ID: 995313483

View in Genome Browser
Species Human (GRCh38)
Location 5:110739395-110739417
Sequence GAGCAGTGGTGAGAAGCATG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 370
Summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 335}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995313473_995313483 15 Left 995313473 5:110739357-110739379 CCCTTTTCCAGTGGCGGCGGCGG 0: 1
1: 1
2: 1
3: 6
4: 78
Right 995313483 5:110739395-110739417 GAGCAGTGGTGAGAAGCATGGGG 0: 1
1: 0
2: 3
3: 31
4: 335
995313476_995313483 8 Left 995313476 5:110739364-110739386 CCAGTGGCGGCGGCGGCAGTGTG 0: 1
1: 0
2: 3
3: 22
4: 346
Right 995313483 5:110739395-110739417 GAGCAGTGGTGAGAAGCATGGGG 0: 1
1: 0
2: 3
3: 31
4: 335
995313468_995313483 27 Left 995313468 5:110739345-110739367 CCCACGGAGGAACCCTTTTCCAG 0: 1
1: 0
2: 0
3: 6
4: 71
Right 995313483 5:110739395-110739417 GAGCAGTGGTGAGAAGCATGGGG 0: 1
1: 0
2: 3
3: 31
4: 335
995313467_995313483 28 Left 995313467 5:110739344-110739366 CCCCACGGAGGAACCCTTTTCCA 0: 1
1: 0
2: 1
3: 4
4: 87
Right 995313483 5:110739395-110739417 GAGCAGTGGTGAGAAGCATGGGG 0: 1
1: 0
2: 3
3: 31
4: 335
995313475_995313483 14 Left 995313475 5:110739358-110739380 CCTTTTCCAGTGGCGGCGGCGGC 0: 1
1: 1
2: 0
3: 14
4: 121
Right 995313483 5:110739395-110739417 GAGCAGTGGTGAGAAGCATGGGG 0: 1
1: 0
2: 3
3: 31
4: 335
995313469_995313483 26 Left 995313469 5:110739346-110739368 CCACGGAGGAACCCTTTTCCAGT 0: 1
1: 0
2: 0
3: 23
4: 76
Right 995313483 5:110739395-110739417 GAGCAGTGGTGAGAAGCATGGGG 0: 1
1: 0
2: 3
3: 31
4: 335

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995313483 Original CRISPR GAGCAGTGGTGAGAAGCATG GGG Exonic
901852419 1:12024024-12024046 GAGCAGCAGTGAGAAGAAGGGGG + Intronic
901930319 1:12592930-12592952 GAGAAGTGGTGAGAAGCCTCTGG - Intronic
902120811 1:14164008-14164030 GAGCAGTGGGCAGAAGCTGGAGG - Intergenic
902886327 1:19407518-19407540 GAGCAGTGCTGATAAGGAAGAGG + Intronic
903064568 1:20691973-20691995 GAACAGAGGTGAGAACCAGGTGG - Intronic
904317680 1:29676385-29676407 GGTCAGTGGTGACCAGCATGAGG + Intergenic
904386460 1:30145799-30145821 GAGCAATGGGGTGAACCATGAGG + Intergenic
904393161 1:30199069-30199091 GAGCAATGGGATGAAGCATGAGG - Intergenic
906138772 1:43520643-43520665 GAGCAGTGGGGAGCTGGATGGGG + Intergenic
906717371 1:47980132-47980154 GAACACTAGTGGGAAGCATGGGG - Intronic
907084760 1:51661119-51661141 AAGCAGTGATGAAAAGTATGTGG + Intronic
907641936 1:56199423-56199445 GAGCAGTAGGGAGCAGCATATGG - Intergenic
908032006 1:60010928-60010950 AAGCAGTGGTGAGAGGCCAGTGG - Intronic
908110811 1:60895550-60895572 GTGTAGTGTGGAGAAGCATGGGG - Intronic
908587556 1:65588119-65588141 GAGCAGTGGGGAGAAGAGTGTGG - Intronic
909030060 1:70528993-70529015 GAGCAGTGGTGGGAAATGTGGGG - Intergenic
912480324 1:109978004-109978026 GACCAGGGTTGAGAGGCATGAGG + Intergenic
915037810 1:152943301-152943323 GAGCAGTGGTGATGAGCACTGGG - Intergenic
915596202 1:156897794-156897816 GCGGTGTGGTGAGAGGCATGTGG + Intronic
915610983 1:156992477-156992499 GGGCTGGGGTGAGGAGCATGTGG - Intronic
915626992 1:157120043-157120065 GAGGAGGGGAGAGAAGCAGGAGG + Intergenic
916291784 1:163174874-163174896 GAGGAGAGTTGAGAAGCATAAGG + Intronic
918045665 1:180939543-180939565 GAGAAGTGGTGGGAGGCAGGGGG - Intronic
918126468 1:181588415-181588437 GAGCGGTGGGGAGAAGGCTGTGG - Intronic
918531472 1:185526970-185526992 AAGCAGAGGTAAGATGCATGTGG + Intergenic
918754309 1:188317866-188317888 GAGCTGTGTTGAGAAGGATCAGG + Intergenic
