ID: 995313482

View in Genome Browser
Species Human (GRCh38)
Location 5:110739394-110739416
Sequence AGAGCAGTGGTGAGAAGCAT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 397
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 364}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995313468_995313482 26 Left 995313468 5:110739345-110739367 CCCACGGAGGAACCCTTTTCCAG 0: 1
1: 0
2: 0
3: 6
4: 71
Right 995313482 5:110739394-110739416 AGAGCAGTGGTGAGAAGCATGGG 0: 1
1: 0
2: 1
3: 31
4: 364
995313473_995313482 14 Left 995313473 5:110739357-110739379 CCCTTTTCCAGTGGCGGCGGCGG 0: 1
1: 1
2: 1
3: 6
4: 78
Right 995313482 5:110739394-110739416 AGAGCAGTGGTGAGAAGCATGGG 0: 1
1: 0
2: 1
3: 31
4: 364
995313476_995313482 7 Left 995313476 5:110739364-110739386 CCAGTGGCGGCGGCGGCAGTGTG 0: 1
1: 0
2: 3
3: 22
4: 346
Right 995313482 5:110739394-110739416 AGAGCAGTGGTGAGAAGCATGGG 0: 1
1: 0
2: 1
3: 31
4: 364
995313475_995313482 13 Left 995313475 5:110739358-110739380 CCTTTTCCAGTGGCGGCGGCGGC 0: 1
1: 1
2: 0
3: 14
4: 121
Right 995313482 5:110739394-110739416 AGAGCAGTGGTGAGAAGCATGGG 0: 1
1: 0
2: 1
3: 31
4: 364
995313469_995313482 25 Left 995313469 5:110739346-110739368 CCACGGAGGAACCCTTTTCCAGT 0: 1
1: 0
2: 0
3: 23
4: 76
Right 995313482 5:110739394-110739416 AGAGCAGTGGTGAGAAGCATGGG 0: 1
1: 0
2: 1
3: 31
4: 364
995313467_995313482 27 Left 995313467 5:110739344-110739366 CCCCACGGAGGAACCCTTTTCCA 0: 1
1: 0
2: 1
3: 4
4: 87
Right 995313482 5:110739394-110739416 AGAGCAGTGGTGAGAAGCATGGG 0: 1
1: 0
2: 1
3: 31
4: 364

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995313482 Original CRISPR AGAGCAGTGGTGAGAAGCAT GGG Exonic
901621299 1:10590028-10590050 AGAGTAGTGCTGAGGAGCCTGGG + Intronic
902239955 1:15081797-15081819 AGGGCAGGGGTGAGAAGCTAAGG + Intronic
902541369 1:17157719-17157741 ATAGCTGTGGCCAGAAGCATGGG + Intergenic
903795575 1:25926805-25926827 AGAGGACTGGTGAAAAGCAGAGG - Intergenic
904276454 1:29387974-29387996 AGAACAGAGATCAGAAGCATAGG - Intergenic
906191904 1:43904393-43904415 AGAGGCTTGGTGAGAAGCCTGGG - Intronic
906298701 1:44665253-44665275 AGAGCAGTGGAGAGACAGATAGG + Intronic
906717372 1:47980133-47980155 AGAACACTAGTGGGAAGCATGGG - Intronic
907624045 1:56010924-56010946 AGAGCAGTAGTGGGCAGCCTAGG + Intergenic
907681272 1:56566247-56566269 GGAGTAGTGGAGAAAAGCATGGG + Intronic
908111040 1:60897538-60897560 ATAGCAGTGGTGAGGAGCAGGGG + Intronic
908650317 1:66325793-66325815 AGAGAAGTGGTGGGAAGGAGGGG + Intronic
909165135 1:72213000-72213022 GGAGTAGGGGTGAGAAGCAGTGG + Intronic
909412449 1:75370982-75371004 AGAGGAGTGAGGAGAAGGATTGG + Intronic
910812716 1:91254170-91254192 AGAGCTGTGGTGGGCAGCCTGGG + Intergenic
910828621 1:91436307-91436329 ATGGCTGTGGGGAGAAGCATAGG + Intergenic
910878841 1:91904238-91904260 AGCACAGTGGTTAAAAGCATGGG + Intronic
912754799 1:112315064-112315086 AGCGCAGTGGGGAGAAGAAGAGG + Intergenic
913256475 1:116958787-116958809 AGAACAGTGGTGAGGAGCTGAGG - Intronic
914756387 1:150563898-150563920 AGAGCTGTGCTGAGAGGCCTGGG + Intergenic
915037811 1:152943302-152943324 TGAGCAGTGGTGATGAGCACTGG - Intergenic
915074938 1:153300142-153300164 AGAGGAGTGGTGAGTAGTAAGGG - Intronic
915537782 1:156547942-156547964 ATAGTAGTGGTTAAAAGCATAGG - Intronic
915587295 1:156851210-156851232 AGAACAGTGGTGAAGAGAATGGG - Intronic
915870433 1:159554412-159554434 AGCGCAGTGCTTTGAAGCATAGG - Intergenic
915882924 1:159691920-159691942 AGAGAAATGGAGAGAAGCAAAGG + Intergenic
916416419 1:164596438-164596460 AGAGCAGTGGTTCTAACCATGGG + Intronic
916970740 1:170012436-170012458 AGTGTAGTGGTTAAAAGCATGGG - Intronic
917328156 1:173854635-173854657 AGGGTAGTGGTTAGGAGCATGGG - Intronic
