:111032010-111032032 GTGAGCAGTGGTGTGAAGCTTGG - Intergenic
1115100306 14:29690436-29690458 CAGAAAAGTGGAAAGAAGCAAGG - Intronic
1115161300 14:30398848-30398870 CAGAGCAGGGCAGAGAAGAACGG - Intergenic
1115521974 14:34241973-34241995 CAGAGCAGAAGTGTGAAGAAGGG - Intronic
1115789139 14:36859138-36859160 CAGAGTAGCGGTGTCAAGCAGGG - Intronic
1116764544 14:49054036-49054058 CAGAGCACTGGGGAAAATCATGG - Intergenic
1117643119 14:57821870-57821892 CAGAACAGTTGGGAGAAGCTGGG + Intronic
1117729627 14:58709317-58709339 CAGATAAGTGGTGAGGAGCTGGG - Intergenic
1118482518 14:66181245-66181267 CATGGCAGGAGTGAGAAGCAGGG + Intergenic
1118730516 14:68662891-68662913 CAGAGCAGTGGGGAGGAGGATGG - Intronic
1119258866 14:73224842-73224864 TTGAGCAGGGTTGAGAAGCAAGG + Intergenic
1119541460 14:75440984-75441006 CAGAGCTCTGGTTAGAAGCCTGG - Intronic
1121846736 14:97178647-97178669 CAGCACAGGGGTTAGAAGCAAGG + Intergenic
1121859207 14:97300524-97300546 CAGAGCGCCAGTGAGAAGCATGG + Intergenic
1122103127 14:99429399-99429421 AGGAGCACTGGTGAGACGCAGGG + Intronic
1122178874 14:99940121-99940143 GAGAGCTGTGGGGAGCAGCATGG + Exonic
1122194452 14:100074647-100074669 CAGTGCTGTGCTGGGAAGCAAGG - Intronic
1122543742 14:102511143-102511165 CAGAGCAGTCCTGAGAGGCCAGG + Intergenic
1123178462 14:106444124-106444146 AGGACCAGTGGTTAGAAGCACGG - Intergenic
1123520944 15:21072808-21072830 CAGAGCAGCGGGAAGCAGCATGG - Intergenic
1123580310 15:21709230-21709252 CAGAGAAGTAGAGAGAAGAATGG + Intergenic
1123616958 15:22151853-22151875 CAGAGAAGTAGAGAGAAGAATGG + Intergenic
1123678299 15:22735384-22735406 CAGAGCAGTGCTGAGCACCTTGG + Intergenic
1123901804 15:24884532-24884554 CAGCACAGTGGTGAGAAACGTGG - Intronic
1124330490 15:28809653-28809675 CAGAGCAGTGCTGAGCACCTTGG + Intergenic
1125124869 15:36208409-36208431 AAGAGGAGTGATGAGAGGCATGG + Intergenic
1125281355 15:38045223-38045245 CAGAGCAGGGTGGAGAAGGATGG - Intergenic
1125352317 15:38780875-38780897 CAGAGCAGGGCTGAGAAGGCTGG - Intergenic
1126794131 15:52245890-52245912 CAGAGCTATGCTGAGAACCAAGG - Intronic
1127313977 15:57777309-57777331 AAGCTCAGTGGTGAGAACCAAGG + Intronic
1127668629 15:61173299-61173321 CAGTGCAGTGGTTAAAAGCATGG - Intronic
1128036517 15:64531446-64531468 CAGTGCAGTGGCGACAATCATGG + Intronic
1128245755 15:66131585-66131607 CAGTACAGTGGTGGGCAGCATGG + Intronic
1129150014 15:73682690-73682712 CAGGGCAGTGGGGAGCAGCGTGG + Intergenic
1129476787 15:75791181-75791203 CAGAGCAGGGGTGATAGTCAGGG - Intergenic
1129727436 15:77908776-77908798 CAGAGCAGGGGTGATAGTCAGGG + Intergenic
1130036170 15:80363375-80363397 CAGAACAGTGAGGAGCAGCAGGG - Intronic
1130074414 15:80676351-80676373 AGGAGCAGTAGTGTGAAGCATGG - Intergenic
1130075322 15:80683995-80684017 TACAGCAGTGGTTAAAAGCAAGG + Intronic
1131000479 15:88936074-88936096 CAAAGGGGTGGTCAGAAGCAGGG - Intergenic
1131934325 15:97486215-97486237 CACAGAAGTGGTGATAAGGATGG + Intergenic
1132185544 15:99799276-99799298 CAGAGCAGGGGTGATAGTCAGGG - Intergenic
1132431451 15:101765265-101765287 CAGAGCAGGGGTGATAGTCAGGG + Intergenic
1202989180 15_KI270727v1_random:443475-443497 CAGAGAAGTAGAGAGAAGAATGG + Intergenic
1133099297 16:3469598-3469620 CAGTGCAGTGCGGAGCAGCAAGG - Intronic
1133280730 16:4663766-4663788 CAGAGCAGTGCTGGGGAGCAGGG + Intronic
1133306430 16:4812443-4812465 CACAGCAGTGATGAGACGCTGGG + Intronic
1133409015 16:5552530-5552552 CAGAGAAGTGGTTAGAAGCCTGG + Intergenic
1135522462 16:23187849-23187871 CAGAGCAGGGGTGGGGAGAAGGG + Intronic
1136163232 16:28435280-28435302 CAGAGCAGTGGTGGGCTGAAGGG - Intergenic
1136199733 16:28679707-28679729 CAGAGCAGTGGTGGGCTGAAGGG + Intergenic
1136216081 16:28793880-28793902 CAGAGCAGTGGTGGGCTGAAGGG + Intergenic
1136279293 16:29198614-29198636 CAGGGCAGTGGTGAGAAAGCAGG + Intergenic
1137031492 16:35528310-35528332 CATGGCAGTGGTGAGAAGGATGG + Intergenic
1137413045 16:48245255-48245277 AGGAGCAGAGGTGAGAAGCTAGG - Intronic
1137447338 16:48539827-48539849 GAGGGAAGTGGTGGGAAGCAGGG + Exonic