919321760 1:196049957-196049979 TAGCAGTGGTGGCAAGCAAGGGG - Intergenic
919694887 1:200564291-200564313 AAGGAGTGGTGAGAAGGATAGGG - Intronic
919786952 1:201264225-201264247 CAGCAGTGGTGAGCAGCACCTGG - Intergenic
921311185 1:213845383-213845405 GTGTAGTGTTGAAAAGCATGGGG - Intergenic
922279892 1:224114010-224114032 GAGGAGTGGGGAGGAGCCTGTGG - Intergenic
922989605 1:229895253-229895275 CAGCAGAGGTGAGAAACATTGGG - Intergenic
923094150 1:230761383-230761405 GAGCAGTGGGGAGGAGCCTCAGG - Intronic
923146580 1:231202784-231202806 ACGCAGTGCTGAGAAGCAGGAGG + Intronic
923228267 1:231959809-231959831 TAGCAGAGGTGAGCAGAATGAGG + Intronic
923349215 1:233087255-233087277 GAGCAGAGGTGAAAAGAAAGAGG + Intronic
923866468 1:237944953-237944975 GAGTAGTGGTGACAAGCCTACGG - Exonic
1063761182 10:9078826-9078848 GAGGCGTGGTGATAAGGATGGGG + Intergenic
1065071403 10:22027997-22028019 GAGCTGGGGAGAGGAGCATGAGG + Intergenic
1065466537 10:26030116-26030138 GAGGTGTGGTGGGAAGAATGGGG - Intronic
1065873837 10:29979981-29980003 GACCAGTGGGGGGAAGCATCAGG + Intergenic
1066409191 10:35149597-35149619 GAGCAGTGGTGAGACCTTTGTGG + Intronic
1068056464 10:52017719-52017741 GAGGAGTGGAGATAACCATGTGG + Intronic
1071683829 10:87734452-87734474 GTGCAGTGATGAGAAGAATCTGG + Intronic
1072200023 10:93149965-93149987 AAGCAGTGGTCAGAATGATGTGG - Intergenic
1072635165 10:97173315-97173337 GAGATGTTGTGAGAAGCATGTGG - Intronic
1074432871 10:113408645-113408667 GGGCAGTGGTGGGAAGGAGGTGG - Intergenic
1074526605 10:114268468-114268490 GAGCTGTGGTGAGAATTATATGG + Intronic
1075612789 10:123866758-123866780 AAGAAGTGGTGACAAGCTTGAGG - Intronic
1075741037 10:124696687-124696709 CCGCTCTGGTGAGAAGCATGGGG + Intronic
1076987998 11:253247-253269 GATGAGTGGTGACAAGGATGTGG - Intergenic
1077857401 11:6142451-6142473 GAGCAGTGATAGGAACCATGAGG + Intergenic
1078717593 11:13854654-13854676 GAGCACTGGTGCAAACCATGGGG + Intergenic
1079048199 11:17128073-17128095 GAGCAGTTGTGAGAAATATAAGG + Intronic
1079571799 11:21952614-21952636 GAGCAGTGGTCAGAGCCATGAGG + Intergenic
1079573668 11:21976489-21976511 CAGCAGAGGGGAGAAGCAGGTGG - Intergenic
1079937451 11:26635251-26635273 GAGCTGAGGTGAGAATCTTGGGG - Intronic
1080661656 11:34301231-34301253 AAGCACTGTTTAGAAGCATGTGG - Intronic
1081444767 11:43119986-43120008 AATCCGTGGTGAGATGCATGTGG - Intergenic
1081858458 11:46318362-46318384 GTACAGTGGTTAGGAGCATGGGG + Intronic
1084406676 11:68978269-68978291 GAGAAGGGTTGTGAAGCATGGGG + Intergenic
1085040217 11:73322486-73322508 GAGCAATGGTGAGATGCATGGGG - Intronic
1085981674 11:81733335-81733357 GGGCACTGGTCAGAATCATGAGG - Intergenic
1086475958 11:87174533-87174555 TAGCAGTGTTAAAAAGCATGTGG + Intronic
1086794177 11:91080233-91080255 GAACTGTGGACAGAAGCATGAGG - Intergenic
1087861488 11:103163343-103163365 GGCCAGTGGTGAGTAGGATGGGG + Intronic
1088520377 11:110691734-110691756 GAGCAGTGGTGACAATAATTTGG - Intronic
1088736788 11:112734372-112734394 GAGCAGGCCCGAGAAGCATGTGG - Intergenic
1089065073 11:115656513-115656535 GAGGAGTGTGGAGACGCATGCGG - Intergenic
1089437360 11:118481770-118481792 GAGCAGTGTTGTGAAGAACGTGG + Exonic
1090014391 11:123073180-123073202 GACCTGTGGTGAGAAGGTTGGGG - Exonic
1090572025 11:128057837-128057859 GAGGATTGGTGAGAAGCACCAGG - Intergenic
1090634208 11:128679616-128679638 TAGGAGTGGGGTGAAGCATGAGG - Intergenic
1091005933 11:131953824-131953846 GATCAGAGGTGAGAAAAATGAGG + Intronic
1091093285 11:132793082-132793104 GAGGAGTGGGGAGAATGATGGGG - Intronic