918764775 1:188466210-188466232 ATTTCACTGGTGAGAAGCATTGG - Intergenic
918802030 1:188984872-188984894 AGGGCAGTGGTGTGAGGCAGGGG + Intergenic
919694888 1:200564292-200564314 GAAGGAGTGGTGAGAAGGATAGG - Intronic
921283494 1:213589023-213589045 AGAGCAGAGGAGAGAGGCAGTGG + Intergenic
921995487 1:221413484-221413506 AGAGCAGTGGTAAGTGTCATGGG - Intergenic
922176318 1:223200654-223200676 AGAGCAGAGGAGACAAGCACAGG - Intergenic
922989606 1:229895254-229895276 GCAGCAGAGGTGAGAAACATTGG - Intergenic
924601089 1:245490038-245490060 AGTGCAGTGGTTACAAGTATGGG - Intronic
924701077 1:246453249-246453271 AGCATAGTGGTGAGAAGCACCGG - Intronic
1064642491 10:17428736-17428758 AGAGCAGTGCCAAGAAGCAGAGG + Intronic
1066995974 10:42563266-42563288 AGAGCTGTGGTGAGAAGCCCAGG + Intergenic
1067809045 10:49412849-49412871 AGAGCAGTGGAGAGCATCAGAGG + Intergenic
1067892546 10:50149406-50149428 AGAGTAGTGGGCAGAAGCAGGGG + Intergenic
1070507523 10:77127375-77127397 AGGGCAGTGGCTAGAAGCTTGGG - Intronic
1071294817 10:84211831-84211853 AGAGAAGTGGAGAGAGGCAGTGG + Intronic
1071346596 10:84699660-84699682 AGAGCAGGAGTGAGAATGATGGG + Intergenic
1072341371 10:94454907-94454929 AGAACAATGTTGAGAAGCAGTGG + Intronic
1072412398 10:95215625-95215647 AGATCAGTGGTGAGAAGACAAGG + Intronic
1072571113 10:96658248-96658270 ACAGGAGAGGTGAGAAGCAAGGG + Intronic
1072729686 10:97837380-97837402 AGAGAAGTGGTGAGAAGGGCTGG + Intergenic
1072732165 10:97853537-97853559 AAATCAGTGGTGAGACCCATGGG - Intronic
1074932789 10:118146140-118146162 AGGGCAGTGGAGAGGAGCAGAGG - Intergenic
1075121227 10:119666333-119666355 AGAAGAGTGGTGGGAAGCAGTGG - Intronic
1075343058 10:121662560-121662582 AGGGCCGGGGTGAGCAGCATCGG + Intergenic
1075350839 10:121723733-121723755 GGAGCAGAGGTGAGAAGACTGGG + Intergenic
1075363534 10:121862097-121862119 AGAGCAGTGGAGATAAGGCTAGG - Intronic
1078403448 11:11047349-11047371 AGAGGAGTGGAGGGAAGCTTTGG + Intergenic
1078717592 11:13854653-13854675 AGAGCACTGGTGCAAACCATGGG + Intergenic
1078827816 11:14947982-14948004 GGAGCAGTGGAGAGAAGGATGGG - Intronic
1079260614 11:18875840-18875862 TGACCCTTGGTGAGAAGCATGGG + Intergenic
1079321972 11:19458710-19458732 AGAGAACTGGTTAAAAGCATGGG - Intronic
1079937452 11:26635252-26635274 AGAGCTGAGGTGAGAATCTTGGG - Intronic
1080692562 11:34570653-34570675 AAAGCACTGATGAGAAGCACAGG - Intergenic
1080972710 11:37298610-37298632 ATTGCAGTGGTGAGGAGCAGGGG + Intergenic
1080997772 11:37625234-37625256 AGAACAGGAGTAAGAAGCATTGG + Intergenic
1081873910 11:46396214-46396236 AGAGAAGTGGTATGAAGCAGAGG + Intergenic
1083012269 11:59413918-59413940 AGAGAAGTGGTGACAAGAGTCGG - Intergenic
1083386626 11:62315525-62315547 TGAGCTGTGGTGAAAAGCACAGG + Intergenic
1084095353 11:66907683-66907705 AGAGCAGAGGGTAGAAGGATGGG - Intronic
1084163904 11:67366291-67366313 AGGGCAGTGGAGTGAAGCAAAGG + Intronic
1084270813 11:68028140-68028162 AGAGCCGAGGTGGGAGGCATGGG + Exonic
1085040218 11:73322487-73322509 GGAGCAATGGTGAGATGCATGGG - Intronic
1085409138 11:76281345-76281367 AGAGCAGTGGTAGAAAGCTTAGG - Intergenic
1085546419 11:77322495-77322517 AGAGCAGTGTTGAGAAGTCGGGG - Intronic
1085886064 11:80523573-80523595 ATAGCAGTGATGAGAAATATAGG - Intergenic
1087861487 11:103163342-103163364 AGGCCAGTGGTGAGTAGGATGGG + Intronic
1088190430 11:107222346-107222368 AGAGCACTGGTGGAGAGCATTGG + Intergenic
1090238196 11:125164710-125164732 CGAGCAGTGCTGGGAAGTATAGG + Exonic
1090328363 11:125908639-125908661 AGAGCATTGGGTAGCAGCATGGG + Intronic
1090537751 11:127663127-127663149 ACAGCATTGGTCATAAGCATAGG + Intergenic
1091457568 12:619104-619126 AGAGCAGTGGCTAGAAGGAATGG + Intronic
1092288407 12:7143286-7143308 ACAGCAGTGGTGAGGCGCAGGGG - Exonic