1137461804 16:48671396-48671418 CAGAGGAATGGGGAGAATCATGG - Intergenic
1137716122 16:50599300-50599322 CAGGGCAGTTGTGAGAGGAATGG - Intronic
1137902105 16:52279883-52279905 CAGTGTAGTGGGGAGGAGCAGGG + Intergenic
1139658068 16:68401192-68401214 CAGAAAAGGGGTGAGACGCAGGG - Intronic
1141530505 16:84643355-84643377 CAGACCTTTGGTGAGAAGCAGGG + Intergenic
1142350231 16:89576248-89576270 CAGAGCTGTGGGGAGAGGCTGGG + Intronic
1142755613 17:2014903-2014925 CAAAGCAGTGGGGAGAAAGAAGG + Intronic
1142899250 17:3002304-3002326 CAGAGGGGTGATGAGAAGCAGGG + Intronic
1143122415 17:4617099-4617121 CAGAGACGTGCTGAGAAGCTGGG + Intergenic
1143140884 17:4741131-4741153 CAGAGGAGTGGTAAGAACCCAGG + Exonic
1143622910 17:8091228-8091250 CTGAGGCTTGGTGAGAAGCAGGG + Intergenic
1143876497 17:9995060-9995082 CTGAGCACTGGGGAGCAGCAGGG + Intronic
1144574860 17:16423007-16423029 CAGCCTAGTGGTTAGAAGCAGGG - Intronic
1146395632 17:32463387-32463409 AAGTGCAGTAGTGAGAAGCAGGG + Intronic
1146466806 17:33092666-33092688 CAGAGCAGGGGCTAGAAGCCAGG + Intronic
1146701101 17:34961123-34961145 CAGAGCAGGGATGAGAATGAGGG + Intronic
1147261785 17:39213175-39213197 GAAAGCAGTGGTGGGCAGCAGGG - Intronic
1147332838 17:39709044-39709066 CAGAGTAGAGGTGAGAAGGAAGG + Intronic
1147433584 17:40391244-40391266 AAGTGCAGTAGTGAGAAGGAGGG + Intronic
1147801884 17:43097444-43097466 CAGAGAAGTGGTTAAAGGCATGG + Intronic
1147842825 17:43384404-43384426 AAGAGCAGGGGAGAGAAGAATGG - Intergenic
1147871184 17:43588752-43588774 GAGAGCAGGGCTGACAAGCAGGG - Intergenic
1147953139 17:44118061-44118083 CATAGCAGTGGGGAGATGCAGGG + Intronic
1149003345 17:51779229-51779251 CAGAGCAGGGGTAACAAACAGGG - Intronic
1150166136 17:62945379-62945401 AAAAGCAGTGGTGATAAGAATGG - Intergenic
1151552768 17:74831576-74831598 GAGAGCAGCAGTGAGAAGCTGGG - Intronic
1151553221 17:74833963-74833985 CAGAGCAGAGCTGAGCAGGATGG - Intronic
1151961773 17:77409417-77409439 CCGTGCAGTGGTGAGAGGAAAGG + Intronic
1152425866 17:80218413-80218435 CAGAGCAGGGGGAAGAAGCTTGG - Intronic
1153413297 18:4817831-4817853 CAGTGCAGTGGAGAGAATAATGG - Intergenic
1153523604 18:5975079-5975101 TAGAGCAGAGGTGGGAAGGATGG - Intronic
1153837801 18:8979853-8979875 AAGAACAGTGATTAGAAGCAGGG - Intergenic
1154935699 18:21053993-21054015 CTGAGCAGCAGTGTGAAGCAAGG + Intronic
1155386363 18:25282301-25282323 GAGAGGAGTAGGGAGAAGCAGGG + Intronic
1155391807 18:25346778-25346800 GAGAGGAGTGGTGGGAACCAGGG - Intronic
1155447516 18:25927755-25927777 CAGGGCTGTGGTGAGAAATATGG + Intergenic
1156147512 18:34203246-34203268 CAGATCAGTGGTTAGGAACAGGG + Intronic
1156232896 18:35172197-35172219 CAGAGCTGGGGTGAGCAGCTGGG + Intergenic
1157454628 18:47814921-47814943 CAGAGTTGTGGTCAGGAGCAGGG + Exonic
1158967906 18:62638603-62638625 CTGAGCTGGTGTGAGAAGCAGGG - Intergenic
1160095684 18:75870387-75870409 AAGAGGTGAGGTGAGAAGCATGG + Intergenic
1161476179 19:4486883-4486905 CAGAGGAGTTGTCAGAAGCATGG - Intronic
1161520647 19:4721878-4721900 CAGTCCAGTGGTGAAAAGCGTGG + Intronic
1163720812 19:18897342-18897364 CAGAGAAGTGGCCAGATGCAGGG - Intergenic
1164300027 19:23953910-23953932 GACAGTAGTGGTGTGAAGCAAGG + Intergenic
1164621811 19:29700587-29700609 CAGGGCAGGGGTGGGAAGGAGGG - Intronic
1164778869 19:30876396-30876418 CAGAGCAGTGGGGAGGAGTGAGG + Intergenic
1164819051 19:31230674-31230696 AAAAGCAGTGATGGGAAGCAGGG - Intergenic
1164949142 19:32321731-32321753 CTGTGCAGTGGTTAGAAGCAGGG - Intergenic
1165195759 19:34101756-34101778 CAGTGCAGTGGTGTGAATCTTGG - Intergenic
1165383576 19:35497378-35497400 CAGTGCAGTGGGAAGAAACAAGG + Exonic
1165411587 19:35665701-35665723 CAGAGCAGTGGGGAGATGAGGGG - Intergenic
1165650866 19:37488429-37488451 CAGAACAGTGGTGACCTGCAGGG + Exonic
1166179399 19:41096118-41096140 CAGAGCTGTGATGAGAGGAAGGG + Exonic
1167161087 19:47767449-47767471 CAGGGCATTGGTTAGTAGCATGG + Intergenic
1167786654 19:51643359-51643381 CAGAGCAGGGCTGAGAGGCCTGG - Exonic
1168191696 19:54742990-54743012 CAGAGGAGTGGTGAGAATGATGG + Intronic