1091228639 11:133973503-133973525 GAGTAGTGGAGAGAAGCCTGTGG + Intergenic
1091321534 11:134655694-134655716 GAGCAGTGCAGAGGAGCCTGAGG + Intergenic
1091351551 11:134901613-134901635 GAGCAGAGGGGAGAAGCAGCTGG - Intergenic
1092204978 12:6609067-6609089 GAGTAGTGGTGAGTAGCGGGAGG - Intergenic
1092296283 12:7201681-7201703 TAGGAGTGGGGAGTAGCATGGGG + Intronic
1093073744 12:14735549-14735571 TAGCAATGGTGAGAAGCAGTTGG - Intergenic
1094713004 12:32984301-32984323 GTTCAGTGGTGAAATGCATGGGG - Intergenic
1096187085 12:49588380-49588402 GAGCAGGGGTGACCAGCCTGGGG - Intronic
1097065222 12:56315806-56315828 GAGCAGAGGTGGGACGGATGCGG - Exonic
1099351482 12:81575283-81575305 GAGGAGTGGTGAGAATCATTTGG - Intronic
1100324044 12:93524301-93524323 GAGAAGTGGTCAGGACCATGTGG - Intergenic
1103014944 12:117486908-117486930 GCACAGTGGTTAGGAGCATGGGG + Intronic
1103998065 12:124842737-124842759 GAGCAGTGAAGAGGGGCATGTGG - Intronic
1104315125 12:127691451-127691473 GAGCAGAGGTGAGTAGCTTCGGG + Intergenic
1104752114 12:131246298-131246320 GTGCTGAGGGGAGAAGCATGTGG + Intergenic
1105556383 13:21450015-21450037 TAGTAGTGGTGAGAAGCAGCTGG + Intronic
1106720399 13:32429351-32429373 TAGCAGTGCTGAGAAGAATGAGG - Intergenic
1107448904 13:40491235-40491257 GGGCTGGGTTGAGAAGCATGAGG + Intergenic
1107552253 13:41487910-41487932 GGGCACTGGTGAGAGTCATGGGG - Intergenic
1108567400 13:51714229-51714251 AAGCAGTGTTGACAAGGATGTGG + Intronic
1110939941 13:81337419-81337441 GAGCAGTGGTGAAAAAGATTTGG + Intergenic
1111377188 13:87396161-87396183 GTTCAGAGGTGAGAAGCATTAGG + Intergenic
1112252457 13:97794768-97794790 GAGCAGAGGTCAGAAGAGTGTGG - Intergenic
1113462439 13:110491536-110491558 GAGAATTGGAGAGAAGCATGGGG + Intronic
1113875074 13:113589138-113589160 GAGAAATGGTGAGAAGGATTAGG + Intronic
1114293675 14:21309624-21309646 GAGCAGAGGTGAGAAACATCAGG + Intronic
1114852327 14:26396000-26396022 GAGCAGTGCTGAGTAGTATCTGG + Intergenic
1115479611 14:33848713-33848735 CAGCTGTGGGGAGAAGAATGAGG + Intergenic
1116580998 14:46641409-46641431 GAGAAGTAGTGAGCAGAATGAGG + Intergenic
1117167372 14:53050237-53050259 CTGCAGAGGTGGGAAGCATGGGG + Intronic
1118262330 14:64259331-64259353 GAGGAGGGGTGAGAAGCTGGGGG - Intronic
1118437722 14:65786762-65786784 CAGCAGGGGTGAGAGGCCTGGGG + Intergenic
1118730514 14:68662889-68662911 GAGCAGTGGGGAGGAGGATGGGG - Intronic
1119324989 14:73754573-73754595 GAGAGGTGGTGAGATGCTTGAGG - Intronic
1121776447 14:96593829-96593851 GAGCAGGGGTGAGGAGAATGAGG + Intergenic
1121958914 14:98240631-98240653 CAGCAGGGGTGAGAGGCAGGAGG - Intergenic
1122243015 14:100381707-100381729 TAGAAGTGGAGAGAAGCATGTGG - Exonic
1122495041 14:102147415-102147437 GAGCAATGGTGAGAAGCACCTGG + Intronic
1124595164 15:31086189-31086211 GGGCTGTGGGGAGAACCATGGGG + Intronic
1125234088 15:37491273-37491295 GAGGAGTAGTTAGAAGCAGGGGG + Intergenic
1127313979 15:57777311-57777333 GCTCAGTGGTGAGAACCAAGGGG + Intronic
1128432251 15:67608304-67608326 GAGCAATGGAGAGAATAATGAGG + Intronic
1128632156 15:69278609-69278631 GAGCTGTGGTGAGAGGGAAGGGG + Intergenic
1129742964 15:77998982-77999004 GACCAGTGGTTAGGAGCAAGTGG - Intronic
1129842515 15:78752465-78752487 GACCAGTGGTTAGGAGCAAGTGG + Intergenic
1130012069 15:80159870-80159892 CGGAAGTGGTGAGAAGCACGTGG + Exonic
1130871765 15:87977639-87977661 GAGCAATGGGGAGCAGGATGAGG + Intronic
1131459215 15:92606685-92606707 GAGCCCTGGAGAGAAGCAGGCGG + Intergenic