1092299029 12:7227675-7227697 AGATCAGTGGTGAGAAGACAAGG + Intergenic
1095884729 12:47177098-47177120 AGAGCAGGAGTGAGTAGCTTAGG + Intronic
1096100520 12:48968189-48968211 AGGGCAGTGGTGAGCAGGATCGG - Exonic
1096470137 12:51870365-51870387 TGGGCAGTGGGGAGAAGGATAGG - Intergenic
1096820189 12:54227754-54227776 AGTGGAGTGGGGAGAAGCAAAGG + Intergenic
1097560500 12:61199172-61199194 GGAGATGTGATGAGAAGCATAGG - Intergenic
1097988637 12:65810980-65811002 AGAGCAGAGGTGAAAAACACTGG - Intergenic
1099990497 12:89715776-89715798 AGAGCAGGAGTGAGAAGCAGAGG + Intergenic
1101355420 12:103973005-103973027 AGAGTAGTAGTAAGAAACATGGG + Intronic
1103014943 12:117486907-117486929 AGCACAGTGGTTAGGAGCATGGG + Intronic
1103445966 12:120995405-120995427 AGAGGAGTGGAGAGAAGAGTGGG - Intronic
1104315124 12:127691450-127691472 AGAGCAGAGGTGAGTAGCTTCGG + Intergenic
1105603706 13:21909790-21909812 AGGGCAGTGGTAAGAAGAGTGGG + Intergenic
1106329491 13:28726309-28726331 AGAGCAGTGGTTGGAACCTTAGG + Intergenic
1106549262 13:30757452-30757474 AGGGCAGTGTTGATAAGAATAGG - Intronic
1107552254 13:41487911-41487933 AGGGCACTGGTGAGAGTCATGGG - Intergenic
1107729836 13:43337833-43337855 AGAGCAGACGTGAGAGGCTTTGG - Intronic
1108718852 13:53109284-53109306 ATAGCAGTGGTGAGTAAAATGGG + Intergenic
1110838493 13:80112579-80112601 AAATCAGTGGTTAAAAGCATTGG - Intergenic
1111665304 13:91260323-91260345 ACAGCAGTGCTGAGGAGCACAGG + Intergenic
1112617435 13:101019622-101019644 AGAGGAGTGGTGATAATCCTTGG + Intergenic
1113462438 13:110491535-110491557 TGAGAATTGGAGAGAAGCATGGG + Intronic
1113531666 13:111032009-111032031 TGAGCAGTGGTGTGAAGCTTGGG - Intergenic
1115667021 14:35562250-35562272 AGAGCAGTAGGGGGAAGCAATGG - Intronic
1117167371 14:53050236-53050258 ACTGCAGAGGTGGGAAGCATGGG + Intronic
1117501401 14:56356427-56356449 AGCACAGTGGTTAAAAGCATGGG - Intergenic
1118302396 14:64627214-64627236 AGAGAAGTGGATAAAAGCATGGG + Intergenic
1118598397 14:67453659-67453681 AGAGCTGGGATGAGAAGCAGCGG + Intronic
1118730515 14:68662890-68662912 AGAGCAGTGGGGAGGAGGATGGG - Intronic
1119258867 14:73224843-73224865 TGAGCAGGGTTGAGAAGCAAGGG + Intergenic
1119320391 14:73726834-73726856 AGAGCAGCCGGGAGAAGCAGAGG - Exonic
1119678784 14:76576299-76576321 AGAGCAGAGGAGAGGAGCTTGGG + Intergenic
1119894384 14:78207363-78207385 TGAACAGTAGTGAAAAGCATAGG - Intergenic
1120323199 14:82992147-82992169 AATTCACTGGTGAGAAGCATTGG - Intergenic
1121066326 14:90969831-90969853 AGAGAAGTGGTCTGAATCATAGG - Intronic
1121285041 14:92728724-92728746 AGAGTAGTGATTATAAGCATGGG + Intronic
1122103128 14:99429400-99429422 GGAGCACTGGTGAGACGCAGGGG + Intronic
1122119859 14:99546459-99546481 AGAGCAGTGGTGGGAATCCAAGG + Intronic
1122178875 14:99940122-99940144 AGAGCTGTGGGGAGCAGCATGGG + Exonic
1122271413 14:100569949-100569971 AGAGCTGTGGTGAGGAGCCGTGG - Intronic
1122350092 14:101084078-101084100 GGAGCTGTGGTTAAAAGCATGGG - Intergenic
1123138011 14:106048359-106048381 TGAGCAGGGGTGAGAATAATTGG + Intergenic
1123142032 14:106089022-106089044 AGGCCAGTTGTGAGGAGCATAGG - Intergenic
1123158966 14:106258760-106258782 GGTCCAGTGGTGAGAAGCACAGG - Intergenic
1123160078 14:106269605-106269627 GGTCCAGTGGTGAGAAGCACAGG - Intergenic
1123178461 14:106444123-106444145 GGACCAGTGGTTAGAAGCACGGG - Intergenic
1123212739 14:106776156-106776178 GGTCCAGTGGTGAGAAGCACAGG - Intergenic
1202943332 14_KI270726v1_random:4387-4409 AGGCCAGTTGTGAGGAGCATAGG + Intergenic
1123520943 15:21072807-21072829 AGAGCAGCGGGAAGCAGCATGGG - Intergenic
1124839255 15:33226560-33226582 AGAGCAGTGGTTTGCAGCCTTGG + Intergenic
1127313978 15:57777310-57777332 AGCTCAGTGGTGAGAACCAAGGG + Intronic
1127638150 15:60890591-60890613 AGAGCAGTGGTGATAAGGTGTGG + Intronic