1168193970 19:54759622-54759644 CAGAGGAGTGGTGAGAATGATGG + Intronic
1168196015 19:54774347-54774369 CAGAGGAGTGGTGAGAATGATGG + Intronic
1168197913 19:54789210-54789232 CAGAGAAGTGGAGAGAACAATGG + Intronic
1168204379 19:54838591-54838613 CAGAGAAGTGGAGAGAATGATGG + Intronic
1202684029 1_KI270712v1_random:32438-32460 CAAGGCAGCGGTGAGAGGCAAGG - Intergenic
925179724 2:1809222-1809244 CAGGGAAGTGGTGGTAAGCAAGG + Intronic
926801206 2:16662659-16662681 CAGGGTAGGGGAGAGAAGCATGG - Intronic
927139950 2:20123073-20123095 CAGAGCAGAGGTGATGTGCATGG - Intergenic
927411996 2:22837006-22837028 TAGGGCAGAGGGGAGAAGCAAGG + Intergenic
927510452 2:23641063-23641085 CAGAGCAGCTGTGAAAACCAAGG + Intronic
928514616 2:32034078-32034100 CAGAGCACTGAAGAGAAGAAAGG + Intronic
929545626 2:42853741-42853763 CAGAGCTGTGATTTGAAGCACGG - Intergenic
929766016 2:44844531-44844553 CAGAGTTGTTGTGAGAACCAGGG - Intergenic
931057645 2:58490786-58490808 CAGAAGAGTGGTGGGAAACAAGG - Intergenic
933727597 2:85435558-85435580 CCGAGCAGTGGGGAGCAGGAGGG + Intronic
934247689 2:90322415-90322437 CAAGGCAGCGGTGAGAGGCAAGG + Intergenic
934261634 2:91480186-91480208 CAAGGCAGCGGTGAGAGGCAAGG - Intergenic
934304674 2:91811169-91811191 CAAGGCAGTGGTGAGAGGCAAGG - Intergenic
934328583 2:92041581-92041603 CAAGGCAGTGGTGAGAGGCAAGG + Intergenic
934466959 2:94272090-94272112 CAAGGCAGCGGTGAGAGGCAAGG + Intergenic
934620393 2:95799873-95799895 CAAAGCAGGGCTGAGCAGCAGGG - Intergenic
934755016 2:96818760-96818782 GAGTGCAGGTGTGAGAAGCATGG - Intronic
934990444 2:98916764-98916786 CAGAGAAGGGGTGAGAGGCCAGG + Intronic
936154193 2:110037504-110037526 CAGGGCAGTGGTGACTGGCAGGG + Intergenic
936190491 2:110333911-110333933 CAGGGCAGTGGTGACTGGCAGGG - Intergenic
936351350 2:111715043-111715065 GAGGCCAGTGGAGAGAAGCAAGG + Intergenic
936600968 2:113893991-113894013 AAGAGCAGTGGGGAAAAGCTGGG + Intronic
937256240 2:120557847-120557869 CCGAGCTGTGGTGTGGAGCAAGG - Intergenic
939502177 2:143001532-143001554 AAGAGCAGAGGTGAAAAGTAGGG - Intronic
940143515 2:150521753-150521775 GAGAGCAATGGTGAGAAAAAAGG - Intronic
940398537 2:153221629-153221651 CAGGCCAGTAGTGAGAACCAAGG - Intergenic
940904636 2:159158058-159158080 CAGAGCAGTGTAGAGAGGCCGGG + Intronic
941225375 2:162840357-162840379 CTGAGAAGGGCTGAGAAGCAGGG + Intergenic
941489250 2:166123501-166123523 AAGAGCAGTAGTGAGAAGAGGGG + Intronic
941658282 2:168167861-168167883 CACAGCAGTCCTGAGAAACAGGG - Intronic
942311599 2:174661792-174661814 CAGAGGAGTGAAGAGGAGCAAGG + Intronic
942336171 2:174888735-174888757 GAGAGCAGTGGGGAGAAGAGTGG + Intronic
944404536 2:199368184-199368206 CAGAGCAGTGGTGAAAACACGGG - Intronic
945154063 2:206819141-206819163 CAGAGCCATGGAGAGAAGCTGGG - Intergenic
945181183 2:207092932-207092954 CAGGGCAGTGGCCAGAAGTAGGG - Intronic
945682438 2:212930312-212930334 CAGAGCAGTGGTGGGGATCTGGG - Intergenic
946187062 2:217987102-217987124 CACAGAGGTTGTGAGAAGCAGGG + Intronic
946361279 2:219220590-219220612 CAGAGCAGTTGAGAAAAGAAGGG + Intronic
946422645 2:219573233-219573255 CAGCACAGTGGGGAGAAGGATGG + Intronic
947158085 2:227183926-227183948 CAGGGCTGTTGTGAGAATCAAGG - Intronic
947579060 2:231300702-231300724 TAGGGCAGTGGTTAGGAGCATGG - Intronic
948222932 2:236287781-236287803 CAGAGAAGTGGGGATCAGCACGG + Intergenic
948231425 2:236351935-236351957 CAGAGAAGAGGAGAGAGGCAAGG + Intronic
948267588 2:236646955-236646977 AAGAGGAGTGGAGAGGAGCAAGG + Intergenic
948293483 2:236844538-236844560 CATAGCAGTAGAGAGGAGCAAGG + Intergenic
948362799 2:237434798-237434820 CAGAGCAGTGCTGGCAAGCCTGG + Intergenic
948523288 2:238554997-238555019 CAGGGCAGGGCTGAGTAGCAGGG - Intergenic
948552823 2:238785884-238785906 AAGAGCAGGGGCCAGAAGCAGGG + Intergenic
948688286 2:239685503-239685525 CACAGCACTGCTGAGAAGCCAGG + Intergenic
1168997859 20:2146157-2146179 CAGGGGAGGGGTAAGAAGCAAGG - Exonic
1170227438 20:14007368-14007390 CAGAGAAGAGGAGAGAAGGAAGG - Intronic
1170429531 20:16263713-16263735 CATAGCAGAGGAGAGAAGGATGG - Intergenic