1131645000 15:94331934-94331956 AAACAGCTGTGAGAAGCATGCGG + Intronic
1133583613 16:7170249-7170271 TAACAGTGGTGAGGAGCAGGAGG - Intronic
1134686010 16:16159302-16159324 CAGCAGTGGTTAGGAGCATAAGG - Intronic
1134806980 16:17134427-17134449 GAGGAGAGCTGAGAAGCAGGAGG - Intronic
1135621930 16:23963268-23963290 GAGCACTTGTGAGAAGTAAGTGG + Intronic
1136061517 16:27729922-27729944 GAGCAGTGGAGGGAAGGATGGGG - Intronic
1136393636 16:29980852-29980874 AAGCAGTGTGGAGAAGGATGTGG + Intronic
1140744254 16:77967200-77967222 GAAAGGTGGTGAGAACCATGGGG - Intronic
1141014177 16:80432594-80432616 GAGCAGTGGTGAGAGGGAGGTGG + Intergenic
1141413793 16:83854535-83854557 GTTTTGTGGTGAGAAGCATGGGG + Intergenic
1141530507 16:84643357-84643379 GACCTTTGGTGAGAAGCAGGGGG + Intergenic
1142899252 17:3002306-3002328 GAGGGGTGATGAGAAGCAGGGGG + Intronic
1143315130 17:6026665-6026687 GAGGAGTGGTGAGACCCATAAGG - Intronic
1143876499 17:9995062-9995084 GAGCACTGGGGAGCAGCAGGGGG + Intronic
1144675827 17:17160952-17160974 GAGCAGGTGTGGGAAGTATGTGG + Intronic
1149529374 17:57382525-57382547 GAGCAGTGGTCAGAGACATGTGG + Intronic
1151425420 17:74028104-74028126 CAGCAGTGGACAGAAGCCTGGGG + Intergenic
1151553219 17:74833961-74833983 GAGCAGAGCTGAGCAGGATGGGG - Intronic
1152268365 17:79309406-79309428 GAGCAGGTGTGAGAAGCAGCAGG - Intronic
1153427210 18:4978347-4978369 CAGCAGTTGTGTGAAGCATATGG - Intergenic
1156550317 18:38009235-38009257 GAGCAGGGGGGAGGAGAATGTGG - Intergenic
1157465513 18:47941150-47941172 GAGTAGGGGAGAGAAGAATGAGG - Intergenic
1157484702 18:48078552-48078574 GAGCAGTCGTGGGATGCTTGGGG + Intronic
1157762660 18:50275750-50275772 GAGCAGAGGCATGAAGCATGGGG + Intronic
1161287147 19:3474526-3474548 AGGCAGTGGGGAGAAGCAGGTGG + Exonic
1161348618 19:3779937-3779959 CGGCAGGGGTGAGGAGCATGGGG - Intronic
1163050168 19:14677084-14677106 TAGCAGTGGTGATAATGATGGGG + Intronic
1163194430 19:15705207-15705229 GAGCAGTGAGGAAAAGCATCAGG + Intergenic
1163378353 19:16948292-16948314 GTGATGTGGAGAGAAGCATGCGG + Intronic
1163489193 19:17606891-17606913 GAGCACAGGTGAGGGGCATGCGG - Intronic
1164113529 19:22194115-22194137 GACCAGTGGTAAGCAGCATCTGG - Intronic
1164636074 19:29792389-29792411 CAGCAGGGGTGAGAAGCAGGAGG - Intergenic
1165793547 19:38506126-38506148 GGGCAGAGGAGAGAAGGATGGGG + Intronic
1165796643 19:38523714-38523736 GGGCAGTGCTGAGAAGGATAGGG - Intronic
1166204093 19:41257753-41257775 GAGCATTGGTGAGGGGCAAGTGG - Intronic
1167622985 19:50568986-50569008 GGGCTGTGGGGAGAAGAATGGGG + Intergenic
1167733831 19:51279142-51279164 GGGCAGCAGTAAGAAGCATGGGG - Intergenic
1168292916 19:55365807-55365829 GAGCAGGGGTGGGAGGCAGGTGG - Exonic
924959774 2:23880-23902 CTGCAGTGGCAAGAAGCATGAGG - Intergenic
925115152 2:1372390-1372412 TAGCTGTTGGGAGAAGCATGTGG + Intergenic
926886919 2:17606451-17606473 GAGCAGTGGTGAGGGCCAGGAGG + Intronic
928383109 2:30838344-30838366 GAGCCGTGGGGAGGAGGATGTGG + Intergenic
928453378 2:31398484-31398506 GTGCCAGGGTGAGAAGCATGAGG - Intronic
929276301 2:40028652-40028674 AAGCAGTTGTCAGAAGAATGAGG - Intergenic
929388699 2:41442682-41442704 GGGCAGTGGTCAGAGTCATGAGG - Intergenic
929836552 2:45406235-45406257 GAGCAGTGTAGGGAAGGATGGGG + Intronic
930288888 2:49468285-49468307 GAGCACTGGGTAGAATCATGAGG - Intergenic
930901452 2:56511785-56511807 GAGCAGAAGGGAGAAGAATGAGG - Intergenic
932774810 2:74521805-74521827 GAGCAAGGGAGAGACGCATGGGG - Intronic
933823202 2:86133966-86133988 GAGCAGTCGTGTGAAGCAGGAGG - Intronic