1128088548 15:64903370-64903392 AGAGCAGTGGAGGGAAAGATGGG - Intronic
1128143121 15:65316238-65316260 AGCCCAGTGGTTAAAAGCATGGG - Intergenic
1128245756 15:66131586-66131608 AGTACAGTGGTGGGCAGCATGGG + Intronic
1128331009 15:66755733-66755755 AGAGCAGTGGAGAGGAGGACAGG - Intronic
1129738306 15:77977737-77977759 AGGGCAGTGGGGAAGAGCATGGG + Intergenic
1129847770 15:78775876-78775898 AGGGCAGTGGGGAAGAGCATGGG - Intronic
1130075323 15:80683996-80684018 ACAGCAGTGGTTAAAAGCAAGGG + Intronic
1130254133 15:82318039-82318061 AGGGCAGTGGGGAAGAGCATGGG + Intergenic
1130600838 15:85271932-85271954 AGGGCAGTGGGGAAGAGCATGGG - Intergenic
1131097922 15:89667541-89667563 ACAGAAGGGGTGAGAAGCAGAGG - Intronic
1133227316 16:4347833-4347855 AGAGCAGCAGTCAGAAGCACAGG + Intronic
1133280731 16:4663767-4663789 AGAGCAGTGCTGGGGAGCAGGGG + Intronic
1133922072 16:10162325-10162347 AGAGGAGTGAGGAGAAGCCTTGG + Intronic
1135011331 16:18882220-18882242 AGTACTGTGGTGAGGAGCATTGG - Exonic
1135105574 16:19646257-19646279 AGAACAGTGGTGAGAAAGAGAGG - Intronic
1135286474 16:21197797-21197819 GGAGCAGTGGGGAGAAGAGTAGG - Exonic
1136061518 16:27729923-27729945 TGAGCAGTGGAGGGAAGGATGGG - Intronic
1136143134 16:28299852-28299874 AGAGCAGAGGTGAGAAGGGATGG - Intronic
1136569652 16:31088965-31088987 AGAGGGGTGGTGACAAGCCTAGG - Intronic
1138370656 16:56524034-56524056 AGTGCAGTGGTGAGGAGCTCAGG - Intergenic
1139075767 16:63445138-63445160 AGAGCAGTGCAAAGAACCATGGG - Intergenic
1139297647 16:65917217-65917239 ACAGCACAGGTGAGAAGCAGTGG - Intergenic
1139889855 16:70243681-70243703 AGTACTGTGGTGAGGAGCATTGG - Intergenic
1139896402 16:70290889-70290911 AGTGCAGTGGTTAAGAGCATGGG - Intronic
1141530506 16:84643356-84643378 AGACCTTTGGTGAGAAGCAGGGG + Intergenic
1142015635 16:87745326-87745348 AGAGCAGTGCTGGGTAGTATGGG - Intronic
1142879702 17:2874798-2874820 TGGGCATTGGTGAGAAGCAGAGG - Intronic
1142899251 17:3002305-3002327 AGAGGGGTGATGAGAAGCAGGGG + Intronic
1143680027 17:8469522-8469544 ACAGCAGTGGTGACATGCAGTGG - Intronic
1145950687 17:28814507-28814529 AGTGCAGTGGTGAGATGCTGTGG + Intronic
1146466973 17:33094101-33094123 AGAGCAGGGTGGAGAAGCACTGG - Intronic
1146472289 17:33134292-33134314 AGAGCACTGGTGAAAAGGAACGG - Intronic
1147261784 17:39213174-39213196 AAAGCAGTGGTGGGCAGCAGGGG - Intronic
1147801885 17:43097445-43097467 AGAGAAGTGGTTAAAGGCATGGG + Intronic
1148714976 17:49709377-49709399 AGCGCTGTGGTTAGAAACATGGG + Intergenic
1148838072 17:50476930-50476952 AGTGCAGTGGTGTGAACCCTGGG + Intergenic
1148983906 17:51604120-51604142 ACAGCAGTGAAGAGAGGCATGGG - Intergenic
1150592926 17:66578961-66578983 AGTGCAGAGGTGAGAAGCAACGG - Intronic
1151553220 17:74833962-74833984 AGAGCAGAGCTGAGCAGGATGGG - Intronic
1153523603 18:5975078-5975100 AGAGCAGAGGTGGGAAGGATGGG - Intronic
1153837800 18:8979852-8979874 AGAACAGTGATTAGAAGCAGGGG - Intergenic
1157017251 18:43731057-43731079 AGAGTAGAAGTGAGAAGCAAAGG + Intergenic
1157165843 18:45357682-45357704 AGAGGAGGGAAGAGAAGCATAGG + Intronic
1157459208 18:47871460-47871482 AGGGCAATGGTGAGAAGCGCTGG + Intronic
1157478264 18:48036952-48036974 AGAGATGGGGTGAGAAGCAAAGG + Intronic
1158357023 18:56632713-56632735 AGAGTAGTGGGAAGAAGCTTGGG + Intronic
1158403978 18:57145064-57145086 GGAGCAGTGGTTTGAAGCCTCGG + Intergenic
1159416471 18:68155618-68155640 AGATCAGTGTTGGGAAGAATAGG - Intergenic
1161476178 19:4486882-4486904 AGAGGAGTTGTCAGAAGCATGGG - Intronic
1161520648 19:4721879-4721901 AGTCCAGTGGTGAAAAGCGTGGG + Intronic
1163050167 19:14677083-14677105 ATAGCAGTGGTGATAATGATGGG + Intronic
1164300028 19:23953911-23953933 ACAGTAGTGGTGTGAAGCAAGGG + Intergenic
1164819050 19:31230673-31230695 AAAGCAGTGATGGGAAGCAGGGG - Intergenic