1170798311 20:19569522-19569544 CAGAGCAGGGCAGAGAAGAATGG - Intronic
1171302098 20:24072048-24072070 CAGAGCTGGGGAGAGAGGCATGG + Intergenic
1172202218 20:33134447-33134469 CAAAGCAGTTGTGCAAAGCAGGG - Intergenic
1172258833 20:33543705-33543727 CAGAGCAGTGGTCAGGAGACTGG - Intronic
1172557297 20:35853264-35853286 GAAAGCAGTTGTGAGAAGAAAGG + Intronic
1172772786 20:37391353-37391375 CAGAGCAAGAGTGAGAAGCAGGG - Intronic
1173150147 20:40560365-40560387 CAAAGGAGTGGTGGGAAGGATGG + Intergenic
1173419592 20:42889206-42889228 CTCAGCAGAGGGGAGAAGCAAGG - Intronic
1173452490 20:43177355-43177377 CAAAGCAGTGGTTAGAACTAAGG + Intronic
1173560643 20:44003050-44003072 CAGTGCAGTGGTTAGGAGCCAGG - Intronic
1173988966 20:47285194-47285216 CAGTGCAGTGGTGACCTGCATGG - Intronic
1175050315 20:56149646-56149668 AAGTGCAGTGGTGAGGTGCATGG - Intergenic
1175248000 20:57592848-57592870 CAGAGCAGGGATGCGAAGCCGGG + Intergenic
1175374919 20:58517549-58517571 CAGCGCGGTGGTTGGAAGCAGGG - Intergenic
1175552524 20:59826574-59826596 GAGAGCAGGTGTGAGAGGCAGGG - Intronic
1175572388 20:60033881-60033903 CAGGCCAGTGGTGAGAAACATGG - Intronic
1176273897 20:64252729-64252751 CAGATGAGTGGAGAGATGCAAGG + Intergenic
1176586982 21:8596545-8596567 CAAGGCAGCGGTGAGAGGCAAGG - Intergenic
1177244036 21:18498759-18498781 CAGAGCAAGGCTGAGAAGGATGG + Intergenic
1177749312 21:25260158-25260180 CAGCGCATTGCTCAGAAGCAAGG + Intergenic
1180269811 22:10573542-10573564 CAAGGCAGCGGTGAGAGGCAAGG - Intergenic
1180468775 22:15638195-15638217 CACAGCAGTGGTCAGGAGTAGGG + Intergenic
1180995192 22:19962042-19962064 CAGAGCATGGGTGACCAGCACGG + Intronic
1181019694 22:20092981-20093003 CTGAGCAGTGGTGACAAGTGGGG + Intronic
1181038544 22:20181420-20181442 CACAGCAGTGGGGAGGGGCAGGG + Intergenic
1181080001 22:20407504-20407526 CAGTGCAGTGCTGTGAATCATGG - Exonic
1181107931 22:20585658-20585680 CAGAGCAGGGCTGTGAGGCAGGG + Intronic
1181732839 22:24859936-24859958 CAGAGGAGGGGGCAGAAGCAGGG - Intronic
1182498413 22:30727490-30727512 CAGAGAAGAGGTGAGAACAAGGG + Intronic
1184028003 22:41872357-41872379 CAGAGCGGTGGTGACAAGGAGGG + Intronic
1184735205 22:46393949-46393971 CAGAGCACGGGGGAGCAGCAAGG + Intronic
1184845127 22:47078203-47078225 CAGTGCCGTGGAGAGAAACAGGG + Intronic
1185043759 22:48518632-48518654 CAGAGCAGGGGTGCTCAGCAGGG + Intronic
1185400608 22:50613666-50613688 CAGAGCAGAAGTGGGATGCAGGG - Intronic
950283412 3:11725830-11725852 CAGTCCAGTGATGAGAAACATGG + Intergenic
950401946 3:12775678-12775700 GAGAGAAGTGGTGAGGAGCAAGG - Intergenic
950600929 3:14035133-14035155 CAGAGCTGTGGTGGGCAGCCTGG - Intronic
951569183 3:24044301-24044323 GAGAGCAGTGGGCAGAAGCCAGG + Intergenic
953736871 3:45502454-45502476 CAGATCAGTGGGGAAAAGGATGG - Intronic
953774421 3:45803398-45803420 CAGAGGAGAGGAGAGAAGGAAGG - Intergenic
954477635 3:50763330-50763352 GAGTGCAGTGGTGAGATACACGG + Intronic
954663043 3:52236386-52236408 CAGGGCAGAGGTGAGGACCATGG + Intronic
954774012 3:52999610-52999632 CACAGCAGTGGTTAGGGGCAAGG - Intronic
955094121 3:55780807-55780829 CAGAGCTGTGGTCAAGAGCATGG - Intronic
955460827 3:59181327-59181349 TAGTGCTGTGGTGAAAAGCATGG - Intergenic
955784959 3:62527646-62527668 CAGAGCAGTTGGGAGAAACTTGG + Intronic
955863777 3:63360295-63360317 GTGAGCAGTGGTCAGAATCAGGG - Intronic
956421682 3:69092414-69092436 CAGAGCTGTGGAGAGAAGACAGG - Intronic
956914475 3:73856693-73856715 TAGTGTAGTGGTTAGAAGCAAGG + Intergenic
957796829 3:85019794-85019816 GAGAACAGTGTTGTGAAGCAGGG + Intronic
958057518 3:88431276-88431298 AAGTGCAGTAGTGAGAAGAAGGG - Intergenic
958685021 3:97381582-97381604 CAGAGCAATCAAGAGAAGCAGGG - Intronic
958996956 3:100915888-100915910 CAGAGCATTCGAGTGAAGCAGGG - Intronic
960213389 3:114999071-114999093 CAGAGGAGAGGAGAGGAGCAGGG + Intronic
960315816 3:116175526-116175548 CAGAGCAGTGCTGGGAAGCCAGG + Intronic
960926479 3:122799515-122799537 CAGAGAGGTGGTGAGAGGCCAGG + Intronic
961078523 3:124004214-124004236 TAGAGCAATGGTGGGAGGCATGG - Intergenic