934648505 2:96073206-96073228 GTGCAGAGGTGAGAGGCATTTGG + Intergenic
934841739 2:97628230-97628252 GTGCAGAGGTGAGAGGCATTTGG + Intergenic
934864774 2:97797925-97797947 GAGCAGTGGCGGGAAGCATCAGG - Intronic
934921538 2:98348139-98348161 GGGCATTGGTGCGAAGCAGGGGG - Intronic
936233672 2:110725359-110725381 GGGGAGTACTGAGAAGCATGGGG + Intergenic
937469777 2:122165180-122165202 GAGCGATGGTGAGAAACACGTGG + Intergenic
938149341 2:128868633-128868655 TAGCAGTGGTGAGAAATAGGTGG - Intergenic
938694298 2:133821638-133821660 GAGCAGTAGTAAGAATCAAGTGG - Intergenic
938888351 2:135677313-135677335 GAGAAGGGGTCAGAAGCATGGGG - Intronic
939366119 2:141233340-141233362 AAGGAGTGGTGAGGAGTATGAGG - Intronic
939484752 2:142797100-142797122 TAGCAGGGGTGACAAACATGTGG - Intergenic
939834495 2:147112095-147112117 GAGCAGGGGTGAGAGTCAGGTGG - Intergenic
939879422 2:147613218-147613240 TAGCAGTGAAGAGCAGCATGAGG + Intergenic
940551854 2:155169212-155169234 GGGCAGAGGTCAGAGGCATGGGG - Intergenic
940616492 2:156055073-156055095 GGGCATTGCTGAGAAGCATGAGG + Intergenic
942717035 2:178904809-178904831 GAGCACTGTTCAAAAGCATGGGG + Intronic
942837318 2:180315763-180315785 GAGGAGTGGAGAGAAGCAAGTGG - Intergenic
944069698 2:195655213-195655235 GCACAGGGGTGAGAAGCATGGGG + Intronic
944923286 2:204437617-204437639 CAGCAGTGGTGACAAGGGTGGGG - Intergenic
946368722 2:219267072-219267094 GATCAGTGGGGAGAAGAAGGAGG + Intronic
946640932 2:221782823-221782845 GAGAAGTGCTGAGCAGCAGGGGG - Intergenic
947632578 2:231663564-231663586 GAGCAGTGGGGAGAAGCAGCTGG + Intergenic
947694434 2:232172307-232172329 GAGTAGTTGTGAGAAGCTGGGGG - Intronic
947852738 2:233301333-233301355 GAGCAATGGAGAGAAGCAGAAGG + Intergenic
947893124 2:233643869-233643891 GGGCACTGGTCAGAATCATGAGG - Intronic
947937552 2:234021170-234021192 GAGCAGTGTTGAGAATCAATGGG - Intergenic
949067484 2:242002064-242002086 GAGCATTGGTGAGGGGCTTGGGG - Intergenic
1169377807 20:5081174-5081196 GAGAATTAGAGAGAAGCATGTGG + Intronic
1171154434 20:22859316-22859338 GAGTGGTGGGGAGAAGCATGTGG + Intergenic
1171307686 20:24120155-24120177 GAGAGGAGGTGGGAAGCATGTGG - Intergenic
1173519827 20:43690886-43690908 GTATAGTGGTGAGAAGCAAGCGG - Intronic
1176900514 21:14436187-14436209 AGGCAGCTGTGAGAAGCATGGGG - Intergenic
1177074645 21:16556539-16556561 GAGCAGTGGTGTGTAGCAGAAGG + Intergenic
1178329793 21:31678026-31678048 GAGAAGTGGTGAGAGGTCTGAGG - Intronic
1179057215 21:37947240-37947262 GGGCAGGGTTCAGAAGCATGTGG + Intergenic
1180231497 21:46429311-46429333 GAGCGCTCGTGAGAGGCATGGGG + Intronic
1182329945 22:29544459-29544481 GAGCAGGGGTGGCAAGGATGTGG - Exonic
1182965101 22:34514057-34514079 GAGCAGTGGGGAGAAGGCAGCGG - Intergenic
1183523633 22:38310864-38310886 GAGCACTGGGGATAAGAATGTGG + Intronic
1185166372 22:49265023-49265045 GAGGAGTGGAGAGAGGCACGGGG + Intergenic
949546473 3:5077177-5077199 GATTAGTGGTGAGAAGCAGGTGG + Intergenic
951177841 3:19622764-19622786 GAGCATTGGTTAGAGTCATGAGG - Intergenic
951569185 3:24044303-24044325 GAGCAGTGGGCAGAAGCCAGGGG + Intergenic
951732700 3:25827698-25827720 GAGCAGTGGTGAAGACCAAGTGG + Intergenic
952254030 3:31680301-31680323 GAGCAGGGTTGAGCAGCAGGCGG - Intronic
952312169 3:32200004-32200026 GAGGAGTGGGAAGAAGCAGGAGG + Intergenic
953504618 3:43472560-43472582 GTGCAGTAGTGAGAAGGGTGGGG - Intronic
953718970 3:45338877-45338899 GAGAAGTGGAGAGAAGCTGGAGG + Intergenic
955287288 3:57654491-57654513 GAACAGGGGAGAGAAGCAGGTGG + Intronic