1165023476 19:32942407-32942429 ATAGAAGTGGGGAGATGCATAGG + Intronic
1165793546 19:38506125-38506147 AGGGCAGAGGAGAGAAGGATGGG + Intronic
1165796644 19:38523715-38523737 AGGGCAGTGCTGAGAAGGATAGG - Intronic
927411997 2:22837007-22837029 AGGGCAGAGGGGAGAAGCAAGGG + Intergenic
927592032 2:24364858-24364880 TGAGCACTGGTGAGGAGCAGTGG + Intergenic
929085447 2:38163245-38163267 AGAACCTAGGTGAGAAGCATGGG + Intergenic
931019509 2:58027533-58027555 AGGGCAGTGGTGAAAAGGGTTGG + Intronic
931147362 2:59533829-59533851 AGAGCACTCATGAGAAGCCTTGG - Intergenic
931991156 2:67791761-67791783 AGATCAGTGGAGAGAAACAGAGG - Intergenic
932774811 2:74521806-74521828 AGAGCAAGGGAGAGACGCATGGG - Intronic
932892672 2:75610330-75610352 AGAGCTGTGGTCAGAGGCACCGG + Intergenic
934049037 2:88194852-88194874 AGTGCAGAGGTGAGAAGCTGCGG - Intergenic
935116835 2:100144053-100144075 AGGGCAGTGATGAGAGGCAATGG - Intergenic
935786661 2:106555255-106555277 AGAGCACTGGTTAGAAGGCTTGG - Intergenic
937359261 2:121217717-121217739 TGAGCAGTGGTGGGCAGCAGTGG - Exonic
937458337 2:122063552-122063574 AGGGCAGTGGTGAGAATGACTGG - Intergenic
938121990 2:128640495-128640517 AGAGCACTGGTCAGAAGCCCAGG - Intergenic
938888352 2:135677314-135677336 GGAGAAGGGGTCAGAAGCATGGG - Intronic
942717034 2:178904808-178904830 AGAGCACTGTTCAAAAGCATGGG + Intronic
943025426 2:182622367-182622389 AGAGCAGTGGTGCTCAGCACTGG - Intergenic
943877480 2:193089723-193089745 AGAGTAGTGGTGAGAAATGTTGG - Intergenic
944069697 2:195655212-195655234 GGCACAGGGGTGAGAAGCATGGG + Intronic
944213364 2:197229666-197229688 AGAGCAGTTGTGAAAACCAAAGG - Intronic
944659465 2:201909039-201909061 AGAATAGTGATTAGAAGCATAGG - Intergenic
944871044 2:203911923-203911945 AGTGTAGTGGTTATAAGCATGGG + Intergenic
945489554 2:210438941-210438963 TGGGCAGTGGTGTGAAGCACAGG + Intronic
945706897 2:213246347-213246369 AGATCAGAGGTGTGAAACATTGG + Intergenic
945745336 2:213713612-213713634 GGAGAAGTGGTGAGAAGTAGAGG - Intronic
946666126 2:222051698-222051720 AGAGCAGTGGAGTGAACCATAGG - Intergenic
946851798 2:223914625-223914647 ATCACTGTGGTGAGAAGCATAGG + Intronic
947937553 2:234021171-234021193 AGAGCAGTGTTGAGAATCAATGG - Intergenic
1170429530 20:16263712-16263734 ATAGCAGAGGAGAGAAGGATGGG - Intergenic
1170881314 20:20298694-20298716 AGAGCAGTGGTCAGAAATGTAGG + Intronic
1171302099 20:24072049-24072071 AGAGCTGGGGAGAGAGGCATGGG + Intergenic
1171458663 20:25286382-25286404 AGAGCAGAGGAGAGGAGCAGAGG - Intronic
1171502333 20:25603530-25603552 AGTCCAGTGGTGAGAACCAGTGG + Intergenic
1172715188 20:36957877-36957899 AGAGGAGTAGAGAGAAGGATAGG + Intergenic
1173988965 20:47285193-47285215 AGTGCAGTGGTGACCTGCATGGG - Intronic
1175751553 20:61501614-61501636 AGAGCTGTGGTGAGACTCAAAGG + Intronic
1176096862 20:63348345-63348367 AGAGCAGCCTGGAGAAGCATCGG - Intronic
1176513429 21:7765815-7765837 AGCACGGTGGTGAGGAGCATGGG + Intronic
1176900515 21:14436188-14436210 AAGGCAGCTGTGAGAAGCATGGG - Intergenic
1176947582 21:15002189-15002211 ACAGCAGTGGTGCCAAGCACAGG + Intronic
1177073129 21:16536293-16536315 AGAGCAGTTGCAAAAAGCATTGG + Intergenic
1177782004 21:25631761-25631783 ATAGCAGTGGTTAGGAGCATTGG + Intergenic
1177816942 21:25988001-25988023 AGAGCAGAGTTCAGAAGGATCGG + Intronic
1178647542 21:34396339-34396361 AGCACGGTGGTGAGGAGCATGGG + Intronic
1179711108 21:43263726-43263748 AGAGCTGTGGTGAGGATCAAAGG + Intergenic
1183593822 22:38797684-38797706 AGAGCATTAGTGAGAAGAAAAGG - Intergenic
1184028004 22:41872358-41872380 AGAGCGGTGGTGACAAGGAGGGG + Intronic
1185146146 22:49137686-49137708 ATAGCAGTGGTGAGATGCTGAGG + Intergenic
950600928 3:14035132-14035154 AGAGCTGTGGTGGGCAGCCTGGG - Intronic
951451525 3:22844758-22844780 AGCACAGTGGTGAGCAGCAGAGG + Intergenic