961304952 3:125952233-125952255 CAGAGCAATGGTGGGAGGCATGG + Intergenic
961442720 3:126962411-126962433 AAGAGCAGAGCTGGGAAGCAAGG + Intergenic
961800040 3:129440362-129440384 CCGAGCACTGGTGAGGAGCGGGG + Exonic
962853298 3:139323852-139323874 CTGAGGAGGGGTGGGAAGCAGGG - Intronic
963381074 3:144530966-144530988 CTGAGCAGTAGTGAGTATCAAGG - Intergenic
963853107 3:150227169-150227191 CAGAGAACTGGTGAGAATCCAGG + Intergenic
964354290 3:155835779-155835801 CAGATCTGTGGTGAAATGCAAGG - Intronic
965113005 3:164451335-164451357 CAGAGCTGTGGTGTGCAGCTTGG - Intergenic
966154624 3:176902510-176902532 CACAGGAGTGGGGACAAGCAGGG + Intergenic
966213288 3:177475230-177475252 CAGAGCTGGGATGAGAACCAAGG - Intergenic
966555185 3:181251167-181251189 CAGAGGAATGGTGAGAATGAGGG - Intergenic
966731867 3:183158372-183158394 GAGGGCAGTGGGCAGAAGCAAGG + Intronic
967172508 3:186833003-186833025 CAGAGCAGGGGCTAGAAGCCAGG + Intergenic
967267400 3:187702490-187702512 AAGAGCAGTTGGGTGAAGCAGGG - Exonic
967546226 3:190732030-190732052 CTGTGCAGTGGGGAGAAGCCTGG - Intergenic
968234830 3:197025367-197025389 CAGAGGATTGGTAAGAAACAAGG - Intronic
969576346 4:8038309-8038331 GAGAGCTGTGGTGGGGAGCATGG - Intronic
970174402 4:13324211-13324233 CACTGCAGTAGAGAGAAGCAGGG + Intergenic
970415477 4:15852725-15852747 CAGAGAAGTGGTGATTAGCTTGG + Exonic
970536444 4:17034752-17034774 CAAAGCAATGGTGAGGAGAATGG - Intergenic
971089466 4:23324032-23324054 CTGAGCAGTGGTGAGTTTCATGG + Intergenic
971809528 4:31406161-31406183 CAGAGTAGTGGGGATGAGCAGGG + Intergenic
972292231 4:37699907-37699929 AAGTGCAGTAGTGAGAAGGAAGG + Intergenic
972723565 4:41725363-41725385 AAAAGCAGTGGTGAGGGGCAGGG + Intergenic
973257376 4:48127098-48127120 AAGAACAGTGGTGAGCAGGAAGG + Intronic
973961924 4:56119191-56119213 CAGAGTAGTGGTTAAGAGCATGG - Intergenic
974992937 4:69115692-69115714 CAGTGCAGTGGTGGGATGAAGGG + Intronic
975250619 4:72174259-72174281 CAAAGCATTAGTTAGAAGCAGGG - Intergenic
975426744 4:74238254-74238276 TAGAGCAGTTCTGAGAAGGAAGG + Intronic
975555448 4:75659823-75659845 AAGAGTAGTGGTTAAAAGCATGG - Intronic
975758868 4:77598322-77598344 GAGAGCAGTGGGGAGTAACAGGG + Intronic
975983574 4:80184192-80184214 CAGAGCACCCGCGAGAAGCAGGG + Intronic
977356150 4:95949547-95949569 CAGATCAGAGATGAGATGCAGGG + Intergenic
977666154 4:99649573-99649595 CAGAGCATTGGTGGGCAGCACGG + Exonic
977735349 4:100408610-100408632 CAGAGCACTGAGGGGAAGCATGG - Intronic
979170935 4:117600666-117600688 CACAGCAGTCCTGAGAAACATGG - Intergenic
979561212 4:122104175-122104197 CAGAGAATTGGTGAGAAGGCTGG + Intergenic
979829290 4:125280861-125280883 CAGTGCAGTGGTGAGCTGAAGGG - Intergenic
980475530 4:133309857-133309879 CAGAGCTGTGGTCTGAAGCATGG + Intergenic
982304141 4:153911818-153911840 CAGAGCAGAGTAGAGAAGCATGG + Intergenic
982763918 4:159321586-159321608 CAGAGCCATGGTGAGGAGTAAGG + Intronic
984626326 4:182011407-182011429 CAGAGTTGTGGTGAGATACAGGG - Intergenic
984788470 4:183591874-183591896 CAGCTCAGTGATGGGAAGCAAGG + Intergenic
984840357 4:184062023-184062045 CTGAGCCCTGGTGAGAGGCAGGG + Intergenic
984935363 4:184884666-184884688 CTGAGCAGTGCTGAGAATCCAGG - Intergenic
985544989 5:504965-504987 GAGCCCAGTGCTGAGAAGCAGGG + Intronic
985938100 5:3112002-3112024 CAGAGCAGAGGTGGGACTCAGGG - Intergenic
986048629 5:4065754-4065776 CTGAAGAGTGGTGAGGAGCAAGG + Intergenic
986104342 5:4645411-4645433 CAGAGCCATGCTGAGGAGCAGGG + Intergenic
986340429 5:6784492-6784514 GGGAGCAGTGGAGAGAACCAGGG + Intergenic
986463717 5:7999223-7999245 AAGAGCTGGGGTGAGAAGCATGG - Intergenic
986694139 5:10337352-10337374 AAGTGCAGTGGTGAGAAGCGGGG - Intergenic
987151903 5:15050064-15050086 CAGAGAGGTGGTGACAAGTAAGG + Intergenic
987362210 5:17117588-17117610 AAGTGCAGTAGTGAGAAGGAGGG + Intronic
987939013 5:24508568-24508590 GAGAGCAGTGGTGTGAATGAAGG + Intronic
989180216 5:38568946-38568968 CTGAGCTGTGGTGAGAGGTAGGG + Intronic
989714516 5:44445737-44445759 CTGAACACTGCTGAGAAGCAGGG - Intergenic