955723430 3:61907409-61907431 GAGCAATGCTGAGAAGAATCAGG - Intronic
955728798 3:61961358-61961380 CAGCAGTGGGGATAAACATGTGG + Intronic
957982688 3:87530830-87530852 GAGCAGTGGAAAGAAAGATGTGG + Intergenic
960513228 3:118575424-118575446 CAGCAGTGATGAGAATAATGGGG + Intergenic
962898050 3:139733733-139733755 GAGCAGTGGTGAAATGGCTGGGG + Intergenic
963006728 3:140733355-140733377 TAGCAGTGGTGTGAAGCAGTGGG - Intergenic
965847936 3:172986606-172986628 GTGCAGAGGTTAGAAGCAGGAGG + Intronic
966851085 3:184165303-184165325 GTGCAGTGTTGAGAACCTTGGGG + Intronic
968913314 4:3486488-3486510 GGGCAGAGGCGAGCAGCATGTGG + Intronic
969491243 4:7500271-7500293 GAGCAGTGGTGGGCAGGATAAGG + Intronic
969578357 4:8049327-8049349 CAGCGGAGGTGAGAAGGATGTGG - Intronic
970142176 4:12994701-12994723 GAGCAGAGGTTGAAAGCATGTGG - Intergenic
971327303 4:25655088-25655110 GAGCTGTTGGGATAAGCATGGGG + Intergenic
972927168 4:44023828-44023850 GATGAGTGGTGAGATGGATGTGG - Intergenic
976306268 4:83562849-83562871 TAGCAGTGGACAGAAGAATGAGG - Intronic
977076327 4:92455519-92455541 GAGCAGATGTCAGAAGAATGAGG + Intronic
977229451 4:94434353-94434375 GGGCAGTGGTGAGGAGGGTGTGG - Intergenic
980747864 4:137043801-137043823 GAGGATTATTGAGAAGCATGAGG - Intergenic
980869600 4:138595435-138595457 GAGCTCTGGTGAGAAGCAGCTGG - Intergenic
982087244 4:151848255-151848277 GAGCATTGGTGAGAGTCATCCGG - Intergenic
982202582 4:152974782-152974804 GAGCAGCAGTGAGAATGATGTGG + Exonic
983485072 4:168323400-168323422 TAGCAGTGGTGACACCCATGAGG + Intergenic
983665204 4:170173577-170173599 GATGAGTGTTGAGAAGAATGTGG - Intergenic
984374624 4:178911854-178911876 GGGAAGTGGAGAGAAGCCTGTGG + Intergenic
984535469 4:180969530-180969552 TAGCAGTGATGAGAATAATGTGG + Intergenic
985142507 4:186856838-186856860 TAGAAGTGCTGGGAAGCATGTGG - Intergenic
985375638 4:189334597-189334619 GAACAGTGAAGAGAAGGATGGGG - Intergenic
985384788 4:189434180-189434202 GTGCAGTGGGCAGAGGCATGAGG - Intergenic
985804986 5:2036908-2036930 GAGGAGTGGAGAAAAGCAAGAGG - Intergenic
987051362 5:14149108-14149130 GAGGAGTGGTCAGAGGCTTGCGG + Intronic
987149019 5:15020206-15020228 GTGCAGTGATGAGAACCCTGGGG + Intergenic
987387984 5:17348251-17348273 GAGCAGAAGTGGAAAGCATGAGG + Intergenic
990347316 5:54883633-54883655 GAGCAGTGCTAAGAAGGATCAGG + Intergenic
992666379 5:79013470-79013492 GGGCAGAGGTTAGAAGGATGTGG - Intronic
992890069 5:81195839-81195861 GGGCTGAGATGAGAAGCATGGGG - Intronic
992972083 5:82071652-82071674 GGGTAGTGGTGGGAAGCAAGAGG + Intronic
993631750 5:90294138-90294160 GAGATGTGGTGAGAACAATGCGG + Intergenic
995313483 5:110739395-110739417 GAGCAGTGGTGAGAAGCATGGGG + Exonic
995536760 5:113144252-113144274 GAGCAGTGGAGAGAAGTGAGAGG - Intronic
995573577 5:113506691-113506713 GAGTAAGGGTGGGAAGCATGTGG + Intergenic
995830388 5:116348525-116348547 GAGAAGTGGTGAGTAAAATGGGG - Intronic
996389360 5:122943283-122943305 GAGCACAGGAGGGAAGCATGGGG - Intronic
996614666 5:125426474-125426496 AAGTAGGGGTGAGAAGCGTGAGG + Intergenic
997195737 5:131978158-131978180 GAGCAGTGGTGGGAATGGTGGGG + Intronic
997239230 5:132294600-132294622 GAGCGGCAGTGGGAAGCATGCGG + Exonic
997705308 5:135945222-135945244 GAGCAGATGTGAGAAGGCTGAGG + Intronic
1000124019 5:158226067-158226089 CAGCAGTGGTGACAAGCACCAGG + Intergenic
1000756263 5:165164346-165164368 GAGCTGTTGTGAGAAGGATCTGG + Intergenic
1000812165 5:165876821-165876843 AAGCAGTGGGGAGAGCCATGTGG + Intergenic
1002028974 5:176414375-176414397 GATGTGGGGTGAGAAGCATGGGG - Intronic