951569184 3:24044302-24044324 AGAGCAGTGGGCAGAAGCCAGGG + Intergenic
951937370 3:28036726-28036748 AGAGCTGTGGTCACATGCATAGG - Intergenic
953504619 3:43472561-43472583 AGTGCAGTAGTGAGAAGGGTGGG - Intronic
953787576 3:45922495-45922517 AGGGCAGTGGTTAGGAGAATGGG - Intronic
955415512 3:58687459-58687481 AGAGGAGCGGGGAGAAGCAGTGG - Intergenic
955460826 3:59181326-59181348 AGTGCTGTGGTGAAAAGCATGGG - Intergenic
955926839 3:64014993-64015015 AAAGCTGTGGTGAGAAGCAAAGG + Intronic
955928779 3:64034336-64034358 AGAGGAGTGGTTTGAAGGATGGG - Intergenic
956260033 3:67329374-67329396 AGAGCAGGGGTGAGTAGATTTGG - Intergenic
957218660 3:77353950-77353972 GGAGCAGTGGTGGGAAGAAGCGG - Intronic
958982235 3:100735608-100735630 AGAAGAGTGGTTAAAAGCATAGG - Intronic
959330309 3:104996664-104996686 ACAGCCATGGTGAAAAGCATTGG - Intergenic
960513227 3:118575423-118575445 ACAGCAGTGATGAGAATAATGGG + Intergenic
962829727 3:139129385-139129407 AGAGCAGTGGTTGGAATCAGAGG + Intronic
963006729 3:140733356-140733378 TTAGCAGTGGTGTGAAGCAGTGG - Intergenic
965113004 3:164451334-164451356 AGAGCTGTGGTGTGCAGCTTGGG - Intergenic
965284837 3:166805519-166805541 AAAGCAGTGGTGAGAGGCTTCGG - Intergenic
965810949 3:172591675-172591697 AGAGCTGTGGTGGGCAGCCTAGG - Intergenic
966396114 3:179504986-179505008 AGAGCAATGGTTTGAAGCAATGG - Intergenic
966559306 3:181301738-181301760 AGTACAGTGGTAAGAAGCAATGG + Intergenic
966561948 3:181331165-181331187 AGAGGAATGGTTAAAAGCATAGG + Intergenic
966731868 3:183158373-183158395 AGGGCAGTGGGCAGAAGCAAGGG + Intronic
966851084 3:184165302-184165324 AGTGCAGTGTTGAGAACCTTGGG + Intronic
967081685 3:186055361-186055383 AAAGCAGTGAGGAGAGGCATGGG + Intronic
968611669 4:1560008-1560030 AGGGCAGTGGTCGGAAGCCTGGG - Intergenic
968907645 4:3462072-3462094 AGAGCAGGGCTCAGAGGCATCGG - Intergenic
969576345 4:8038308-8038330 AGAGCTGTGGTGGGGAGCATGGG - Intronic
971089467 4:23324033-23324055 TGAGCAGTGGTGAGTTTCATGGG + Intergenic
971223603 4:24731692-24731714 AAGGCAGAGTTGAGAAGCATAGG + Intergenic
971488330 4:27185166-27185188 AGAGCTGTGGTGCAAAGCACAGG + Intergenic
971779530 4:31014471-31014493 AGAGAAGTGGAGAGGAGGATGGG + Intronic
971931671 4:33091643-33091665 AGAGAGGTGATGAGAGGCATGGG - Intergenic
973539843 4:51924841-51924863 ACAGCAGAAGTGTGAAGCATGGG + Intergenic
976600984 4:86936826-86936848 AAAGCAGTGGTGAGAACTAAAGG + Intronic
976663641 4:87566406-87566428 GGAGCAGTAGAGAGGAGCATGGG + Intergenic
977814024 4:101392554-101392576 AGAGGAGAGGAGAGAAGAATGGG - Intergenic
978767579 4:112420253-112420275 AAAGCAGAGGTGAGAAACAGTGG + Intronic
978814196 4:112884597-112884619 AGAGCAGGGGAGAGAAACAATGG - Intronic
979201858 4:117987999-117988021 AGAGCAGTGATGGGAAACAAAGG + Intergenic
979712081 4:123791545-123791567 AGAGGGGTTGAGAGAAGCATGGG + Intergenic
980203775 4:129691182-129691204 AGAGCAATGGAGAAAAACATTGG - Intergenic
980475531 4:133309858-133309880 AGAGCTGTGGTCTGAAGCATGGG + Intergenic
980791679 4:137629016-137629038 AGAGAACTGGGGAGAAGCAAAGG + Intergenic
981022476 4:140043176-140043198 AGAAGAGGGGTGAGAAGCAGAGG - Intronic
981482372 4:145252295-145252317 AGAGCATTGGTGGTTAGCATAGG + Intergenic
981555906 4:145993369-145993391 AGAGCAATGTTGATAAGCAGTGG + Intergenic
982236570 4:153256294-153256316 AGAGCAGTGGTGATTACCTTTGG - Intronic
983563150 4:169121605-169121627 AGAGCACTGGTAAGAACTATAGG - Intronic
984510269 4:180670502-180670524 AAAGAAGTTGTGAGAAGAATAGG - Intergenic
985491244 5:181164-181186 AGAGCAGGGGTCAGAGGCCTGGG - Intronic
985544990 5:504966-504988 AGCCCAGTGCTGAGAAGCAGGGG + Intronic
986463716 5:7999222-7999244 AGAGCTGGGGTGAGAAGCATGGG - Intergenic
987149018 5:15020205-15020227 AGTGCAGTGATGAGAACCCTGGG + Intergenic