990147035 5:52773856-52773878 TAGAACAGTGGAGAGAATCAGGG - Intergenic
990246384 5:53867410-53867432 CAGAGCAGTGGGAAAGAGCACGG - Intergenic
991303449 5:65151204-65151226 CACAGCAGTGTTCAGAACCAGGG + Exonic
992410248 5:76498484-76498506 AGGAGCTGTGGTGAAAAGCAGGG + Intronic
992735547 5:79715637-79715659 CAGAGCAGGGGTTAGAATCCAGG + Intronic
992816125 5:80440971-80440993 CAGAGCAGAGGTCAACAGCAGGG - Intronic
993692774 5:91023335-91023357 CAGAGCCCAGGTGAAAAGCAAGG + Intronic
995313481 5:110739393-110739415 CAGAGCAGTGGTGAGAAGCATGG + Exonic
995854116 5:116574802-116574824 CAGAGGAGTAGTGAGCGGCACGG - Exonic
996303932 5:122024315-122024337 CAGTTCAGTGGTGGGTAGCAAGG - Intronic
996582460 5:125047070-125047092 CAGAGCAGTGCAGAGAAGGTGGG + Intergenic
997206377 5:132052628-132052650 GAGAGCTGTGGTGAGAACCAAGG + Intergenic
997291052 5:132735934-132735956 AAGGCCAGTGGTGAGGAGCATGG - Intronic
997698609 5:135880722-135880744 CAGAACAGTGGTGAGGAGTGAGG - Intronic
997962870 5:138335914-138335936 CAGCTTAGTGGTGAAAAGCAAGG + Intronic
998059416 5:139107955-139107977 CAGAGCAGAGGTGTGAACCCAGG + Intronic
998201974 5:140132162-140132184 AAGAGCAGTGGAGAGAGGCCTGG - Intergenic
998666871 5:144307648-144307670 TAGACTAGTGATGAGAAGCATGG - Intronic
999049679 5:148509015-148509037 TAGAGTAGTGGTTAAAAGCATGG - Intronic
999120332 5:149204839-149204861 CAGCGCAGTGGTTAGAGGCTGGG - Intronic
999501298 5:152149122-152149144 CAGTGCTGTGGTGGGAAGAAGGG - Intergenic
1001148142 5:169202925-169202947 CAGGGCAGGGGTCAGAGGCAAGG - Intronic
1001154341 5:169260103-169260125 AAGTGCAGTTGTGAGAAGGAGGG - Intronic
1001358288 5:171054532-171054554 AAGAGCAGTGAGGATAAGCAGGG + Intronic
1002102118 5:176862836-176862858 GGGAGCAGTGGTGAGCCGCATGG + Exonic
1002292368 5:178208768-178208790 CAGACCAGTGGTTAGGAGGAGGG + Exonic
1004129454 6:12905044-12905066 CAGTGCAGGGTTGAGAAACATGG - Intronic
1004317812 6:14605883-14605905 TAGACCAGGGGAGAGAAGCAAGG - Intergenic
1004433769 6:15569979-15570001 CAGAGAAGGGGTGAGAGGGAGGG - Intronic
1006097186 6:31663367-31663389 AAGTGCAGTAGTGAGAAGGAGGG - Intronic
1006178359 6:32137759-32137781 CAGAGAGGTGGGGAGAAACAAGG + Intergenic
1006796596 6:36736029-36736051 CAGAGTGGGGGTGAGAAGAAAGG + Intergenic
1007268641 6:40618497-40618519 CAGAGGAGTGGTTAGAAGCCTGG + Intergenic
1007389073 6:41539534-41539556 CAGAGTAGAGATGAGAAGAATGG + Intergenic
1007758848 6:44119911-44119933 CAGTGCGGTGTTGAGAGGCAGGG - Intronic
1008532518 6:52476840-52476862 AAGAGCATTTGTGAGAAACAGGG + Intronic
1008816094 6:55568630-55568652 CAGAACAGTGGTGGGAAACTGGG + Intronic
1008870633 6:56268460-56268482 GAGAGTAGTGGTGGGAAGAATGG - Intronic
1009901634 6:69813956-69813978 CAGAGCAGAGTGGAGAAGGATGG + Intergenic
1010507745 6:76681132-76681154 CACAGCAGTGGAGAGGAGGATGG + Intergenic
1011735861 6:90310163-90310185 CAGACCAGAGGTGAGCAGCCTGG + Intergenic
1012276173 6:97278022-97278044 CAGTGCAGTGTTTAGAATCATGG - Intronic
1012466942 6:99526171-99526193 AAGTGCAGTAGTGAGAAGGAGGG - Intergenic
1013139412 6:107317023-107317045 TAGAGCAGTAGTGACCAGCATGG - Intronic
1013702725 6:112793656-112793678 CAGACCAGTAGAGAGAAGGATGG - Intergenic
1016906560 6:149156528-149156550 CAGTGGAGTGTTGACAAGCATGG + Intergenic
1016956451 6:149631515-149631537 AAGGGCAGTAGTGAGAAGGAGGG - Intronic
1017134206 6:151134058-151134080 CAGAGACGTGGAGGGAAGCAGGG - Intergenic
1017364774 6:153622405-153622427 CAGAGCAGTGGAGAAACCCAAGG + Intergenic
1017582355 6:155880094-155880116 CAGGGCAGTGATGAAGAGCACGG + Intergenic
1017770379 6:157639693-157639715 CAGCTCAGTAGGGAGAAGCAGGG + Intronic
1018342710 6:162868464-162868486 CAGCACAGTGGTGAGATGCGCGG + Intronic
1018676058 6:166223265-166223287 CAGATAAGTGGGGAGGAGCAGGG + Intergenic
1019143591 6:169962908-169962930 CAGAGCAGCGGAGAGGAGAAGGG - Intergenic
1019223914 6:170495472-170495494 CAGAGCGGTGGTGAAGAGGATGG + Intergenic
1019223948 6:170495629-170495651 CAGAGCGGTGGTGAAGAGGATGG + Intergenic
1019224135 6:170496466-170496488 CAGAGCGGTGGTGAAGAGGATGG + Intergenic