1002102120 5:176862838-176862860 GAGCAGTGGTGAGCCGCATGGGG + Exonic
1002519064 5:179780590-179780612 GGGCTGTGGTGAGAAGCAGCAGG + Intronic
1003429101 6:6022649-6022671 CAGCTGTGTTGAGAAGAATGAGG + Intergenic
1004022745 6:11789616-11789638 GAGCGGTAGTGAGAAGGAGGAGG - Intronic
1004889707 6:20088806-20088828 GAGGACAGGTGAGAAGGATGCGG + Intergenic
1005612054 6:27535689-27535711 GGGCAGTGGGGAGAAGCAAATGG + Intergenic
1005886198 6:30099803-30099825 AAGCAGTTGTGAGAAGCAAATGG + Intergenic
1006187409 6:32189273-32189295 GAGCAGTGGAGAGGAGCTTTAGG + Intronic
1007389075 6:41539536-41539558 GAGTAGAGATGAGAAGAATGGGG + Intergenic
1007506895 6:42342456-42342478 GAACAGAGGTGAGAAGGATGTGG - Intronic
1007787929 6:44292110-44292132 GAGCAGTGGTGAGCTGCTAGAGG - Intronic
1008295656 6:49772737-49772759 GAACAGTTTTGAGAAACATGTGG + Intergenic
1008762539 6:54870183-54870205 ATGCAGTGGTGAGAAGTATCTGG - Exonic
1009748764 6:67855686-67855708 GAGAAGTGCTGAGCAGAATGGGG - Intergenic
1010110358 6:72221024-72221046 GAGTATTGGTAAGAAACATGTGG + Intronic
1010142798 6:72631004-72631026 GGGCAGTGGTAGGAAGGATGGGG + Intronic
1012492333 6:99795816-99795838 CAGCAGAGGTGAGAGGCATCTGG - Intergenic
1013139410 6:107317021-107317043 GAGCAGTAGTGACCAGCATGGGG - Intronic
1014425352 6:121297897-121297919 GAGCACTGATGAGAAGCTAGAGG + Intronic
1014887841 6:126803475-126803497 GAGCTGTGTTGAGAAGGTTGAGG - Intergenic
1015177995 6:130332110-130332132 GAACAGAGGTGATAAGCTTGTGG + Intronic
1015701699 6:136042234-136042256 GGGGAGTGGGGAGAAGGATGAGG + Intronic
1016056759 6:139586172-139586194 GAACAGGGGTGAGAAACTTGGGG + Intergenic
1017035199 6:150261054-150261076 CAGGGGTGGTGAGAAGCAGGCGG - Intergenic
1019223916 6:170495474-170495496 GAGCGGTGGTGAAGAGGATGGGG + Intergenic
1019223950 6:170495631-170495653 GAGCGGTGGTGAAGAGGATGGGG + Intergenic
1019224137 6:170496468-170496490 GAGCGGTGGTGAAGAGGATGGGG + Intergenic
1019224145 6:170496505-170496527 GAGCGGTGGTGAAGAGGATGGGG + Intergenic
1019224171 6:170496622-170496644 GAGCGGTGGTGAAGAGGATGGGG + Intergenic
1020572968 7:9889920-9889942 GGGCAATGGTGAGAGTCATGAGG + Intergenic
1021668887 7:23014845-23014867 GACCAGTCTTGAGAAGGATGTGG - Intergenic
1022082968 7:27042448-27042470 GCGGAGGGGTGAGAAGAATGGGG - Intergenic
1022196736 7:28075301-28075323 GAGGAGTGGGGAGAAGCTTCTGG - Intronic
1022323271 7:29306899-29306921 ATCCAGTGGTGTGAAGCATGTGG + Intronic
1023181102 7:37484676-37484698 GAGCAGGGGTGAGCAGCCAGTGG - Intergenic
1024410804 7:49039054-49039076 GAGCACTGGTCAGAGTCATGAGG + Intergenic
1024525210 7:50342822-50342844 GAGCAGCGGTTAGCAGCAGGAGG - Intronic
1028013666 7:85680091-85680113 AAGCAGTGATGGGAAGCCTGGGG - Intergenic
1030082426 7:105789363-105789385 GAGCAGAAGAGAGAAGCATTAGG + Intronic
1030434864 7:109503967-109503989 AAAGAGTTGTGAGAAGCATGAGG + Intergenic
1031441394 7:121799108-121799130 GAGCTGTAGTGGGAAGGATGAGG - Intergenic
1033453464 7:141481888-141481910 GGGCAGGGGTGAGTAGGATGGGG + Intergenic
1033958821 7:146887028-146887050 GGGGAATGGAGAGAAGCATGAGG - Intronic
1034228357 7:149499859-149499881 GAGGAGAGGGGAAAAGCATGAGG - Intergenic
1034449858 7:151131571-151131593 GGACAGTGGAGAGAAGCTTGAGG - Intronic
1034497613 7:151431898-151431920 GAGAGGTGGTGAGAAGCAATGGG - Intronic
1036593008 8:10185847-10185869 GAGCTGTTGTGAGAATCATAAGG - Intronic
1037285749 8:17297656-17297678 GAGCAGTGGTTTAAAGCATAGGG - Exonic
1037632618 8:20671960-20671982 GTGCTGTGGTGAGAGGAATGGGG + Intergenic