987673538 5:21045192-21045214 AGGGAAGTGCTGAGAAGCAAAGG - Intergenic
989524528 5:42438336-42438358 TAGGCAGTGGTTAGAAGCATGGG - Intronic
991354481 5:65753720-65753742 AGAGGAGTGGTGAAAAGAACAGG + Intronic
992370104 5:76135069-76135091 AAAGCAGTGGAGAGAAGGAATGG + Intronic
992992175 5:82294872-82294894 ATAGCAATGGTGAGGAGCACTGG - Intronic
993283019 5:85952168-85952190 AGAGCAGTGGTGGGCAGCCAAGG - Intergenic
993628409 5:90253961-90253983 AAAGAAGTGGTGTGAGGCATAGG - Intergenic
994381094 5:99072423-99072445 AGTGTAGTGGTTAAAAGCATAGG + Intergenic
995313482 5:110739394-110739416 AGAGCAGTGGTGAGAAGCATGGG + Exonic
995801089 5:115995878-115995900 AGCACAGTGGTTAAAAGCATGGG - Intronic
995888653 5:116924156-116924178 AGAGAAGGGCTGAGGAGCATGGG + Intergenic
997195736 5:131978157-131978179 AGAGCAGTGGTGGGAATGGTGGG + Intronic
997453479 5:134001817-134001839 AGAGCACTGGAGAGTAGCTTAGG - Intronic
1001154340 5:169260102-169260124 AGTGCAGTTGTGAGAAGGAGGGG - Intronic
1001223391 5:169923127-169923149 AGCACAGAGGTGAGGAGCATAGG - Intronic
1001358289 5:171054533-171054555 AGAGCAGTGAGGATAAGCAGGGG + Intronic
1001416965 5:171552114-171552136 AGAGCAGTGGGGTGAAGCCACGG + Intergenic
1002102119 5:176862837-176862859 GGAGCAGTGGTGAGCCGCATGGG + Exonic
1003905771 6:10698455-10698477 ACACCAGTGGTCAAAAGCATGGG - Intronic
1004654304 6:17643712-17643734 ATAGAAGTGGTGAGAACCAACGG + Intronic
1006097185 6:31663366-31663388 AGTGCAGTAGTGAGAAGGAGGGG - Intronic
1007267760 6:40610061-40610083 AGAGAAGTGCTGAGAAGGAATGG - Intergenic
1007268642 6:40618498-40618520 AGAGGAGTGGTTAGAAGCCTGGG + Intergenic
1007389074 6:41539535-41539557 AGAGTAGAGATGAGAAGAATGGG + Intergenic
1007492181 6:42231792-42231814 AGAGCAGTGGTCAGAAGCCCAGG + Intronic
1008182244 6:48345106-48345128 AGAGTTGTTGTGAGAAGAATTGG - Intergenic
1008979003 6:57461885-57461907 AGAGCAGTGGTTAAAAGCCCTGG + Intronic
1009167138 6:60354879-60354901 AGAGCAGTGGTTAAAAGCCCTGG + Intergenic
1011745029 6:90400935-90400957 AGAGAAGTGGTGGGAAACTTAGG - Intergenic
1011772811 6:90693787-90693809 AGTGCAGTGGTTAAAAGAATGGG + Intergenic
1011978400 6:93337687-93337709 AGATCAGTGGTGAGAACAACAGG - Intronic
1013139411 6:107317022-107317044 AGAGCAGTAGTGACCAGCATGGG - Intronic
1013636243 6:112032362-112032384 AGCACAGTGATGAGTAGCATAGG - Intergenic
1014763395 6:125383369-125383391 AGAGAAGAGGAGAGAAGCAAAGG + Intergenic
1014982413 6:127960092-127960114 AGAGTCTTGGAGAGAAGCATGGG + Intergenic
1015868946 6:137756124-137756146 AGAGCAGTGGAGAGATGGTTTGG + Intergenic
1016056758 6:139586171-139586193 AGAACAGGGGTGAGAAACTTGGG + Intergenic
1016956450 6:149631514-149631536 AGGGCAGTAGTGAGAAGGAGGGG - Intronic
1017122515 6:151038145-151038167 TGAGCAGGTGTGAGACGCATGGG + Intronic
1018303581 6:162429741-162429763 AGAGCAGTGGTAAGCAGGACCGG - Intronic
1018642196 6:165914883-165914905 AGACCAGTTGTGAGAGGAATTGG - Intronic
1018674056 6:166203646-166203668 GGTGCAGTGCTGAGAAGCATCGG + Intergenic
1019223915 6:170495473-170495495 AGAGCGGTGGTGAAGAGGATGGG + Intergenic
1019223949 6:170495630-170495652 AGAGCGGTGGTGAAGAGGATGGG + Intergenic
1019224136 6:170496467-170496489 AGAGCGGTGGTGAAGAGGATGGG + Intergenic
1019224144 6:170496504-170496526 AGAGCGGTGGTGAAGAGGATGGG + Intergenic
1019224170 6:170496621-170496643 AGAGCGGTGGTGAAGAGGATGGG + Intergenic
1020504648 7:8968858-8968880 AGAGGAGTGATTAAAAGCATGGG - Intergenic
1023054555 7:36281082-36281104 AGAGCACAGGTCAGAAGCGTGGG - Intronic
1023617409 7:42034214-42034236 AGAGGCATGGTGAAAAGCATTGG - Intronic
1025265100 7:57450203-57450225 AGAGCAGTGAAGAGAAGGACTGG - Exonic
1025742230 7:64207117-64207139 AGAGCAGTGAAGAGAAGAACTGG - Intronic