1019224143 6:170496503-170496525 CAGAGCGGTGGTGAAGAGGATGG + Intergenic
1019224169 6:170496620-170496642 CAGAGCGGTGGTGAAGAGGATGG + Intergenic
1019658369 7:2209934-2209956 CACAGATGTGGTGAGAAGCTGGG - Intronic
1019869622 7:3747762-3747784 CAGAGGAGTGGTAAGAGGCAGGG + Intronic
1021016907 7:15547178-15547200 CATAGCTGAGGTGAGAAGGAAGG - Intronic
1022059184 7:26773922-26773944 CAGTGCTGTGGGGAGAGGCAGGG + Intronic
1022166750 7:27773209-27773231 TACAGCAGTGGTTAAAAGCACGG - Intronic
1022388584 7:29924397-29924419 CTGAGGAGTGGGGAGATGCAGGG - Intronic
1022968910 7:35498959-35498981 CAGAGCAGGGCTGAGAGTCAAGG + Intergenic
1022978022 7:35576248-35576270 CAGAGCTGCTGTGAGAAGGAAGG - Intergenic
1023054556 7:36281083-36281105 CAGAGCACAGGTCAGAAGCGTGG - Intronic
1023452042 7:40296849-40296871 TAGAGTAGTGGTTAGGAGCATGG + Intronic
1026148965 7:67772054-67772076 CAGATCAGTAATGAGAAGCCAGG + Intergenic
1026447555 7:70498916-70498938 CAGGGCAGTGAAGAGACGCAGGG + Intronic
1026566198 7:71491535-71491557 CTGTGCAGTGGAGAGAGGCAGGG + Intronic
1027945963 7:84746621-84746643 CAGAGTAGTGGTGGGAGACAAGG + Intergenic
1029980565 7:104874896-104874918 GAGAGCAGTGGTGAGATCCTAGG + Intronic
1030333271 7:108295878-108295900 CAGAGGAGTGGTGAGGAACAGGG + Intronic
1030642527 7:112022466-112022488 CAGAGTAGCGGTGAGGAGCATGG + Intronic
1031356076 7:120788778-120788800 CAGAGTAATGGTGAGAATCATGG + Exonic
1031512993 7:122671806-122671828 CAGAGGAGTAGTGAGTAGGAAGG + Intronic
1031724095 7:125215647-125215669 CAGAGAAGTGATGGGAATCATGG + Intergenic
1032539198 7:132689364-132689386 CGGAGTAGAGGTGAGAAGAAAGG + Intronic
1032638991 7:133743854-133743876 CTAAGCAGCAGTGAGAAGCAGGG - Intronic
1033320068 7:140331390-140331412 CAGAGCAGAGGAGAGAACCCAGG + Intronic
1034670774 7:152856553-152856575 CAGAGCAGAGGTGGGAATGACGG - Intergenic
1036659079 8:10696180-10696202 CAGCACAGTGGTCAGAGGCAGGG - Intronic
1036991694 8:13605404-13605426 CAGGGCAGTGGTGAAAAGGACGG - Intergenic
1037478284 8:19278909-19278931 CAGAGCAGGAAAGAGAAGCATGG - Intergenic
1037541825 8:19879585-19879607 CAGAGCTGAGATGAGAAACAGGG - Intergenic
1037559746 8:20062193-20062215 CATACCAGTGGTGAGAAGGGAGG - Intergenic
1037780432 8:21864754-21864776 CAGAGCAGTGGGAAGAAGGTGGG + Intergenic
1038949170 8:32394958-32394980 GAAATCAGTGGTGAGAAGAATGG + Intronic
1040558295 8:48500400-48500422 CAGAGCTGTCCTGAGAAGCCTGG + Intergenic
1040781946 8:51120049-51120071 CAGAGTAGTGGGGGGAAGGATGG - Intergenic
1040783723 8:51140834-51140856 GAGAGAAGTGGTGTGAGGCAGGG - Intergenic
1040860571 8:51994557-51994579 CACAACAGTGGTGGGAAACAGGG - Intergenic
1041340872 8:56844194-56844216 CACAGTGGTGGTCAGAAGCAGGG - Intergenic
1041415083 8:57599083-57599105 CCGAGGTGTGGTGAGAGGCAAGG - Intergenic
1041437796 8:57861498-57861520 CAGAGAAGTAGGGAGCAGCATGG - Intergenic
1041466485 8:58162686-58162708 CAGAGCTGTGGTGGGAAGCCTGG - Intronic
1041904793 8:63020675-63020697 CAGTGCAGAGGCAAGAAGCATGG + Intronic
1042756400 8:72218076-72218098 CATAGGTGTGGTGAGAAGTAGGG - Intergenic
1043152921 8:76741031-76741053 CATAGGAGTGGTGATAAGAAAGG + Intronic
1043500408 8:80848719-80848741 GAGTGCAGTGGTGAGTAGCTGGG - Intronic
1043509007 8:80931542-80931564 CAGAGCCATGATGAAAAGCAAGG - Intergenic
1045128330 8:99119936-99119958 CAGTGCAGTGGTATGAAACATGG + Intronic
1045300168 8:100903851-100903873 CAGGGCAGTTGTAAGAAGTAAGG + Intergenic
1045786649 8:105929138-105929160 GAGTGCAGTAGTGAGAAGCAGGG + Intergenic
1046616878 8:116487561-116487583 CAGAGTGGTAGTGTGAAGCAAGG - Intergenic
1046802342 8:118442353-118442375 CACAGCAGGGTAGAGAAGCAAGG - Intronic
1048873362 8:138816675-138816697 CAGGGCTGTGGTGGGAACCAAGG + Intronic
1049286371 8:141777540-141777562 CAGTGACGTGGTGAAAAGCACGG + Intergenic
1049337895 8:142096220-142096242 CAGAGCAGTGAGGAGGAGCCAGG - Intergenic
1049717135 8:144098411-144098433 CAGCCCAGTGGTGAGCAGCTGGG + Intergenic
1049888721 9:47287-47309 CAGAGCAAGAGTGAGAAGGAGGG + Intergenic
1050176397 9:2873592-2873614 CAGAGATGAGGTGAGAAGCAGGG - Intergenic