1037806541 8:22060757-22060779 GAGCAGAGGTGAGAGGCCAGAGG + Intronic
1038664619 8:29527430-29527452 GGGGAGTGGTGAGGGGCATGAGG + Intergenic
1041162689 8:55061185-55061207 GAGCAGTGGTGAGGAGGTGGTGG - Intergenic
1043829154 8:84966871-84966893 AAGCAGTGGTGAGAACCCAGTGG - Intergenic
1045040748 8:98221687-98221709 GACCAGTGATGATAAGCATGAGG - Intronic
1045870661 8:106923400-106923422 GAGCAGGAGAGAGAACCATGGGG + Intergenic
1047403211 8:124563044-124563066 GAGCAGTGGTAAGAGGAAGGAGG + Intronic
1048277866 8:133080769-133080791 GGGCAGTGGTGAAGTGCATGAGG - Intronic
1048862390 8:138733583-138733605 GAGCAGTGGGGAGAAGTAAAGGG - Intronic
1050531958 9:6598514-6598536 GAGCAAGAGTGAGAAGAATGTGG + Intronic
1051284318 9:15480496-15480518 GCCCAGTGTTGATAAGCATGTGG + Intronic
1051750930 9:20340327-20340349 GAGCAGTGGAGGGAAGCTTTGGG - Intergenic
1052859952 9:33431510-33431532 GACCAGAGGTGGGAAACATGAGG + Intergenic
1053269951 9:36743058-36743080 CAGCGGTGGGGAGGAGCATGGGG - Intergenic
1053612484 9:39729083-39729105 GAGCAGTGGAGAGATGGAAGAGG + Intergenic
1053870516 9:42487054-42487076 GAGCAGTGGAGAGATGGAAGGGG + Intergenic
1054241030 9:62613310-62613332 GAGCAGTGGAGAGATGGAAGGGG - Intergenic
1054555163 9:66647834-66647856 GAGCAGTGGAGAGATGGAAGAGG - Intergenic
1056098910 9:83281796-83281818 AAGGAGTGGTGAGAAGGCTGGGG - Intronic
1056371261 9:85956918-85956940 GAGCAGTGGGGAGTGGCATGTGG + Intronic
1056682698 9:88732972-88732994 AAGCAGTGGTGAGATGGAAGGGG + Intergenic
1056765579 9:89442791-89442813 GGGAAATGGTGAGAAGGATGGGG - Intronic
1057814818 9:98286718-98286740 GAGCAGTGGTGTGGAGCAGCAGG + Intergenic
1060402215 9:123355708-123355730 GAGCACTGGGGAGCAGCAGGTGG + Intergenic
1060857736 9:126928275-126928297 GAGGAGTAGTGAGAAGGATCAGG + Intronic
1061178617 9:129011545-129011567 TAGCAGTGGTGACAAGCATGAGG + Intronic
1061394015 9:130333439-130333461 GAGTGGTGGGGAGAAGCAAGAGG - Intronic
1061874850 9:133538556-133538578 GAGCAGGGTTGAGAAGGCTGCGG + Intronic
1061954681 9:133955532-133955554 GGGGAGTGGGGAGGAGCATGTGG - Intronic
1185757854 X:2666278-2666300 GAGCAATGCTGAGAAGCTGGTGG + Intergenic
1185996449 X:4955429-4955451 GAGCAGAGGTGAGCAGAATTTGG - Intergenic
1186082879 X:5952396-5952418 GAGTAGGTGTGAGAAGGATGGGG + Intronic
1188750035 X:33893698-33893720 GAGTAGTGGTTGGAAGCATAAGG - Intergenic
1189775256 X:44464779-44464801 GGGCTGTGGTTAGAAGCCTGGGG - Intergenic
1190480562 X:50872660-50872682 GAGCAGTGGGGAGGAGGATAAGG - Intergenic
1191792168 X:64982474-64982496 GGCAAGTGGTGAGAAGGATGAGG - Intronic
1192165731 X:68826675-68826697 GAGCAGGGATAAGTAGCATGTGG + Intergenic
1192860057 X:75058128-75058150 GAAAAGTGGCGATAAGCATGAGG - Intronic
1193196594 X:78639489-78639511 GAGCAGTGGTGACATGCTGGAGG + Intergenic
1194359062 X:92925216-92925238 GATAAGTGTTGACAAGCATGTGG + Intergenic
1196008577 X:110862104-110862126 TAGCAGTGGTGAAAAGCAGTTGG + Intergenic
1196214543 X:113035380-113035402 GGGCACTGGTCAGAATCATGAGG - Intergenic
1196232509 X:113240336-113240358 GGGCACTGGTCAGAATCATGAGG - Intergenic
1196839468 X:119845668-119845690 TAGAAGTGGTGAGAAGAATGAGG + Intronic
1197147082 X:123183370-123183392 GAGCAGTGATGGGCAGTATGGGG - Intergenic
1198214736 X:134545726-134545748 GAGGCCTGCTGAGAAGCATGGGG - Intergenic
1198623523 X:138541485-138541507 GAGCAGTAGTTAGAAGTATAAGG - Intergenic
1199826306 X:151503957-151503979 GAGCAGTAGGCAGAAGCCTGGGG - Intergenic
1201391476 Y:13502168-13502190 TGGCAGTGGAGAGAAGCAAGTGG - Intergenic