1025746685 7:64249032-64249054 AGAGCAGTGAAGAGAAGAACTGG - Exonic
1025941861 7:66081008-66081030 GGAACAGGGGTGAAAAGCATAGG + Intronic
1028013667 7:85680092-85680114 AAAGCAGTGATGGGAAGCCTGGG - Intergenic
1028877665 7:95841879-95841901 AAGCCAGTGGGGAGAAGCATGGG + Intronic
1029884152 7:103849339-103849361 AATGCAGTGGTGAGAAGGATAGG - Intronic
1030333272 7:108295879-108295901 AGAGGAGTGGTGAGGAACAGGGG + Intronic
1031955507 7:127938435-127938457 AGAGCAGTTATCAAAAGCATAGG + Intronic
1032796517 7:135281606-135281628 ACAGCACTGGTGAAAAACATTGG + Intergenic
1032981505 7:137289325-137289347 AGAGCAGTCCTGTGAATCATTGG + Intronic
1033609065 7:142948070-142948092 TGAGAAGGGGTGAGAAGAATAGG - Intronic
1034497614 7:151431899-151431921 GGAGAGGTGGTGAGAAGCAATGG - Intronic
1036991693 8:13605403-13605425 AGGGCAGTGGTGAAAAGGACGGG - Intergenic
1037285750 8:17297657-17297679 AGAGCAGTGGTTTAAAGCATAGG - Exonic
1037839388 8:22232912-22232934 TGCGCAGTGGTGAAAAGCACAGG + Intergenic
1039578408 8:38644097-38644119 AGAGCAGGGGTTATAGGCATGGG + Intergenic
1040516025 8:48135848-48135870 GCAGGAGTGGTGAGATGCATAGG + Intergenic
1040781945 8:51120048-51120070 AGAGTAGTGGGGGGAAGGATGGG - Intergenic
1040783722 8:51140833-51140855 AGAGAAGTGGTGTGAGGCAGGGG - Intergenic
1044805572 8:96005190-96005212 AGGGAAGTGGTATGAAGCATCGG - Intergenic
1045417698 8:101983647-101983669 AGAGCAGTGTGGAGAAGGGTAGG - Intronic
1045703922 8:104898118-104898140 AGAGCACTGTAGAGAAGTATGGG - Intronic
1046514992 8:115247510-115247532 GGAGCAGAGGAGAGAAGGATGGG - Intergenic
1047720146 8:127631586-127631608 CCAGGAGTGGTGAGAATCATAGG - Intergenic
1048862391 8:138733584-138733606 AGAGCAGTGGGGAGAAGTAAAGG - Intronic
1050833645 9:10048440-10048462 ATAGCAATGGTCAGAAGCACAGG - Intronic
1051750931 9:20340328-20340350 TGAGCAGTGGAGGGAAGCTTTGG - Intergenic
1052978792 9:34431928-34431950 AGTGCAGTGCTTAAAAGCATTGG + Intronic
1053026263 9:34730914-34730936 AGAGCAATTGTGAGAAAGATTGG + Intergenic
1053269952 9:36743059-36743081 ACAGCGGTGGGGAGGAGCATGGG - Intergenic
1053286727 9:36854637-36854659 AGAGGAACGGTGAGAAGCCTTGG - Intronic
1053368152 9:37538400-37538422 TGAACAGTGGTTAAAAGCATGGG + Intronic
1055030055 9:71765066-71765088 TGAGCATTAGTGAGAAGAATGGG - Intronic
1055380184 9:75698230-75698252 AGTGCCCTAGTGAGAAGCATAGG - Intergenic
1056115180 9:83434633-83434655 AGAGGACTGTTGATAAGCATGGG - Intronic
1056795891 9:89658681-89658703 GGGGCAGGGGTGAGAAGCAAGGG - Intergenic
1059670947 9:116491843-116491865 AGAGCAGTGGTTAGGAGCCTGGG + Intronic
1059910694 9:119040841-119040863 AAGACAATGGTGAGAAGCATAGG + Intergenic
1060489860 9:124075052-124075074 AGAGCAGTGGGGAAGAACATGGG + Intergenic
1061547823 9:131314992-131315014 GGAGTAGTGGGGAGAAGCAAGGG + Intergenic
1061661208 9:132131467-132131489 TGGGCAGTGGTGGGGAGCATTGG + Intergenic
1061668251 9:132173088-132173110 ACTGCAGTGGAGAGAAGCAGGGG - Intronic
1062025634 9:134338958-134338980 ACAGCAGTGGTGACAACAATCGG - Intronic
1186706127 X:12140416-12140438 AGAATAGTGGTGTGAAGCAATGG - Intronic
1189615326 X:42777747-42777769 ACAGCTGTGGTCGGAAGCATCGG + Intergenic
1192639167 X:72846631-72846653 AGGGCAATGGTGAAAATCATGGG - Intronic
1192642544 X:72874174-72874196 AGGGCAATGGTGAAAATCATGGG + Intronic
1192834798 X:74787742-74787764 AGAGCTGTGCTGAGATGCAAGGG + Intronic
1193184308 X:78494243-78494265 AGGGCAGTGGTGAGAAACTAAGG - Intergenic
1193496333 X:82218671-82218693 AGAGCTGTGGTGTGCAGCCTGGG - Intergenic
1194156343 X:90393888-90393910 AGAGCAGTGTTCAAAAGCACAGG - Intergenic
1198054072 X:132976509-132976531 AGAGCAGTAGGGAGTAGCAGTGG - Intergenic
1199826307 X:151503958-151503980 AGAGCAGTAGGCAGAAGCCTGGG - Intergenic
1200502691 Y:3970877-3970899 AGAGCAGTGTTCAAAAGCACAGG - Intergenic