1050216661 9:3333486-3333508 TATAGCAGTGATGAGAAGAATGG - Intronic
1050391212 9:5146407-5146429 CAAGGCATTGGTGAGGAGCAGGG + Intronic
1050432806 9:5578994-5579016 CAGAGCAGAGGAGAGGAGGATGG + Intergenic
1050456934 9:5843642-5843664 CAAAGCAGTGGCTAGAAGCGGGG - Intergenic
1050784685 9:9386485-9386507 CAGGGCAGTGGTGAGACTCTTGG + Intronic
1051216987 9:14808576-14808598 CAGAGCAGTTATGAGAAACGAGG + Intronic
1052016671 9:23476699-23476721 AAAAGCAATGGTGAAAAGCACGG - Intergenic
1052863519 9:33451211-33451233 CAGAGCAGGGGAGAAAAACAGGG + Intergenic
1052985977 9:34488308-34488330 CAGTGCAGTGGTTAAGAGCATGG - Intronic
1053697008 9:40648894-40648916 CAAGGCAGTGGTGAGAGGCAAGG + Intergenic
1053870514 9:42487052-42487074 CTGAGCAGTGGAGAGATGGAAGG + Intergenic
1053943404 9:43279033-43279055 CAAGGCAGTGGTGAGAGGCAAGG + Intergenic
1054241032 9:62613312-62613334 CTGAGCAGTGGAGAGATGGAAGG - Intergenic
1054308260 9:63448127-63448149 CAAGGCAGTGGTGAGAGGCAAGG + Intergenic
1054406996 9:64772122-64772144 CAAGGCAGTGGTGAGAGGCAAGG + Intergenic
1054440620 9:65257584-65257606 CAAGGCAGTGGTGAGAGGCAAGG + Intergenic
1054489788 9:65764340-65764362 CAAGGCAGTGGTGAGAGGCAAGG - Intergenic
1054795944 9:69302143-69302165 CAGAGCAGTAGGAAGAAGGATGG - Intergenic
1054928175 9:70609246-70609268 CAGCTTAGTGGTGACAAGCATGG - Intronic
1055763948 9:79640980-79641002 CAGATCAGTGGGGAGAAAGATGG + Intronic
1056434539 9:86562791-86562813 CAGAGCAGCGCTTAGAGGCAAGG + Intergenic
1056445048 9:86657378-86657400 TAGATCAGTGGGGAGAAGAAGGG - Intergenic
1056580636 9:87886361-87886383 CAGAGCACTGGTGGCAAGGAAGG + Exonic
1056682696 9:88732970-88732992 CTAAGCAGTGGTGAGATGGAAGG + Intergenic
1056795892 9:89658682-89658704 AGGGGCAGGGGTGAGAAGCAAGG - Intergenic
1057570808 9:96202982-96203004 CACAGCAGTAGTGAGAGGTAGGG + Intergenic
1059670946 9:116491842-116491864 CAGAGCAGTGGTTAGGAGCCTGG + Intronic
1059679821 9:116575415-116575437 CAGAGGAGTGATGAGAAGTGAGG + Intronic
1061061650 9:128253629-128253651 TAGAGCAGGGGTGAGAGTCAGGG + Intronic
1061547822 9:131314991-131315013 TGGAGTAGTGGGGAGAAGCAAGG + Intergenic
1061668252 9:132173089-132173111 GACTGCAGTGGAGAGAAGCAGGG - Intronic
1061723464 9:132568125-132568147 CAGAGAAGCAGAGAGAAGCAAGG + Intronic
1062055521 9:134467964-134467986 CAGAGGAGTGGTTAGAATCTGGG - Intergenic
1062146279 9:134991480-134991502 CAGAGCAGTGGTGGGCTGAAGGG + Intergenic
1062741880 9:138179748-138179770 CACAGCTGTGGATAGAAGCAGGG + Intergenic
1202779462 9_KI270717v1_random:22553-22575 CAAGGCAGTGGTGAGAGGCAAGG + Intergenic
1203586524 Un_KI270747v1:8938-8960 CAAGGCAGTGGTGAGAGGCAAGG + Intergenic
1203616940 Un_KI270749v1:74259-74281 CAAGGCAGCGGTGAGAGGCAAGG - Intergenic
1186151345 X:6677699-6677721 CAGAGGACTGGTGAGAATTAAGG + Intergenic
1186662245 X:11680358-11680380 AAGAGTAGGGGTGAGGAGCAGGG + Intergenic
1187719201 X:22133947-22133969 CAGAGCAGTGGGGAGTCACAGGG + Intronic
1188873384 X:35400754-35400776 CAGAGAGGTGGTGAGAAGTCAGG - Intergenic
1189537722 X:41953838-41953860 AAGGGCATTGCTGAGAAGCAGGG + Intergenic
1189850506 X:45172102-45172124 GGGAGCAGAGATGAGAAGCAAGG + Intronic
1190505589 X:51122737-51122759 CATAGAAGTGGAGAGAAGAATGG - Intergenic
1192639168 X:72846632-72846654 CAGGGCAATGGTGAAAATCATGG - Intronic
1192642543 X:72874173-72874195 CAGGGCAATGGTGAAAATCATGG + Intronic
1192696379 X:73420310-73420332 CAGAGCATTGGGAAGAAACATGG + Intergenic
1192834797 X:74787741-74787763 GAGAGCTGTGCTGAGATGCAAGG + Intronic
1192871879 X:75192111-75192133 CAAAGCAGTGTTAAGAAGGAAGG - Intergenic
1193496334 X:82218672-82218694 CAGAGCTGTGGTGTGCAGCCTGG - Intergenic
1197322966 X:125055682-125055704 CAGACCAGTGCCGAGGAGCATGG + Intergenic
1197815547 X:130494367-130494389 CAGAGGAGAGATCAGAAGCAGGG + Intergenic
1198174512 X:134142240-134142262 CAGTGCAGTAGTGAGAAGGGTGG + Intergenic
1198513547 X:137379527-137379549 CACTGCAGAGGTGAGAATCAGGG - Intergenic
1201194730 Y:11480839-11480861 CAAGGCAGCGGTGAGAGGCAAGG + Intergenic